ID: 934524689

View in Genome Browser
Species Human (GRCh38)
Location 2:95044373-95044395
Sequence ATGCAGTTCCCCCATTGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934524689 Original CRISPR ATGCAGTTCCCCCATTGAAA GGG (reversed) Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
902533347 1:17104741-17104763 CTGCAGTAACCACATTGAAAAGG - Intronic
902927618 1:19707146-19707168 TTGCTGTTCCCTCTTTGAAATGG + Intronic
905050638 1:35047932-35047954 ATACAATTCACCCATTTAAAGGG + Intergenic
908027003 1:59963117-59963139 ATGCAATTCACCCAATTAAAGGG + Intergenic
909341338 1:74534871-74534893 ATGTAGTTCCTCCTTTGAAATGG + Intronic
910790939 1:91049731-91049753 ATGCAGTTTACCACTTGAAAGGG + Intergenic
913067045 1:115265672-115265694 ATGTGGTTACACCATTGAAAGGG - Intergenic
916739347 1:167634765-167634787 TTGCAGTTACCCCAGAGAAAAGG - Intronic
918860875 1:189825384-189825406 ATGCAGATCCCAGATTCAAAGGG + Intergenic
920032570 1:203046083-203046105 CTGCAGGTCACCCTTTGAAAGGG + Intronic
922073456 1:222218944-222218966 ATGAAGTTTCCAGATTGAAAGGG - Intergenic
1063190803 10:3692924-3692946 AGGCAGTTTACCCATTGCAATGG + Intergenic
1074351497 10:112741567-112741589 ATGCAATTCACCCATTTAAAGGG - Intronic
1074832577 10:117259844-117259866 ATGGGGTTCCCCAAGTGAAAGGG - Intronic
1076239788 10:128895900-128895922 ATAGAATTCCCCCATTTAAAGGG + Intergenic
1076745150 10:132509248-132509270 ATGCAGCTCCCGCTGTGAAAAGG + Intergenic
1078563325 11:12391877-12391899 ATACAATTCACCCATTTAAATGG + Intronic
1078701015 11:13682908-13682930 AGCCAGTTCCCCCTTTTAAAGGG + Intronic
1080451255 11:32380717-32380739 ATGCAGTTGCATCATTGAGAAGG + Intergenic
1081415292 11:42807601-42807623 ATCCATTTCCGCCATTGAGATGG - Intergenic
1085096767 11:73767730-73767752 ATTCAGTTTCACCATAGAAAGGG - Intergenic
1089102451 11:115974953-115974975 CTGCAGGTCTCCCATTCAAATGG - Intergenic
1091267022 11:134278520-134278542 AAGCAGTTCACCCTTTAAAAGGG + Intronic
1095378778 12:41563943-41563965 ATGCTTTTCCCCCCTTAAAAGGG - Intronic
1103145765 12:118594660-118594682 ATACAATTCACCCATTTAAAAGG - Intergenic
1104187979 12:126450593-126450615 AAGCAGTTCCCAGCTTGAAAGGG + Intergenic
1111807720 13:93058482-93058504 CTGCAATTACCCCACTGAAATGG - Intergenic
1115886530 14:37978028-37978050 TTGCACTCCCCTCATTGAAAGGG - Intronic
1115913653 14:38285251-38285273 ATGCAGCTCCCCCATAAAGAAGG + Intergenic
1117607465 14:57444488-57444510 ATTCAGTTCCTCCATCAAAAAGG - Intergenic
1120958305 14:90102203-90102225 AAGAAATCCCCCCATTGAAATGG + Intronic
1125273524 15:37966921-37966943 ATGCATTTCTCCCACTAAAAGGG + Intronic
1127500183 15:59547728-59547750 AAGCAGTTCCCAGCTTGAAAGGG - Intergenic
1133062399 16:3183355-3183377 CGCCAGTTCCCCCAGTGAAAGGG - Intergenic
1135049487 16:19181028-19181050 AAGCAAATGCCCCATTGAAAGGG + Intronic
1138242349 16:55437287-55437309 ATGCTGTTCTCCCCTTTAAATGG - Intronic
1140949092 16:79798523-79798545 ATGAAGTTTCACCATTTAAAGGG + Intergenic
1143967269 17:10765078-10765100 ATGCAGTTTCACCTTTGCAAAGG - Intergenic
1149634928 17:58159004-58159026 ATGCCTTTACCCCTTTGAAAGGG + Intergenic
1151471620 17:74321909-74321931 AGGCAGTTCCCCCAAGGAAAGGG + Intergenic
1152461464 17:80444496-80444518 CTGCAGTGCCCCCACTGATATGG - Intergenic
1154024130 18:10690810-10690832 AGTAAGTTCCTCCATTGAAAAGG - Intronic
1158050868 18:53217751-53217773 ATACAGTTTGCCCCTTGAAATGG - Intronic
929113490 2:38424994-38425016 TTGAAGTTTCCCCATTGACAAGG - Intergenic
929204638 2:39276973-39276995 ATACAGTTCACCCACTTAAAGGG - Intronic
929624763 2:43395250-43395272 ATACAGTTCACACTTTGAAAAGG + Intronic
931316114 2:61133914-61133936 ATACAATTCGCCCATTTAAATGG - Intronic
933855572 2:86411111-86411133 ATACAATTCACCCATTTAAAAGG - Intergenic
934524689 2:95044373-95044395 ATGCAGTTCCCCCATTGAAAGGG - Intronic
937096345 2:119237775-119237797 ACGCAATTCACCCATTCAAATGG + Intronic
937542093 2:122968824-122968846 ATACAGTTTCTCCCTTGAAAGGG - Intergenic
939260401 2:139801049-139801071 ATGAACTTCCTCCAGTGAAATGG - Intergenic
939374787 2:141350262-141350284 GTACATTTGCCCCATTGAAATGG - Intronic
941289910 2:163662371-163662393 ATGCTGTTTCCCTTTTGAAATGG - Intronic
942371613 2:175291856-175291878 ATTCAATTTTCCCATTGAAACGG - Intergenic
948064702 2:235068658-235068680 ATCCTGTTCCACCATTAAAAGGG + Intergenic
1170526852 20:17247332-17247354 ATTCAGGTCCCCAAATGAAATGG + Intronic
1173515932 20:43665784-43665806 CTGCATTTCCCCCTTTGAACTGG - Intergenic
1175389383 20:58616723-58616745 ATGCAATTCACCCATTGCGATGG + Intergenic
1177587575 21:23118357-23118379 ATGCAGTTCCTACATTAAATGGG + Intergenic
1179624414 21:42640555-42640577 ACCCAGTCCCCCCACTGAAATGG + Intergenic
1180592982 22:16956454-16956476 TTGCAGTTCCTGCATTGAAGGGG - Intergenic
1184200278 22:42963940-42963962 ACACAGTTCACCCATTTAAAGGG + Intronic
949192510 3:1267147-1267169 ATGTACTTCCCCCAGTGACAGGG + Intronic
951658392 3:25034866-25034888 CTGCAGTTGCCACATGGAAATGG - Intergenic
952037003 3:29214892-29214914 ATGTAGAGACCCCATTGAAATGG + Intergenic
953079144 3:39599180-39599202 TTGCAGTTCCTCCATTGGGAAGG - Intergenic
956897925 3:73682848-73682870 CTGCAGTTTCCCCATAGATAGGG - Intergenic
958893498 3:99805434-99805456 AGGCATTTCCCCCATTGTCATGG + Intergenic
963163315 3:142174858-142174880 CTTCAGTTCCCCCATTGATGAGG - Intronic
964701106 3:159568048-159568070 TTGCAGTTGCCACATTGTAAAGG + Intronic
965397952 3:168183197-168183219 ATTCAGTTCTGCCATTGTAATGG + Intergenic
969193077 4:5538731-5538753 ATGCTTTTTCCCCATTGAGATGG - Intergenic
970435657 4:16032257-16032279 ATGCAGTGTACCCATTGAAGAGG - Intronic
974350694 4:60742122-60742144 ATGCAGTTCCCTGAGTGAATGGG - Intergenic
976771810 4:88661141-88661163 ATTTATTTCCCCCATTCAAAGGG - Intronic
981591431 4:146367533-146367555 ATTCAGTGTCTCCATTGAAAAGG - Intronic
991336852 5:65558384-65558406 ATGCAGTTCATCCATTTTAATGG + Intronic
992377909 5:76207640-76207662 ATGCAGCTTACCCCTTGAAAGGG + Intronic
996651485 5:125882329-125882351 ATGCAACTCCCCCACTCAAAAGG + Intergenic
1001999083 5:176186882-176186904 ATGCTGTTCCTCCAGTGAGATGG - Intergenic
1008631429 6:53366065-53366087 AGGCAGTTCCCCAGTGGAAATGG + Intergenic
1009664588 6:66658843-66658865 ATGCACCATCCCCATTGAAAGGG - Intergenic
1010610976 6:77953634-77953656 AGGCATTTTCCCCATTGAATTGG - Intergenic
1011520114 6:88195653-88195675 ATACAATTCACCCATTTAAATGG + Intergenic
1012971207 6:105733381-105733403 ATCCTTTTCCACCATTGAAATGG - Intergenic
1017604109 6:156114818-156114840 ATGGAGTTCCCCCAAGTAAAGGG + Intergenic
1022197854 7:28086333-28086355 ATGCACCTCCCCAAATGAAACGG - Intronic
1022786283 7:33640786-33640808 ATGCAGTCTTCCCATGGAAATGG - Intergenic
1026011968 7:66643430-66643452 ACTTATTTCCCCCATTGAAAAGG - Intronic
1026946038 7:74316893-74316915 ATGCAGCTCACGCTTTGAAAAGG + Intronic
1031148539 7:118025726-118025748 GTGGAGTTGCCCCATTGGAATGG + Intergenic
1032181262 7:129680906-129680928 ATACAATTCACCCATTTAAAGGG - Intronic
1034950626 7:155294741-155294763 GTGCAATTCACCCATTTAAACGG - Intergenic
1036679623 8:10861702-10861724 CTGCAGCTCTCCTATTGAAATGG + Intergenic
1037684001 8:21122097-21122119 ATGCAGTTTCCCCATAGAGCAGG + Intergenic
1040506702 8:48055584-48055606 ATACAATTCACCCATTTAAAGGG + Intronic
1041367474 8:57124006-57124028 ATTCAGTTCCCATAGTGAAATGG - Intergenic
1042835872 8:73078807-73078829 GTGTTGTTCCCCCATTGATACGG - Intronic
1042845123 8:73162483-73162505 AGGCAGTTCCCCAGTGGAAAAGG - Intergenic
1043563676 8:81523879-81523901 AAGCAGTCCCCCTATTGGAAAGG - Intergenic
1044958785 8:97508762-97508784 TTGTAGTTCCCCCTATGAAAGGG - Intergenic
1049078780 8:140424103-140424125 ATGCAGTTTACCTATTTAAAGGG - Intronic
1049249945 8:141582935-141582957 TCTCAGTTCCCCCATTGTAACGG + Intergenic
1050342415 9:4654261-4654283 ATACAGTTACCACATTGAAATGG + Intronic
1051327186 9:15985234-15985256 ATGCAGTACACCAAGTGAAAAGG + Intronic
1052786403 9:32832226-32832248 CTGCTCTGCCCCCATTGAAAAGG + Intergenic
1053440507 9:38112337-38112359 ATTCAGATCCCCTATTGGAATGG - Intergenic
1053460900 9:38270699-38270721 AAGCAGTTCCCACAGTGAAAAGG - Intergenic
1055617826 9:78091375-78091397 ATGCAGTTTCCCCATGGTGATGG - Intergenic
1056710310 9:88987267-88987289 ATGCAGTGGCCCCAGGGAAAGGG - Intergenic
1062692881 9:137853395-137853417 ATTAAGTTCCCCCAATTAAATGG - Intronic
1185744290 X:2559583-2559605 ATGCAATTCTCCCAATGAAATGG + Intergenic
1187211495 X:17236760-17236782 AAGCAGTAAGCCCATTGAAAAGG - Intergenic
1187438426 X:19294241-19294263 ATGCAATTCCCAGATGGAAAAGG - Intergenic
1187592159 X:20729294-20729316 ATACAATTCACCCATTTAAAGGG - Intergenic
1190732798 X:53235945-53235967 ATCCCTTTCCCCCATTGAAGAGG + Intronic
1195418828 X:104650598-104650620 ATTCAGATTTCCCATTGAAAGGG - Intronic
1195947324 X:110229328-110229350 ATTTAATTCTCCCATTGAAAAGG + Intronic
1196108187 X:111918289-111918311 ATGCAGTTTTCTCATTGAAATGG + Intronic
1198224701 X:134634378-134634400 ATACAATTCACCCATTTAAATGG + Intronic
1198285936 X:135192001-135192023 ATGCAATTCCCCCATCTACAGGG - Intergenic
1201273752 Y:12280394-12280416 TTGCAGTTCCAGCATTGAACAGG - Intergenic