ID: 934521452

View in Genome Browser
Species Human (GRCh38)
Location 2:95022645-95022667
Sequence CTCTGGGAACACAAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934521452_934521460 6 Left 934521452 2:95022645-95022667 CCCACTTCCTTGTGTTCCCAGAG No data
Right 934521460 2:95022674-95022696 GTCCCAAGCCCTGTCCACCAGGG No data
934521452_934521468 19 Left 934521452 2:95022645-95022667 CCCACTTCCTTGTGTTCCCAGAG No data
Right 934521468 2:95022687-95022709 TCCACCAGGGCAGGTGCCTGGGG No data
934521452_934521459 5 Left 934521452 2:95022645-95022667 CCCACTTCCTTGTGTTCCCAGAG No data
Right 934521459 2:95022673-95022695 GGTCCCAAGCCCTGTCCACCAGG No data
934521452_934521467 18 Left 934521452 2:95022645-95022667 CCCACTTCCTTGTGTTCCCAGAG No data
Right 934521467 2:95022686-95022708 GTCCACCAGGGCAGGTGCCTGGG No data
934521452_934521466 17 Left 934521452 2:95022645-95022667 CCCACTTCCTTGTGTTCCCAGAG No data
Right 934521466 2:95022685-95022707 TGTCCACCAGGGCAGGTGCCTGG No data
934521452_934521463 10 Left 934521452 2:95022645-95022667 CCCACTTCCTTGTGTTCCCAGAG No data
Right 934521463 2:95022678-95022700 CAAGCCCTGTCCACCAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934521452 Original CRISPR CTCTGGGAACACAAGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr