ID: 934522748

View in Genome Browser
Species Human (GRCh38)
Location 2:95030269-95030291
Sequence GGCTGTGCCCCTATTGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 114}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934522739_934522748 26 Left 934522739 2:95030220-95030242 CCCAACTAGGAAGTGAGACTGCC 0: 1
1: 0
2: 0
3: 5
4: 121
Right 934522748 2:95030269-95030291 GGCTGTGCCCCTATTGCAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 114
934522740_934522748 25 Left 934522740 2:95030221-95030243 CCAACTAGGAAGTGAGACTGCCT 0: 1
1: 0
2: 1
3: 8
4: 115
Right 934522748 2:95030269-95030291 GGCTGTGCCCCTATTGCAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 114
934522742_934522748 0 Left 934522742 2:95030246-95030268 CCAAATACCTCCAGAGCCACAGA 0: 1
1: 0
2: 1
3: 16
4: 208
Right 934522748 2:95030269-95030291 GGCTGTGCCCCTATTGCAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 114
934522745_934522748 -10 Left 934522745 2:95030256-95030278 CCAGAGCCACAGAGGCTGTGCCC 0: 1
1: 0
2: 1
3: 29
4: 364
Right 934522748 2:95030269-95030291 GGCTGTGCCCCTATTGCAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 114
934522744_934522748 -7 Left 934522744 2:95030253-95030275 CCTCCAGAGCCACAGAGGCTGTG 0: 1
1: 0
2: 7
3: 80
4: 758
Right 934522748 2:95030269-95030291 GGCTGTGCCCCTATTGCAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 114
934522741_934522748 5 Left 934522741 2:95030241-95030263 CCTTTCCAAATACCTCCAGAGCC 0: 1
1: 0
2: 1
3: 21
4: 223
Right 934522748 2:95030269-95030291 GGCTGTGCCCCTATTGCAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934522748 Original CRISPR GGCTGTGCCCCTATTGCAGG TGG Intronic
900667634 1:3826026-3826048 GGCTGGGCCTCCCTTGCAGGTGG + Intronic
903539666 1:24089877-24089899 GGCTGTGGCCCTCCTGGAGGAGG - Intronic
904438710 1:30516027-30516049 GGATGTGCCCCTGCTGCAGGGGG - Intergenic
906551465 1:46669259-46669281 GGCTCTGCCCCTGTCCCAGGAGG - Intronic
915526014 1:156476733-156476755 GGATTTGCCACTATAGCAGGAGG - Intronic
915955308 1:160215796-160215818 GTCTGTGTTCCTATTGCTGGTGG - Exonic
918795202 1:188885617-188885639 GGCTGTGCCCGTGTGGCAGCAGG + Intergenic
921078996 1:211723977-211723999 GGCCATGCCCCTACTGCAGTGGG + Intergenic
1063121482 10:3107873-3107895 GGCTGTGCCCCTGCTGTAGACGG + Intronic
1064270333 10:13859601-13859623 AGCTGTGTCCCTAATGCATGCGG - Intronic
1064870849 10:19935285-19935307 GGCTGTGCCTCTCTTGCAGCTGG - Intronic
1065831849 10:29621660-29621682 GGCTGTGGGCCCATGGCAGGAGG + Intronic
1067702411 10:48583348-48583370 GGCTGTACCCCTACCCCAGGGGG - Intronic
1071137429 10:82468283-82468305 GGGTGGGCGCCTATGGCAGGAGG + Intronic
1075551493 10:123395894-123395916 GGGTGTCCCGCTATTGCTGGTGG + Intergenic
1075615313 10:123886469-123886491 TGCTGGGCCCCAGTTGCAGGGGG - Intronic
1077638015 11:3856315-3856337 GGCTCTGGCCCTGGTGCAGGAGG - Exonic
1084013224 11:66364136-66364158 GGCCGTCCCTCCATTGCAGGCGG + Intronic
1085402988 11:76245689-76245711 GGCTGAGCCCCAACAGCAGGAGG + Intergenic
1091434764 12:463649-463671 AGCTGTGCCCCCATTTCAAGAGG - Intronic
1092236651 12:6814778-6814800 GGCTCTGCCCCTGAAGCAGGTGG - Exonic
1095664098 12:44774552-44774574 TGCTATGCCCCTATTCCAGTAGG - Intronic
1097018761 12:56005538-56005560 GGGAGTGAGCCTATTGCAGGAGG + Intronic
1098917678 12:76274271-76274293 GGCTGGGCCCCTGTTCCAGGAGG + Intergenic
1100434901 12:94562357-94562379 AGCTGTGTCCCTAGAGCAGGCGG - Intergenic
1103893675 12:124258651-124258673 GGCTCTGCCCAGGTTGCAGGAGG + Intronic
1105049796 12:133037924-133037946 GGCTCTGCCGCTATCGAAGGAGG + Exonic
1105303013 13:19152054-19152076 GCCTCTGGCCCTTTTGCAGGAGG + Intergenic
1108680001 13:52771888-52771910 GGCTGTCCAGCTATGGCAGGTGG - Intergenic
1113533591 13:111046703-111046725 GGAGGTGCCCCTGTTGCACGTGG - Intergenic
1115640402 14:35332174-35332196 GGCTCTGGCCTTACTGCAGGGGG + Intergenic
1122540507 14:102495472-102495494 GGCTAAGCCCCCATTCCAGGGGG + Intronic
1123119155 14:105908990-105909012 GGCTCTGACCCTCCTGCAGGGGG + Intergenic
1126477010 15:49076186-49076208 GGGTGTGCCCATAATGCTGGAGG - Intergenic
1132748578 16:1447083-1447105 AGCTGTGCCCCTGCTGCAGGAGG - Exonic
1135944779 16:26856391-26856413 GACTGTGCACCTACTGGAGGAGG + Intergenic
1140935392 16:79665132-79665154 GACTGTTAACCTATTGCAGGTGG + Intergenic
1141898363 16:86973112-86973134 GGTTGTGCCCCTAGTACAGATGG + Intergenic
1141919405 16:87126001-87126023 AGCTGTGCCCATATGGCTGGAGG - Intronic
1142362447 16:89633867-89633889 GGCTGTGCCCCTGTCTCGGGGGG - Intronic
1142428601 16:90013831-90013853 GGCTGTGCTCCCATTTTAGGGGG + Intronic
1142903890 17:3029748-3029770 CGCTGTGCCCCGCTGGCAGGAGG - Intronic
1144834774 17:18151113-18151135 GGCTGTGCCTCTGGTGCTGGGGG - Exonic
1148784791 17:50140752-50140774 GGTAGTACCCCTCTTGCAGGGGG + Intronic
1148865311 17:50625259-50625281 GGCTGTGGCCTTATCACAGGTGG - Intronic
1148906588 17:50916250-50916272 AGCTGTGCCCATTTTACAGGAGG + Intergenic
1151765409 17:76131085-76131107 GGCTGTGTCCTTAGTGCAGTTGG - Intergenic
1152177663 17:78798399-78798421 GACTGTGCCCCTGTGGAAGGAGG - Exonic
1153279531 18:3401261-3401283 GGCTCTGCACCTAGTGTAGGAGG + Intergenic
1158421868 18:57302029-57302051 GGCAGTGCCCCAGCTGCAGGAGG - Intergenic
1161515728 19:4695280-4695302 GGCTGAGCGCCAATGGCAGGTGG - Intronic
1162398570 19:10431698-10431720 GTCTGTGCCTCAATTGCACGTGG - Intronic
1163426797 19:17244806-17244828 TGCTGTGCCCCTATCTCAGAGGG + Intronic
1163667590 19:18610548-18610570 GGCTGTCCCCCTAAAGCAGCTGG - Intronic
1164281703 19:23774785-23774807 GTCTGTGCCCTGATTTCAGGAGG + Intronic
1164636097 19:29792496-29792518 GGGTGTGCCTCCATTCCAGGAGG + Intergenic
1165824082 19:38695676-38695698 GGCTCTGTCCCTTCTGCAGGAGG + Intronic
925917391 2:8616327-8616349 GTCTGTGCCCCAATCCCAGGAGG - Intergenic
926105408 2:10146618-10146640 CGCTCTGCCCCTGCTGCAGGTGG + Intronic
926107501 2:10161445-10161467 GGCTGTGCCCCTCGTGCACGCGG - Intronic
927198344 2:20563415-20563437 GGCTGGGCCCTCATTGCTGGGGG - Intronic
931245595 2:60490035-60490057 GCCTTTGCCCCCATTGCAGATGG - Intronic
934522748 2:95030269-95030291 GGCTGTGCCCCTATTGCAGGTGG + Intronic
941395713 2:164970299-164970321 GGCTGAGCTCCTATGGCAAGTGG - Intergenic
945401834 2:209391812-209391834 GATTGTGCCCCTATTGGAGATGG - Intergenic
948291038 2:236825005-236825027 GGCTGTGCCACTTATCCAGGTGG + Intergenic
948605058 2:239129645-239129667 GGCTGTGTCCCTATGGCTGCCGG + Intronic
1170149374 20:13213517-13213539 GGCTGTGACCATATTAGAGGAGG - Intergenic
1170998997 20:21395748-21395770 GGCTGTGAACCTCTTGCTGGGGG - Exonic
1174519458 20:51118504-51118526 GGCTGAGTCCCTAGGGCAGGAGG - Intergenic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1176101680 20:63367365-63367387 GGCTGTGCCCCTGCTGCCAGGGG + Intronic
1178631438 21:34264615-34264637 GGCTGGGCTCCTTTTCCAGGAGG + Intergenic
1179462664 21:41548226-41548248 GGGTGAGCCCCTAAAGCAGGTGG + Intergenic
1183549661 22:38474448-38474470 GGCTGTGCACCTCTTGAGGGTGG + Intronic
1184235471 22:43180783-43180805 GGCTGTGGCCCTGGTGCTGGAGG - Exonic
955126302 3:56115854-56115876 GTGTGTGCTCCTAATGCAGGAGG - Intronic
960311737 3:116125070-116125092 TGATGTGCTCCTATTGCATGTGG + Intronic
961646339 3:128394743-128394765 GGATGGGCCCCTCCTGCAGGCGG - Intronic
963230314 3:142902996-142903018 GGCAGTGTCCCTTTTGCTGGTGG - Intergenic
965114439 3:164469848-164469870 AGCTGTGCCCCTACTGCTGTAGG + Intergenic
966667810 3:182491839-182491861 ATCTGTGCCCCTATTCCAGATGG - Intergenic
970504249 4:16710914-16710936 GGCTCTGCCCTTATTGCCTGTGG + Intronic
972247957 4:37265881-37265903 GGCTGTGCACATCTTTCAGGGGG + Intronic
978128977 4:105170877-105170899 GGCAGTGCTCATCTTGCAGGAGG - Intronic
985173575 4:187177174-187177196 AGCTGTGCTCCTCTTGCAGACGG + Intergenic
988900545 5:35727749-35727771 GGCTGTGGCACTATTGCAACAGG - Exonic
991248317 5:64531534-64531556 GGCTGTGACCTTATTGCATGGGG - Intronic
991931396 5:71756378-71756400 GGCTCTGCCCCCTGTGCAGGCGG + Intergenic
995206250 5:109484875-109484897 GGCTCTGCCCCTTGTGCAGTCGG + Intergenic
997601358 5:135140916-135140938 GGCTCTGCCCATATTATAGGAGG - Intronic
999141604 5:149366044-149366066 GGCTGAGTCCCTGCTGCAGGTGG + Exonic
1002424613 5:179167764-179167786 AGTTGTGCCCATTTTGCAGGTGG - Intronic
1002676938 5:180924510-180924532 GGCTGTGCTCCTGTGACAGGTGG - Intronic
1005136753 6:22577638-22577660 GGGTGTGCCTGCATTGCAGGAGG + Intergenic
1007605431 6:43114507-43114529 GGCTGTGCCCCCATTCCAGGGGG - Intronic
1011223801 6:85085250-85085272 TGCTGTGCTCCTAATGCAGGGGG - Intergenic
1015551881 6:134420389-134420411 GGCTGTGTCCCTCTATCAGGAGG - Intergenic
1017206331 6:151807824-151807846 GGCTGTGCTCTTTTTCCAGGTGG + Exonic
1018051654 6:160014470-160014492 GGCTGTCTCCCTACTCCAGGAGG - Intronic
1019129967 6:169866255-169866277 GGCTGTGCCACCGTGGCAGGAGG + Intergenic
1019519550 7:1454555-1454577 GCCTGTCCACCTACTGCAGGGGG - Intronic
1020213304 7:6171050-6171072 GGCCGGGCACCTCTTGCAGGCGG - Intronic
1022894129 7:34732315-34732337 AGCTGGGCCCCTCTTGCAGAAGG - Intronic
1033450819 7:141461095-141461117 GGATGTGCCACTGTTGAAGGAGG + Intronic
1033798123 7:144871481-144871503 GGCTGGGCCCCTAATTCAGTAGG - Intergenic
1035708439 8:1695210-1695232 GGCTGTGCCCCTCTTTCTGTAGG - Intronic
1041015193 8:53586052-53586074 GGCTGTTCCCCTAGTGCTGCAGG - Intergenic
1043448370 8:80341379-80341401 AGCTGTGCTCCTAATCCAGGAGG - Intergenic
1044698319 8:94944753-94944775 GGCTGTGGCTCTACTACAGGTGG + Intronic
1049040381 8:140108283-140108305 GGCTGTGCCCCTAGTGGCTGTGG - Intronic
1049254095 8:141604806-141604828 GCCAGTGCCCCTATGGCAGATGG + Intergenic
1049385709 8:142341989-142342011 GGGTCAGCCCCTATTGTAGGTGG - Intronic
1049751941 8:144289046-144289068 GGCTGTCCCCCATGTGCAGGTGG - Intronic
1049873427 8:144999684-144999706 GGCTGTACCCCTCTCCCAGGAGG - Intergenic
1053175235 9:35917720-35917742 GGCTGTGCCTGTATCTCAGGAGG - Intergenic
1054463749 9:65480600-65480622 GGCTGTGCAACTTTCGCAGGTGG - Intergenic
1062048582 9:134435655-134435677 GGCTGCACCCCCACTGCAGGTGG - Intronic
1062049986 9:134442311-134442333 GGCTGTGCCCAGAGTCCAGGGGG - Intergenic
1062553261 9:137100146-137100168 GGCTGTGCTTCTCTTGCAGCTGG + Intronic
1189276201 X:39787794-39787816 GGCTGGGCCTCATTTGCAGGGGG - Intergenic
1200986145 Y:9304795-9304817 GGCTGTGTCCTTACTGAAGGTGG - Intergenic
1202124438 Y:21556107-21556129 GGCTGTGTCCTTACTGAAGGTGG + Intergenic
1202154570 Y:21873273-21873295 GGCTGTGTCCTTACTGAAGGTGG - Intergenic