ID: 934525346

View in Genome Browser
Species Human (GRCh38)
Location 2:95048395-95048417
Sequence CTGGCGGGTACAGGTGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934525346_934525364 27 Left 934525346 2:95048395-95048417 CCCACACCACCTGTACCCGCCAG 0: 1
1: 0
2: 1
3: 12
4: 135
Right 934525364 2:95048445-95048467 CAAGGGCTGTTTTCACCTCAAGG 0: 1
1: 0
2: 1
3: 12
4: 189
934525346_934525356 9 Left 934525346 2:95048395-95048417 CCCACACCACCTGTACCCGCCAG 0: 1
1: 0
2: 1
3: 12
4: 135
Right 934525356 2:95048427-95048449 TGCCCCTCCCATCACCTGCAAGG 0: 1
1: 0
2: 2
3: 64
4: 999
934525346_934525357 10 Left 934525346 2:95048395-95048417 CCCACACCACCTGTACCCGCCAG 0: 1
1: 0
2: 1
3: 12
4: 135
Right 934525357 2:95048428-95048450 GCCCCTCCCATCACCTGCAAGGG 0: 1
1: 0
2: 2
3: 23
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934525346 Original CRISPR CTGGCGGGTACAGGTGGTGT GGG (reversed) Intronic
900101229 1:962977-962999 CTGACCGGCACAGGTGGGGTGGG - Intronic
900169072 1:1257532-1257554 GTGGTGGGTACAGGTGGGGTGGG - Intronic
900480500 1:2895868-2895890 CTGGCGGCTGCAGGTGGTTCTGG - Intergenic
902308949 1:15565759-15565781 TTGGCGGGTGGAGGTGGTGGAGG - Intronic
917166262 1:172116489-172116511 ATGGAGTGGACAGGTGGTGTTGG + Intronic
922271973 1:224043332-224043354 TTGGAGGGTAGAGGTAGTGTTGG - Intergenic
924775726 1:247113436-247113458 CTGGCAGGAGCAGGTGCTGTGGG + Intergenic
1064950873 10:20848722-20848744 CTGGCGAGTGGTGGTGGTGTTGG - Intronic
1067790081 10:49281418-49281440 TTGGCGGGTTCAGGAGGTTTGGG - Intergenic
1069572646 10:69503763-69503785 CTGCGGGGCACAGGTGGTGATGG + Intronic
1070726326 10:78793702-78793724 GTGGCGGGTAGAGGAGGAGTAGG - Intergenic
1077025378 11:437692-437714 CTGGGGGGGACTGGTGGTCTGGG + Intronic
1077211022 11:1370993-1371015 CTGGCGGGGACTGGTGGGGCTGG + Intergenic
1084174105 11:67414871-67414893 CTAGCTGGTTGAGGTGGTGTGGG - Intronic
1088280379 11:108128907-108128929 CTTTTGGGAACAGGTGGTGTTGG + Intronic
1093112742 12:15171182-15171204 CTGGCGGTCAGAGCTGGTGTTGG + Intronic
1093600488 12:21015412-21015434 TTTGGGGGTACAGGTGGTTTTGG - Intergenic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1095225379 12:39672085-39672107 CTGGTGGTGGCAGGTGGTGTGGG + Intronic
1095404548 12:41853689-41853711 CTTGGGGGAACAGGTGGTTTTGG + Intergenic
1096485007 12:51974156-51974178 TTGGCGGGTGGAGGTGGTGGGGG - Intronic
1096491640 12:52015790-52015812 CTGGCGAGTTCAGGTGGGGTGGG + Exonic
1103658220 12:122491751-122491773 CTGGCAGGTGGAGGTTGTGTTGG + Intronic
1104049439 12:125186138-125186160 CTCGCGGGTACAGGGGCTGCGGG - Intergenic
1104110584 12:125700637-125700659 CTGGTGGGTAGAGGTGGGGCTGG + Intergenic
1106029534 13:25987636-25987658 CTGGTGGCTACAGGTGGTCTTGG - Intronic
1112407539 13:99134580-99134602 CTGGCCAGCACTGGTGGTGTGGG - Intergenic
1116110932 14:40580107-40580129 CTGGATTGTACAGGTGGTTTGGG - Intergenic
1120974528 14:90237085-90237107 CTGGGGGGTGGAGGTGGTGGGGG - Intergenic
1121561436 14:94878962-94878984 CTGGCTGGGACAGCAGGTGTGGG + Intergenic
1122923072 14:104887913-104887935 CTGGCGGGGACCCGTGGTGGTGG - Exonic
1123040069 14:105486825-105486847 CGGGCGGGTGCCGGTGGGGTAGG + Intergenic
1124125813 15:26937445-26937467 CTGGCCAGGACAGGTTGTGTGGG - Intronic
1127181487 15:56423794-56423816 TTTGGGGGAACAGGTGGTGTTGG + Intronic
1127546704 15:59999683-59999705 CTGGCGGGGGTAGGGGGTGTGGG + Intergenic
1129602760 15:77009865-77009887 CTGGCAGGCGTAGGTGGTGTGGG + Intronic
1129851884 15:78798212-78798234 CGGGCAGTCACAGGTGGTGTGGG - Intronic
1131070098 15:89460755-89460777 CAGGCGGGCCCAGGGGGTGTGGG - Intergenic
1136300275 16:29329616-29329638 ATGCTGGGTACAGGTGCTGTGGG + Intergenic
1137472880 16:48777290-48777312 CTGGCAGGGAGAGGTGATGTGGG + Intergenic
1139512544 16:67435823-67435845 CTGACCGGTGCTGGTGGTGTGGG - Exonic
1147573699 17:41586814-41586836 CTGGCGGCTGCAGGTGGTCATGG + Exonic
1147577814 17:41612668-41612690 CTGGCGGCTGCAGGTGGTCATGG + Exonic
1148913005 17:50953260-50953282 CTAGCGGGCAGAGGTGGAGTAGG + Intergenic
1151496805 17:74462891-74462913 CTGGGGGGTGCAGGAGGAGTGGG + Intergenic
1152524396 17:80879339-80879361 CAGGCGGGGGCAGGTGGCGTTGG - Intronic
1152662160 17:81547531-81547553 CAGGCGGCTCCAGGTGGTGCTGG + Exonic
1152768320 17:82152741-82152763 CTGGCGGGGACAGGGTGTGCTGG - Intronic
1153262653 18:3239319-3239341 CTGGTGGGTAAATGTGGTGGGGG + Intergenic
1158232149 18:55269022-55269044 CTGGAGGGAAGAGGTGGAGTTGG - Intronic
1160922139 19:1526020-1526042 CTGGTGGGTACAGGTGGGCATGG - Intronic
1160949408 19:1658346-1658368 CTGGCGGGGTGAGGTGGGGTCGG - Intergenic
1161077820 19:2294804-2294826 GTGGCGGGTGGAGGTGGGGTTGG + Intronic
1161251897 19:3285156-3285178 TTTGCGGGTATAGGTGGTGGTGG - Intronic
1161276193 19:3419047-3419069 TTGGCGGGGTCAGGGGGTGTCGG + Intronic
1162155640 19:8676636-8676658 ATGGAGGGGACAGGTGGAGTTGG - Intergenic
1162779313 19:12998424-12998446 CTGGCGGGGAAAGGTACTGTGGG + Intronic
1163753370 19:19091978-19092000 GTGGCGGGTGCTGGTGGTGCTGG + Intronic
1165729141 19:38133233-38133255 CTGGAGGGGACATGTGGTGATGG - Intronic
1165838399 19:38772910-38772932 CTGGTGGATACAGGTGGCCTCGG + Intronic
1165841160 19:38789787-38789809 CTGGTGGATACAGGTGGCCTCGG - Intronic
1167439880 19:49501834-49501856 CTGGTGGGTGCTGGGGGTGTGGG - Intergenic
925882707 2:8366243-8366265 GTGCTGGGTACAGGTGGTGCAGG + Intergenic
926500220 2:13643984-13644006 CTGGTGGCTTCATGTGGTGTTGG + Intergenic
927400405 2:22704086-22704108 CTGGTGGGTACTGGTTGTGATGG - Intergenic
927993238 2:27462965-27462987 CTTGAGGGTAAAGGTGGGGTGGG + Intronic
929023591 2:37577774-37577796 CTGGCTGGTACAGGTAGGATAGG - Intergenic
929454256 2:42055054-42055076 CTGGCGGGTGGGGGTGGGGTAGG - Intronic
932907970 2:75774430-75774452 CATGAGGGTATAGGTGGTGTGGG + Intergenic
932991577 2:76794770-76794792 CTGGTGGGTACAGTTTGTGATGG - Intronic
934525346 2:95048395-95048417 CTGGCGGGTACAGGTGGTGTGGG - Intronic
937338651 2:121077117-121077139 CTGGCAGGTGCAGGTTGTGCAGG - Intergenic
937983365 2:127627650-127627672 CTGGAGGGTACAGGTTGTCTGGG + Intronic
938789324 2:134662937-134662959 CTGGTGGGAACTGGTGGGGTGGG - Intronic
940912780 2:159223797-159223819 CTGCCGTGCACAGGTTGTGTGGG + Intronic
942004843 2:171687781-171687803 GTGGTGGCTACAGTTGGTGTTGG + Intronic
944386749 2:199173760-199173782 CTTTGGGGTACAGGTGGTTTTGG - Intergenic
944728409 2:202495553-202495575 ATGGCGGGTCCGGGTGGTCTTGG + Intronic
946417843 2:219549509-219549531 TTGGCGGGTCCAGCTGGTGGGGG + Intronic
946487117 2:220111472-220111494 CTGGCTGGTATGGGTGGGGTGGG + Intergenic
947717788 2:232350604-232350626 CTGGGGGGCACAGGTGGGGGTGG - Intergenic
948209418 2:236181474-236181496 CTGGCGTGGACAGGAGGTGGGGG + Intergenic
1169626032 20:7570308-7570330 TTGGGGGGTACAGGTGGTCTTGG - Intergenic
1171373554 20:24676640-24676662 CTGGCGGGAATAGCTGGTCTGGG - Intergenic
1171416004 20:24980862-24980884 CTGGCGTGTAGAGGTGATGGAGG - Intronic
1172106829 20:32522064-32522086 CTGGAGGGTAGAGGTGGGCTAGG + Intronic
1172948929 20:38709760-38709782 CTGAGGGGTACAGTTGGTGTGGG + Intergenic
1174982805 20:55416370-55416392 CTAGTGGTAACAGGTGGTGTAGG + Intergenic
1179820597 21:43934809-43934831 GTGAGGGGTAGAGGTGGTGTGGG - Intronic
1181713285 22:24705305-24705327 CTGGCGTGCACAGGTGTGGTAGG + Intergenic
1181935911 22:26438185-26438207 CTGGCTGGTTCAGGTGGCGAAGG - Intronic
1182709045 22:32309087-32309109 CTGGAGGGTACAGGTGAGGTGGG + Intergenic
1184455319 22:44606827-44606849 CTGGCGGGCACACCTGGTGGTGG - Intergenic
1184455335 22:44606877-44606899 CTGGCGGGCACACCTGGTGGTGG - Intergenic
952422392 3:33143911-33143933 CTGGGGAGGACAGGTGGTGGAGG + Exonic
952950459 3:38520193-38520215 CTGGGTGGCACAGGTGGTGGTGG + Intronic
953928889 3:46996334-46996356 GTGGCGGGGACTGGTGGTGTGGG - Exonic
954715756 3:52525927-52525949 CTGGGGGAAACAGGTGGTGTGGG + Intronic
959783449 3:110264722-110264744 CTGGAGGGAATAGGGGGTGTTGG + Intergenic
959959262 3:112277954-112277976 CTGGTGGGTACTGTTGGTGTTGG - Intronic
960556139 3:119032864-119032886 CTGGTGGGGAAAGGTGGTGGTGG - Intronic
960598307 3:119428734-119428756 CTGGCCGTTACAGGTGTTCTTGG + Intergenic
961061764 3:123834523-123834545 CAGGTGGGTAAAGGTGGTGCAGG + Intronic
968798052 4:2722282-2722304 GTCTCGGGTGCAGGTGGTGTGGG + Intronic
975132340 4:70842025-70842047 CTGGCTGGGAGAGGGGGTGTGGG + Intergenic
978513829 4:109550563-109550585 TTGTGGGGTACAGGTGGTTTTGG + Intergenic
984313149 4:178090574-178090596 GTGGCAGGTATAGGTGGTATTGG - Intergenic
985588628 5:753523-753545 CTGGCGGGTCCTGGTGGGGAAGG - Intronic
985603297 5:845962-845984 CTGGCGGGTCCTGGTGGGGAAGG - Intronic
986770159 5:10965681-10965703 GTGGCAGGTACTGGTGGTGTCGG + Intergenic
988119064 5:26936213-26936235 CTTGCGGATACAGGCGGTTTTGG - Intronic
988270231 5:29004517-29004539 CTGGGGGGCAGGGGTGGTGTGGG - Intergenic
992408623 5:76483555-76483577 CTGGCTCTTACAGGTGATGTGGG + Intronic
992613755 5:78530722-78530744 CTGGCAGGTACAGGTGTTGTTGG - Intronic
994402440 5:99298306-99298328 TTTGGGGGAACAGGTGGTGTTGG - Intergenic
996239005 5:121171303-121171325 GTGGAGGGTAAAGGTGGAGTTGG - Intergenic
1003516797 6:6824830-6824852 CAGGCTGGTACAGGTGCTGAGGG - Intergenic
1006826131 6:36937674-36937696 CTGGCAGGCACAGAGGGTGTGGG - Intergenic
1018632843 6:165835474-165835496 CTGGCGAGCACAGGAGGCGTGGG - Intronic
1019544651 7:1567948-1567970 GTGGCGGTTAATGGTGGTGTGGG - Intronic
1019788029 7:2991796-2991818 TTTGGGGGTACAGGTGGTATTGG + Intronic
1020260305 7:6527106-6527128 CTGGCGGGTGCAGAGGGAGTGGG - Intronic
1021657860 7:22889965-22889987 CTGGCCGGCACAGGTGGCCTAGG - Intergenic
1023793337 7:43770988-43771010 CTGGAAGGCACAGGTGGTGAAGG + Intronic
1024068784 7:45768627-45768649 CTGGCTGGTGGAGGTGTTGTGGG + Intergenic
1034388085 7:150757485-150757507 CTGGCGGTTCCAGGTGATGGAGG + Intergenic
1034566325 7:151918526-151918548 CTAGCGGGTGCAGGTGCTGCAGG + Intergenic
1035390377 7:158500489-158500511 CTGGAGGGCACAGGTGCTGTGGG + Intronic
1035415424 7:158679860-158679882 CTGGCGGTTACAGGGGAGGTGGG + Intronic
1035563678 8:627654-627676 CTTTCGGGTTCAGGTGGTGCAGG - Intronic
1037255926 8:16953540-16953562 CTGGCTGGGAAAGGTAGTGTGGG + Intergenic
1038419189 8:27421338-27421360 TTTGGGGGAACAGGTGGTGTTGG + Intronic
1043874124 8:85464829-85464851 CTGACGGTTAAAGGTGGGGTGGG + Intronic
1044552356 8:93526266-93526288 TTTGGGGGTACAGGTGGTTTGGG + Intergenic
1052004563 9:23330515-23330537 CTGGAGGGAAAATGTGGTGTTGG + Intergenic
1053419239 9:37966722-37966744 CTGGCTAGGACAGGTGGTGGTGG + Intronic
1056998685 9:91487841-91487863 CTGGCGGGTACAGGAGGGCAGGG - Intergenic
1057032135 9:91783999-91784021 CTGGCCTGGACAGGTGGTTTGGG - Intronic
1059525599 9:114988474-114988496 TTAGCCGGTACAGGTGGTGCAGG + Intergenic
1060934081 9:127505882-127505904 CTGAGGGGTACAGGTTGGGTGGG - Exonic
1187128362 X:16475812-16475834 TTTGGGGGTACAGGTGGTTTTGG - Intergenic
1189502278 X:41573974-41573996 CTGGTGGGAACAGGTAGTGCAGG + Intronic
1193860781 X:86664359-86664381 TGGGAGGGTAAAGGTGGTGTTGG + Intronic
1195272279 X:103243366-103243388 TTGGCGGGCACAGGTGGCTTGGG - Intergenic
1197913739 X:131513414-131513436 CTGGGGGGTAGAGGAGGTGAGGG + Intergenic
1198286142 X:135194250-135194272 CTGGCGGGTACAGCACGTGACGG - Intergenic
1200058541 X:153473942-153473964 CTGGCTGGTGCAGATGGCGTGGG - Intronic
1200211703 X:154349480-154349502 CTGGGGGGCACAGGTGGCCTTGG + Exonic
1201269564 Y:12241797-12241819 TTTGGGGGAACAGGTGGTGTTGG + Intergenic