ID: 934521408

View in Genome Browser
Species Human (GRCh38)
Location 2:95022431-95022453
Sequence CCCCTCCTGCGCTGACGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934521405_934521408 -7 Left 934521405 2:95022415-95022437 CCCTCAGTAACAGGTTCCCCTCC No data
Right 934521408 2:95022431-95022453 CCCCTCCTGCGCTGACGCCATGG No data
934521406_934521408 -8 Left 934521406 2:95022416-95022438 CCTCAGTAACAGGTTCCCCTCCT No data
Right 934521408 2:95022431-95022453 CCCCTCCTGCGCTGACGCCATGG No data
934521403_934521408 20 Left 934521403 2:95022388-95022410 CCTGTGGCAGTGCTGGGACTCAG No data
Right 934521408 2:95022431-95022453 CCCCTCCTGCGCTGACGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934521408 Original CRISPR CCCCTCCTGCGCTGACGCCA TGG Intergenic
No off target data available for this crispr