ID: 934522748

View in Genome Browser
Species Human (GRCh38)
Location 2:95030269-95030291
Sequence GGCTGTGCCCCTATTGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 114}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934522744_934522748 -7 Left 934522744 2:95030253-95030275 CCTCCAGAGCCACAGAGGCTGTG 0: 1
1: 0
2: 7
3: 80
4: 758
Right 934522748 2:95030269-95030291 GGCTGTGCCCCTATTGCAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 114
934522740_934522748 25 Left 934522740 2:95030221-95030243 CCAACTAGGAAGTGAGACTGCCT 0: 1
1: 0
2: 1
3: 8
4: 115
Right 934522748 2:95030269-95030291 GGCTGTGCCCCTATTGCAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 114
934522741_934522748 5 Left 934522741 2:95030241-95030263 CCTTTCCAAATACCTCCAGAGCC 0: 1
1: 0
2: 1
3: 21
4: 223
Right 934522748 2:95030269-95030291 GGCTGTGCCCCTATTGCAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 114
934522745_934522748 -10 Left 934522745 2:95030256-95030278 CCAGAGCCACAGAGGCTGTGCCC 0: 1
1: 0
2: 1
3: 29
4: 364
Right 934522748 2:95030269-95030291 GGCTGTGCCCCTATTGCAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 114
934522742_934522748 0 Left 934522742 2:95030246-95030268 CCAAATACCTCCAGAGCCACAGA 0: 1
1: 0
2: 1
3: 16
4: 208
Right 934522748 2:95030269-95030291 GGCTGTGCCCCTATTGCAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 114
934522739_934522748 26 Left 934522739 2:95030220-95030242 CCCAACTAGGAAGTGAGACTGCC 0: 1
1: 0
2: 0
3: 5
4: 121
Right 934522748 2:95030269-95030291 GGCTGTGCCCCTATTGCAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934522748 Original CRISPR GGCTGTGCCCCTATTGCAGG TGG Intronic