ID: 934522947

View in Genome Browser
Species Human (GRCh38)
Location 2:95031321-95031343
Sequence TGTCCCTTCATTCCTGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934522947_934522955 12 Left 934522947 2:95031321-95031343 CCCCCAACAGGAATGAAGGGACA 0: 1
1: 0
2: 2
3: 10
4: 193
Right 934522955 2:95031356-95031378 TGGGAAGCTCACACCTCCTCTGG 0: 1
1: 0
2: 0
3: 19
4: 173
934522947_934522952 -8 Left 934522947 2:95031321-95031343 CCCCCAACAGGAATGAAGGGACA 0: 1
1: 0
2: 2
3: 10
4: 193
Right 934522952 2:95031336-95031358 AAGGGACAGCTCAGGACCACTGG 0: 1
1: 0
2: 2
3: 15
4: 222
934522947_934522956 13 Left 934522947 2:95031321-95031343 CCCCCAACAGGAATGAAGGGACA 0: 1
1: 0
2: 2
3: 10
4: 193
Right 934522956 2:95031357-95031379 GGGAAGCTCACACCTCCTCTGGG 0: 1
1: 0
2: 1
3: 18
4: 181
934522947_934522953 -7 Left 934522947 2:95031321-95031343 CCCCCAACAGGAATGAAGGGACA 0: 1
1: 0
2: 2
3: 10
4: 193
Right 934522953 2:95031337-95031359 AGGGACAGCTCAGGACCACTGGG 0: 1
1: 0
2: 0
3: 24
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934522947 Original CRISPR TGTCCCTTCATTCCTGTTGG GGG (reversed) Intronic
902755381 1:18545947-18545969 TGTCCCTCCTTTCCAGTTGAGGG + Intergenic
904128096 1:28256552-28256574 AATGCCTTCATTCCTGTTTGTGG - Intergenic
904582425 1:31555151-31555173 TCTCTCTTCATTCTTGTTAGAGG + Intergenic
905889639 1:41511076-41511098 TGTCCCTTGATTCCCATCGGTGG - Exonic
908807886 1:67949476-67949498 TGGCCCCTGATTCCTGTGGGAGG - Intergenic
912809093 1:112780286-112780308 TGTCCCTTCATTTCTATGTGTGG + Intergenic
915597561 1:156904263-156904285 CGTCCCTTAGTTCCTGTGGGAGG + Intronic
916744000 1:167670431-167670453 TGCCCCTGCATGCCTGCTGGTGG + Intronic
917267935 1:173241767-173241789 TGACCCTTGTTTCCTGTGGGAGG + Intergenic
920740857 1:208579859-208579881 TGTACCTAGACTCCTGTTGGAGG + Intergenic
920938237 1:210456076-210456098 TGTCCCTCCAGGCCTGTTGATGG + Intronic
921318981 1:213918977-213918999 TGTACCTTCACTCCTGTTGCTGG - Intergenic
921667312 1:217888255-217888277 TGTCCCATGTTTCCTGGTGGAGG + Intergenic
921759875 1:218900676-218900698 TATCCCTTCAGTCCTGTGAGGGG + Intergenic
923327607 1:232894719-232894741 AGTCCCTTCATTCCTGTTGCTGG - Intergenic
924688324 1:246319717-246319739 TGTTACTTCATTGTTGTTGGTGG - Intronic
1063519672 10:6729773-6729795 TGTCTTTTCATTCCAGTCGGAGG + Intergenic
1064797648 10:19031394-19031416 TGTCTCTTCACTTCTGCTGGAGG + Intergenic
1066406840 10:35126858-35126880 TGGCGCTTCACTCCTGCTGGCGG + Intronic
1067728855 10:48794367-48794389 TCTCCCTTCCTTCCTGTCGGCGG - Intronic
1067834717 10:49631534-49631556 TGTCACTTCATTCCTCTTATGGG - Intronic
1067987012 10:51160729-51160751 TCTCCCTTTTTTACTGTTGGGGG + Intronic
1068063384 10:52098319-52098341 TGTCCCTGAATTACTGATGGAGG + Intronic
1069003450 10:63291854-63291876 TGTCTCTTCATTTCTTTGGGTGG + Intronic
1069211275 10:65762502-65762524 TGTCCTTACATTACTGTTTGTGG - Intergenic
1070735822 10:78863065-78863087 TGTCCCTTCTCTCAGGTTGGTGG - Intergenic
1073195747 10:101689874-101689896 TGTACATTCATTCCTGTGGAGGG - Intronic
1073401832 10:103263950-103263972 TAACCCTTCATTCCTTCTGGTGG + Intergenic
1074228433 10:111510572-111510594 TCACCCCTCATTCTTGTTGGAGG + Intergenic
1074471310 10:113729289-113729311 TCTCCTTTCTTTCCTGTTGAAGG + Exonic
1075686423 10:124367951-124367973 TGTCCCTTGATTCCTGTCCTCGG - Intergenic
1075835506 10:125449477-125449499 TGTTCCTTCATTTCTTTTGAGGG - Intergenic
1080805359 11:35648141-35648163 TGTCCCTTCCTTCCTGCTTTAGG - Intergenic
1083315239 11:61810876-61810898 TGTCCCTGCTTTTCTGTAGGGGG - Exonic
1083318012 11:61828189-61828211 TGTCCCTGCCTTCCTGGCGGAGG - Exonic
1084494285 11:69495147-69495169 TGTCCATGCTTTCCTGCTGGAGG - Intergenic
1086917231 11:92544909-92544931 TGACTCTTCATAGCTGTTGGAGG + Intronic
1088610604 11:111572680-111572702 TGTCCCTTAAGTAGTGTTGGAGG - Intergenic
1089405422 11:118193697-118193719 TGGTTCTTCATTCCTGCTGGTGG - Intergenic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1090363207 11:126187266-126187288 TGTCCCTTCTCTCCTCTGGGTGG - Intergenic
1091651055 12:2310290-2310312 TGCCCCATCTTTCCTGTTGAGGG - Intronic
1092980367 12:13788652-13788674 TTTCCCTTCTTTCCTTTTCGAGG + Intronic
1094489585 12:30950800-30950822 TCTCCCTTTCTTTCTGTTGGTGG - Intronic
1094709903 12:32951519-32951541 TGTTGCTTCATGGCTGTTGGCGG + Intergenic
1094746246 12:33347420-33347442 TCTCCCTTGAATCCTTTTGGAGG + Intergenic
1096587916 12:52635630-52635652 TGTCAATTCATTCCTTTTTGTGG - Intergenic
1097792303 12:63827973-63827995 TTTCTCTATATTCCTGTTGGTGG - Intergenic
1099594794 12:84647209-84647231 TGTCCCTTGAATGCTTTTGGTGG - Intergenic
1100176060 12:92032180-92032202 TGTGCCTTCATTCAGTTTGGTGG - Intronic
1101598699 12:106189715-106189737 TCTCTCTTCATTCCAGTTGCAGG - Intergenic
1103579217 12:121901976-121901998 TGGCCCTTCATTCCTTTTTATGG + Intronic
1104043667 12:125146447-125146469 GATTCCTTCATTCCTGTGGGAGG - Intergenic
1106338591 13:28807091-28807113 TGCCCATTCATTGCTGTTGCTGG - Intergenic
1110943695 13:81386150-81386172 TGTCCATCCATTACTTTTGGGGG + Intergenic
1111213960 13:85119210-85119232 TGTCCCTTCAGTCCTATGAGAGG + Intergenic
1112632633 13:101179457-101179479 AATCCCTCCATTTCTGTTGGGGG + Intronic
1113792899 13:113040049-113040071 TGTCTGTTCATTCTTGTTGCTGG - Intronic
1115149413 14:30267232-30267254 TGTGCCTTTATTTCTCTTGGGGG - Intergenic
1116209539 14:41916950-41916972 TGTCCTTTCATTTCAATTGGAGG + Intergenic
1117424734 14:55581319-55581341 TGGCCCTTCTTTCCTGTGGGAGG + Intronic
1118331674 14:64820256-64820278 TTTCCCTTCAGTACTGTTGTTGG - Intronic
1120150588 14:81028782-81028804 TGTGCATTCATTTCTGTTGCTGG - Intronic
1121397533 14:93639996-93640018 TCTGCCTTCTTTCCTGTTTGAGG + Intronic
1123842310 15:24260859-24260881 TGCCCCCTCAATCCTTTTGGAGG + Intergenic
1126882100 15:53110276-53110298 TATGCCTTTATTCCTGGTGGAGG - Intergenic
1129186705 15:73911702-73911724 TGTTCCTCCTTTCCTGTTAGTGG + Intergenic
1129689240 15:77703978-77704000 TGTCCCTTTATTCCTTTTCAGGG - Intronic
1132690963 16:1181733-1181755 TCTCCTTTCATTCCTGGAGGTGG + Intronic
1136277436 16:29187215-29187237 TGTCCCCTCACTTTTGTTGGGGG + Intergenic
1136374909 16:29859582-29859604 TGTGCCTTCATTAGTGCTGGGGG - Intronic
1137591369 16:49696124-49696146 TCTCCCTTCATTCCCTTTGTGGG - Intronic
1139581649 16:67877408-67877430 TATCCATTCCTTCCTGTGGGTGG + Intronic
1141149262 16:81552840-81552862 TGTTCCTTCATTGCTGTGGCTGG + Intronic
1141885654 16:86890479-86890501 TGTACCCTCCTGCCTGTTGGGGG + Intergenic
1143252681 17:5534755-5534777 TGTCGCTTCATTGCTTCTGGGGG + Intronic
1146093379 17:29904851-29904873 TGTCCCTGCTTGCCTGTTGTTGG - Intronic
1150531119 17:65982877-65982899 TGTCACTTCATTCCTTTTGATGG - Intronic
1152014553 17:77741865-77741887 TCTCCCTCCATCCCTGATGGCGG + Intergenic
1153838165 18:8982947-8982969 GGTCCCTTCGTTCCTGGTAGTGG - Intergenic
1155366326 18:25052363-25052385 TGTCCCTTCACTGCAGTTTGGGG - Intergenic
1155400773 18:25436740-25436762 TGTCCATTCATTCCTCTTCTTGG + Intergenic
1156265264 18:35482402-35482424 TCTACATTCATTCATGTTGGGGG + Intronic
1160513860 18:79467768-79467790 TTTTCCTTGATCCCTGTTGGGGG + Intronic
1162189644 19:8934718-8934740 TATTCCTTCAGTCCTGTTTGGGG + Intronic
1162936677 19:13984755-13984777 TGGCCCTTCAGTCCTGCCGGGGG - Intronic
1163185948 19:15640010-15640032 TTTCCCTTCACTCCTTTTTGGGG + Intronic
1163274082 19:16271963-16271985 TGGCCCTTCATTCCTTTTTAAGG + Intergenic
1163405631 19:17120347-17120369 TGGCCCTTCATTCCTTTTTATGG - Intronic
1163687624 19:18720909-18720931 AGTCCTTCCTTTCCTGTTGGTGG + Intronic
1163696171 19:18764620-18764642 TGACACATCATTCCTGCTGGAGG - Intronic
1164965420 19:32479072-32479094 TGTCACTTTTTTCATGTTGGCGG + Intronic
1165715772 19:38044878-38044900 TGCCACGTCAGTCCTGTTGGTGG - Intronic
1166440966 19:42815033-42815055 TGTCCCTTCATTTCTAATGAAGG + Intronic
1166460440 19:42983639-42983661 TGTCCCTTCATTTCTAATGAAGG + Intronic
1166477737 19:43143616-43143638 TGTCCCTTCATTTCTAATGAAGG + Intronic
1167997975 19:53421894-53421916 TGTCCATTAATTCCTGTGGTAGG + Intronic
1168007402 19:53502184-53502206 TGTCCATTAATTCCTGTGGTAGG + Intergenic
1168176062 19:54628804-54628826 TGTCCCTGCCTTTCTGATGGTGG - Intronic
925046888 2:778959-778981 TGTCCTTACATTCCTGGGGGTGG - Intergenic
925183635 2:1832555-1832577 TGTCCTTCCTTTCATGTTGGAGG + Intronic
925190071 2:1875522-1875544 TGTCCCATCCTTCCTGTTCAAGG + Intronic
926629018 2:15119940-15119962 ACTCCCTGCATTCCTGTTGCAGG - Intergenic
927696968 2:25245534-25245556 TGTCACTCCATCCCTGTTTGTGG - Intronic
931303055 2:61000059-61000081 TGTCCCTTGATATCTGTGGGGGG - Intronic
932317525 2:70795858-70795880 TTTCCCTCCATGCCTGTGGGCGG + Intergenic
934522947 2:95031321-95031343 TGTCCCTTCATTCCTGTTGGGGG - Intronic
936404673 2:112192281-112192303 TGTTCATACATTGCTGTTGGGGG - Intergenic
937002242 2:118478309-118478331 TGTCCTTTGATATCTGTTGGGGG + Intergenic
937280455 2:120713985-120714007 TCTCCCTTCACCCCTGTTGCAGG - Intergenic
937447183 2:121968444-121968466 TGTCCCTTCAGCCCTGTTGTTGG + Intergenic
938930019 2:136078534-136078556 TGTGCCTTAATTCCTTTGGGTGG + Intergenic
939499930 2:142971152-142971174 TGGACCTTCATTCCTATAGGTGG + Intronic
941316936 2:164004896-164004918 TGTGCCTCCATTTCTGTTGATGG - Intergenic
941958918 2:171234476-171234498 TGTATCTTCATTCCTGTAGAGGG + Intergenic
942983635 2:182112562-182112584 TGGCCCTTAACTCCTATTGGGGG - Intronic
947210648 2:227705510-227705532 TGACCCATCATTCCTGTTACTGG - Intronic
1169461839 20:5802289-5802311 AGGCCCTGCTTTCCTGTTGGTGG + Intronic
1171974287 20:31584281-31584303 TCTCCCTTCTTCCCTATTGGAGG + Intergenic
1172245153 20:33440861-33440883 TGTCTCTTGATTCCGGTTTGAGG - Intronic
1173844490 20:46179242-46179264 GGGCCCTGCATTCCTGCTGGGGG + Intronic
1175147335 20:56906892-56906914 TTTCCCTTCATTCCTCTGGCTGG - Intergenic
1175437205 20:58961857-58961879 AGTCACTCCATTCCTGTTGATGG + Intergenic
1178550190 21:33530961-33530983 TGTCCCTTAATTCTTCTTTGAGG + Intronic
1181616921 22:24061261-24061283 TGGCCCCTTACTCCTGTTGGAGG + Intronic
1183276130 22:36899441-36899463 GTTCTCTTCATTCCTGTTAGGGG - Intergenic
1183523150 22:38308269-38308291 AGTACTTTCATTCCTGTTGCTGG - Intronic
1183964231 22:41431776-41431798 TGTCCCTGCATCCCTGTGTGTGG - Intergenic
1184364068 22:44038155-44038177 TGTCCCTGCATTCCTGTTTCAGG + Intronic
1184856414 22:47148955-47148977 TGTCCCTTCATGCCGGTTCTAGG + Intronic
1185203957 22:49526125-49526147 TGTACCTTCAGGCATGTTGGGGG - Intronic
949351287 3:3127041-3127063 TGCCCCTTCCTTCCTGCTGTGGG + Intronic
950936904 3:16848177-16848199 AGTCCCTTCATTCCTGAAGTGGG + Intronic
952850580 3:37725172-37725194 TGTGGCTTCATTCCAGTGGGAGG + Intronic
953967693 3:47322628-47322650 TGTCCAGTCATTGCTGATGGGGG + Exonic
954144857 3:48629463-48629485 TGTCCCTTCATACCTCTAGAGGG + Intronic
955136834 3:56227357-56227379 TTTGCTTTCTTTCCTGTTGGAGG - Intronic
955835231 3:63047311-63047333 TGACCCTTGGTTCCTGTGGGAGG - Intergenic
956641998 3:71424193-71424215 TGTCCCTTCCTTCTTGCTGCTGG - Intronic
957256548 3:77844805-77844827 TGTCTGTTGATTCCTGCTGGAGG + Intergenic
957289414 3:78258935-78258957 AGTCCCTTCTTCCCTGTGGGAGG + Intergenic
960005936 3:112781197-112781219 TGTCCCTTCAGTCCTGTGGGTGG + Intronic
962102611 3:132358228-132358250 TGTCCCTTCCTTCCTTTTTTTGG - Intronic
963580635 3:147122689-147122711 TGTCCCTTGGTTCCTGTGGGAGG - Intergenic
963637028 3:147810958-147810980 TGCCCCTTCGTTCCTGAAGGAGG - Intergenic
963941730 3:151102471-151102493 TGTCTCTTTTTTGCTGTTGGTGG - Intronic
963961908 3:151318880-151318902 TGTCCCTTCACTACAGTAGGTGG + Intronic
965401878 3:168222155-168222177 TATCCCTACATTCCAATTGGAGG - Intergenic
965515357 3:169615969-169615991 TGTTCAATCATTCCTGTTGGTGG + Intronic
966433423 3:179856740-179856762 TTTCCCTTCATTCCTTAGGGAGG + Intronic
967836154 3:193964820-193964842 TGTCCCTTGATACTTTTTGGAGG - Intergenic
967967053 3:194969847-194969869 TGTCCTTTCATTCCTTTTCTAGG - Intergenic
968881266 4:3301410-3301432 TTTCCCTTGAATCCTGTAGGTGG + Intronic
970404896 4:15753659-15753681 TGTCCCATCATTGCCTTTGGTGG - Intergenic
970911016 4:21275717-21275739 TGTCCTTTCCTTCCTGTTGTAGG + Intronic
983120174 4:163873715-163873737 TTTCCCTTCCTTCCTGTTCTTGG + Intronic
986228601 5:5840801-5840823 TATCCCTTCATGCCTATGGGTGG - Intergenic
987313077 5:16699265-16699287 TGTCCCTTCATTCATCTAAGTGG + Intronic
987749465 5:22020599-22020621 TGTCAATTGATTCCTGATGGAGG + Intronic
989270959 5:39532307-39532329 TTTCCCTCCATTTCTGTTGAAGG - Intergenic
996816128 5:127574165-127574187 TGCCCCTTATTTCCTCTTGGTGG - Intergenic
998288917 5:140893359-140893381 TGTCCCATAAATGCTGTTGGTGG - Intronic
998587667 5:143445237-143445259 TGTCACTGCATTCCAGCTGGGGG - Intergenic
999256641 5:150213288-150213310 GGGCCCTTCATTCCTGTTCTGGG + Intronic
1001323464 5:170701786-170701808 TGTCCCCTTTTTCCTGTTGTTGG + Intronic
1001405241 5:171471770-171471792 GGCCCCTTCATTCCTCTTGAGGG + Intergenic
1003751393 6:9062080-9062102 TGTCTCTTCATTCTGGGTGGTGG + Intergenic
1003776185 6:9368263-9368285 TATCACTTCATTCTTTTTGGTGG - Intergenic
1005087858 6:22025446-22025468 TTTCCATTCATTGCTGTGGGTGG + Intergenic
1006613745 6:35311275-35311297 TGACCCTTTAGTCCTCTTGGTGG + Intronic
1007910235 6:45506117-45506139 CTTCCCTTTATTCCTGGTGGTGG + Intronic
1012008887 6:93754523-93754545 TGTCGCTTCATACCTGTGGTAGG + Intergenic
1013637777 6:112045324-112045346 TGTCCCTCCATCCATGGTGGGGG + Intergenic
1014012438 6:116491797-116491819 TATCCCTTCCTGTCTGTTGGTGG + Intergenic
1014242707 6:119035317-119035339 TGTCCCTGAATTCCAGTGGGAGG - Intronic
1014306786 6:119752918-119752940 TGTCCCTTTTTTACTGTTGTTGG + Intergenic
1016730078 6:147419554-147419576 TGCCTTTACATTCCTGTTGGTGG + Intergenic
1018302796 6:162421199-162421221 TGTTGCTTCCTTCCTGATGGAGG - Intronic
1019188985 6:170239011-170239033 TTTCGCTCCATTGCTGTTGGTGG - Intergenic
1019603275 7:1895870-1895892 TGTCCCTTCTTTCCAGTGGCAGG - Intronic
1023199478 7:37680189-37680211 TTTCCCTTAGTTCATGTTGGTGG + Intergenic
1027967127 7:85026217-85026239 TGTTCATTCATTCCTGGTGTTGG - Intronic
1031173927 7:118325147-118325169 TGTAACCTCATTCCTCTTGGAGG - Intergenic
1033854265 7:145538262-145538284 TGTCCCTTCATATGTGTTGTAGG + Intergenic
1037593653 8:20335486-20335508 TTTTCATTTATTCCTGTTGGAGG + Intergenic
1039977557 8:42380326-42380348 CCTCCCTTCCTTCTTGTTGGTGG - Intergenic
1040607708 8:48951010-48951032 TGCCCCTTCCATCCTGTGGGTGG + Intergenic
1042506039 8:69561856-69561878 TGTCCCTTCATGCCTGTATCAGG + Intronic
1043547858 8:81335401-81335423 GGTCCCTTCATTCCTGGGAGGGG + Intergenic
1044679308 8:94761228-94761250 TGTTCCCTCAGTCCTGGTGGTGG - Intronic
1048270483 8:133024162-133024184 TGTGCCTTCAACTCTGTTGGTGG + Intronic
1048389841 8:133952263-133952285 TGTGCCTGCACACCTGTTGGCGG - Intergenic
1049435068 8:142582727-142582749 TGGCCCCTCAGTCCTGCTGGAGG + Intergenic
1052237931 9:26235067-26235089 TGCCCCCTCATTCCTGAGGGAGG - Intergenic
1055565717 9:77566679-77566701 TGTATTGTCATTCCTGTTGGTGG - Intronic
1056176436 9:84041204-84041226 TTTTCCTTCATTTCTGTTGCGGG + Intergenic
1056414049 9:86359327-86359349 AGTCCCTCCCTTCCTGTAGGTGG + Intergenic
1056970447 9:91196555-91196577 TGACCCCTCTTTCCTGCTGGGGG + Intergenic
1062555164 9:137110517-137110539 TGTCCCGTCCTTCCTGTCTGTGG - Intergenic
1186187802 X:7039210-7039232 TGTCCCTTCATTTCTAATGAAGG + Intergenic
1189589940 X:42500139-42500161 TGTCCCTTCATACTTGTGGAGGG - Intergenic
1189676714 X:43468117-43468139 TGTGACTTCATTCTTCTTGGGGG - Intergenic
1190457260 X:50638305-50638327 TGTCCCTTTCTTGCTGTAGGAGG - Exonic
1192059337 X:67807363-67807385 TGTGCCTTCAGTCCTGTTTGAGG + Intergenic
1198692560 X:139300205-139300227 TATCACTTCATTACTGATGGAGG - Intergenic
1200754061 Y:6973264-6973286 CGTCCCCTCATTCCTCTTGCTGG + Intronic