ID: 934525411

View in Genome Browser
Species Human (GRCh38)
Location 2:95048690-95048712
Sequence GGCCCCACCACCCCTACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 220}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934525411 Original CRISPR GGCCCCACCACCCCTACAGC AGG (reversed) Intronic
900592176 1:3465061-3465083 GGCCCCTGCACCCCAGCAGCTGG + Intronic
900974612 1:6009187-6009209 AGGCCCAGCACCCCTACAGAGGG - Intronic
901497369 1:9629766-9629788 GGCTCCCCCACCCCTGCAGTCGG + Intergenic
902779059 1:18692911-18692933 GTCCCCAGGCCCCCTACAGCAGG - Intronic
903541184 1:24097213-24097235 GGCCCCACCAACCCTGCTGAGGG - Intronic
903879692 1:26500507-26500529 CGCCCCTCCACTCCTCCAGCGGG + Intergenic
905309030 1:37036881-37036903 GGCCCCACAGCCTCTGCAGCTGG - Intergenic
905515343 1:38558411-38558433 GGTTCCTCCACCCCTCCAGCCGG + Intergenic
905977772 1:42191318-42191340 GGCACCCCCACCCCCACAACAGG - Exonic
906059069 1:42936566-42936588 GGCCCCAACCCCCCTGCAGAGGG + Intronic
907329790 1:53663499-53663521 GGCCCCTTCACCCCACCAGCTGG + Intronic
909629866 1:77759872-77759894 GCCCCCACCTCCCCTATCGCCGG - Intergenic
909820222 1:80051948-80051970 GTCCGCACGACCACTACAGCTGG - Intergenic
914847977 1:151293282-151293304 GGCCCCTCCACCCTTACTGAGGG - Intronic
916072312 1:161177443-161177465 GTCACCGCCACCCCAACAGCCGG + Exonic
919922101 1:202172011-202172033 GGCCCCAGCACCAGGACAGCGGG + Intergenic
1064194276 10:13232874-13232896 GGCTCCACAGGCCCTACAGCAGG + Intronic
1070809638 10:79291140-79291162 GGCCCAACTACCCCGGCAGCGGG + Exonic
1074878344 10:117631994-117632016 GGCCCCACCAGTCCCTCAGCTGG + Intergenic
1076163393 10:128263276-128263298 GGCCCCACTGCCACTGCAGCTGG + Intergenic
1076208815 10:128624665-128624687 GACCCCGCCAGCCCTGCAGCGGG - Intergenic
1076371012 10:129953689-129953711 GCTCCCACCACCCCTACAGTTGG + Intronic
1076684242 10:132189928-132189950 GGCACCACCACCCCACCAGAAGG + Intronic
1076687242 10:132203743-132203765 GCCCCCACCCCCCCGGCAGCTGG + Exonic
1077147760 11:1053547-1053569 GGACACACCTCCCCTACAGCTGG - Intergenic
1077283617 11:1756413-1756435 GGCCCAGCCAGCCCTACAGCCGG + Intronic
1078442071 11:11376628-11376650 AGCCCCTCCACCCCTACTGCCGG + Intronic
1079242389 11:18729725-18729747 GGCCCCCCCACTCCTGCACCTGG - Exonic
1080772584 11:35355550-35355572 GGCCTCACTCCCTCTACAGCTGG - Intronic
1083274315 11:61588122-61588144 GGCCCCAGCACTCCGAGAGCTGG + Intergenic
1083342520 11:61967745-61967767 GGCCGCCCCTCCCCCACAGCAGG - Intergenic
1083571719 11:63764907-63764929 GGCCCCCCCAGGCCTGCAGCAGG + Exonic
1083628908 11:64085903-64085925 GGCCACCCCACCCCCACAGAAGG + Intronic
1084803859 11:71565622-71565644 GGAGCCACAACCCCCACAGCCGG - Exonic
1085045807 11:73352764-73352786 GCCCCCACCACACCTACACAGGG - Intronic
1085512402 11:77095080-77095102 GGCCCCAGGGGCCCTACAGCAGG - Intronic
1086213468 11:84349226-84349248 GTCCCCAGCACCCCTACTTCTGG - Intronic
1090438789 11:126709338-126709360 TGCCCCTCCACCCCTACTCCCGG - Intronic
1090684107 11:129096538-129096560 GCCCCTGCCACCCCTATAGCAGG + Intronic
1091241266 11:134053891-134053913 GGCCACAGCACCCCTGCAGCAGG - Intergenic
1091749321 12:3012598-3012620 GCCACCCCCACCCCCACAGCAGG - Intronic
1094002224 12:25707512-25707534 GGAAGCTCCACCCCTACAGCAGG - Intergenic
1095985767 12:47998577-47998599 GGCCCTAACACCCCAACAGAGGG - Intronic
1096567850 12:52496236-52496258 GGCCCCACCACCACTAAAAGGGG + Intergenic
1096925071 12:55135324-55135346 GACCCCCCCACCCCTTCTGCTGG + Intergenic
1096995066 12:55833238-55833260 AGCCCCACCAGCCCCCCAGCTGG - Intergenic
1100172763 12:91994506-91994528 GTCCACACCACCCTGACAGCAGG - Intronic
1101325248 12:103709908-103709930 GACCCCACCACCCATGCACCTGG + Intronic
1103128847 12:118449023-118449045 CTCCCCACCACCCCCACAACAGG + Intergenic
1103670448 12:122610368-122610390 TGCCCCACCCCTCCTCCAGCTGG + Intronic
1104564775 12:129870821-129870843 AGCCCCTCGCCCCCTACAGCTGG + Intronic
1104921510 12:132293035-132293057 GGCCCCGCCACTCCCACACCTGG - Intronic
1105902166 13:24764562-24764584 GGCCTCACCGACCCTCCAGCCGG + Intronic
1106096382 13:26648840-26648862 AGCCCCACCACCCCGACAAAAGG + Intronic
1107389157 13:39945343-39945365 GGCCCCACCCCGGCTACTGCCGG + Intergenic
1108343942 13:49525805-49525827 GTCCTCACCAGCCCTACAGGTGG - Intronic
1108585373 13:51866022-51866044 GGCCCCACAACGCCAACAGAGGG + Exonic
1109245139 13:59945027-59945049 GCCCCTACCACTCCTACTGCTGG + Intronic
1110848578 13:80218304-80218326 GTCCCCTCCACCCCTCCTGCAGG + Intergenic
1121025986 14:90616504-90616526 GCCCCCACCTCCCCCCCAGCTGG - Intronic
1121184711 14:91956597-91956619 GCCACCACCTCCCCTAGAGCTGG + Intergenic
1122843624 14:104478706-104478728 GCCCCCAGCACCCCTCGAGCTGG - Intronic
1122923075 14:104887925-104887947 GTCCCCGCCAGCCCTTCAGCAGG + Exonic
1123033355 14:105461504-105461526 GGCCCCACCACCCCCACATAGGG - Intronic
1123680700 15:22761283-22761305 GGCCACCCCTACCCTACAGCTGG - Intergenic
1124332910 15:28835741-28835763 GGCCACCCCTACCCTACAGCTGG - Intergenic
1124635266 15:31361047-31361069 GTCCCCAGCTCCCCTGCAGCAGG - Intronic
1127054153 15:55114532-55114554 CTACCCACCACCCCCACAGCAGG + Intergenic
1129200776 15:73997925-73997947 CGGCCAACCACCCTTACAGCTGG - Intronic
1129337129 15:74859363-74859385 GTCCCCAGCACCCCTTCAGGGGG - Intronic
1129360961 15:75023817-75023839 GGCGGCCCCACCCGTACAGCCGG - Intronic
1132642600 16:984642-984664 GGCCCCACCCGCCCCACAGAAGG + Intronic
1132889638 16:2197248-2197270 GCCCCCACCACCCCCACTGAGGG + Intergenic
1135563168 16:23492335-23492357 CGCCCCACCACCTCCACAGGTGG - Intronic
1136102630 16:28007034-28007056 GGCCCCTCCACCACTCCAGAGGG + Intronic
1136333343 16:29595667-29595689 GCCCCCACCACCCACACTGCAGG - Intergenic
1136927778 16:34389717-34389739 AGCCCCACGACCCAGACAGCAGG - Intergenic
1136976796 16:35022089-35022111 AGCCCCACGACCCAGACAGCAGG + Exonic
1140087340 16:71808852-71808874 GGCCTCACCACCGCTACCGCAGG + Exonic
1141578760 16:84982926-84982948 GGCCTTACCTTCCCTACAGCGGG - Intronic
1143386676 17:6535115-6535137 GGCCCCACCACAACTAGAGTTGG + Intronic
1143624705 17:8103259-8103281 GCCACCACCACCCCTACTGGTGG + Intronic
1146010795 17:29192769-29192791 TGCCCCACAACCCCTTCAGGAGG + Intergenic
1146064583 17:29624096-29624118 TGCCCCAGCACCCCTACGCCAGG - Intergenic
1146258376 17:31404950-31404972 AGCCCCTCCACCCCTGCAGGTGG - Intronic
1147311140 17:39596810-39596832 CCCCCCACCACCCCCGCAGCTGG + Intergenic
1147461690 17:40576200-40576222 GTTGCCACCACCCCTAGAGCTGG - Intergenic
1147717433 17:42517758-42517780 AGCAGCACCATCCCTACAGCTGG - Intronic
1148115314 17:45171825-45171847 TGCCCCACCCGCCCTCCAGCGGG - Intergenic
1149473601 17:56940218-56940240 GCCCCCACCACCCCCAAAGGTGG + Intronic
1149562686 17:57619971-57619993 GGCACAACCACAGCTACAGCAGG - Intronic
1149654883 17:58304996-58305018 GGCCCTACCACCCCACCAGTAGG + Intronic
1150182625 17:63140890-63140912 GCCCTCACCACCACTACACCTGG + Intronic
1151354385 17:73549917-73549939 GTCACCACCACCCCTCCACCTGG - Intronic
1152296644 17:79471165-79471187 GTCCCCAGCACCCCTCCTGCTGG + Intronic
1152931337 17:83111687-83111709 CGGCCTTCCACCCCTACAGCGGG + Intergenic
1155325418 18:24659871-24659893 GGCCCTAGCACCCATAAAGCTGG + Intergenic
1160148873 18:76384601-76384623 TCCCCCACCCCCCCTACAGTTGG + Intronic
1160717342 19:582338-582360 GGACCCCCGACCCCCACAGCTGG - Intronic
1161271723 19:3393262-3393284 GGCCCTACCTCCCCTCCAGGTGG - Intronic
1161394309 19:4037236-4037258 AGCCTCACCACCCCGACCGCAGG - Intronic
1161704832 19:5814771-5814793 GGCCACACAATCCCCACAGCTGG - Intergenic
1162582695 19:11540308-11540330 AGCCCCACCACCCCCACCCCAGG + Intronic
1163710272 19:18842478-18842500 GACCCCCACACCCCTCCAGCTGG - Intronic
1165407854 19:35641935-35641957 GCCCACGCCACCCCTGCAGCAGG + Exonic
1166235741 19:41454615-41454637 GGCCACAGCAACACTACAGCAGG + Intergenic
1166808362 19:45500086-45500108 TGGCCAACCACCCCTCCAGCTGG - Intronic
1167236871 19:48320707-48320729 TGCCCAACCCCCACTACAGCAGG - Intronic
1167636492 19:50658928-50658950 GTCCCCACCCCCCTTACAGGTGG + Exonic
1167684858 19:50949908-50949930 GGCCCAACCAGCTCTACTGCGGG - Exonic
1168177041 19:54633649-54633671 GGCCCCAGCTCCCCGACAACAGG + Exonic
925342855 2:3148937-3148959 GGAAACACCACCCCTGCAGCTGG + Intergenic
925502568 2:4522578-4522600 GCCCCCATAACCCCTACAGCTGG + Intergenic
926696919 2:15776755-15776777 GGCCCCACCAGCTATTCAGCGGG - Intergenic
929573892 2:43040271-43040293 GGCCCCACCACGCCACCAGTGGG + Intergenic
930094871 2:47559320-47559342 GGGCTCCCCACTCCTACAGCTGG - Intronic
930108097 2:47655750-47655772 CACCCCAGCACACCTACAGCAGG + Intergenic
932397773 2:71459970-71459992 GGCCCCATCACCTTTACAGTGGG + Intronic
933644347 2:84798615-84798637 GGCCCCACCACCACTGCTACAGG + Intronic
934525411 2:95048690-95048712 GGCCCCACCACCCCTACAGCAGG - Intronic
936248250 2:110847136-110847158 GGCCCCATCACCCACACAGTGGG + Intronic
937392149 2:121498320-121498342 CACCCCACCACCCCCCCAGCTGG + Intronic
937955528 2:127420017-127420039 GGCCACCCCACCCCTACCCCGGG + Intronic
938237971 2:129722058-129722080 GGCCCCACCCCCGCAGCAGCTGG + Intergenic
940775457 2:157878815-157878837 GGCTCCTCCACTCCTCCAGCAGG + Intronic
948366182 2:237456315-237456337 GGCCCCACCACCGCTCCAGCGGG + Intergenic
948916639 2:241037681-241037703 GGCCCCACCACATCCCCAGCGGG - Intronic
1169350135 20:4862111-4862133 AGCTCCAGCACCACTACAGCGGG + Intronic
1171150381 20:22822275-22822297 GGCCCCACCATTCCAACAGGCGG + Intergenic
1171409663 20:24937413-24937435 GAGCCCATCACCCCTGCAGCAGG + Intergenic
1171851456 20:30311426-30311448 CGCCCCACCACCCCTGCCCCAGG - Intergenic
1172359513 20:34302687-34302709 GGGTCCCCCACCCCTCCAGCAGG - Intronic
1172510369 20:35496844-35496866 TGCCTCAACACCCCTACAGGAGG + Intronic
1172942478 20:38663995-38664017 GGCACTGCCACCCCTCCAGCTGG + Intergenic
1175507051 20:59493558-59493580 GGACCCGCCACCCCTCCAGGAGG + Intergenic
1175891939 20:62319614-62319636 GGCACCCCCACCCCTACCCCAGG + Intronic
1176302375 21:5104750-5104772 AGCCCCACCTCCTCAACAGCTGG + Intergenic
1176740449 21:10596648-10596670 GGCCTCACCACTCCCACTGCCGG + Intronic
1178389262 21:32185185-32185207 GATCCCACCTCCCCCACAGCTGG + Intergenic
1178507762 21:33176767-33176789 GGCCCCACCTTCCCTACACTGGG - Intergenic
1179488409 21:41725704-41725726 AGCCTCAGCACCCCTGCAGCGGG + Intergenic
1179493486 21:41756572-41756594 GGCCCCGCCACTCCTGCACCTGG - Exonic
1179617863 21:42593531-42593553 GGCCCCACCCCCGCCCCAGCTGG + Intergenic
1179667955 21:42925437-42925459 GGACCTACCACCCCTCCATCTGG - Intergenic
1179854652 21:44157173-44157195 AGCCCCACCTCCTCAACAGCTGG - Intergenic
1179996302 21:44975990-44976012 GGCCCCACCTCCCCGCCACCAGG + Intronic
1180223099 21:46371741-46371763 GGCGCCACCACCCCGCCTGCTGG + Intronic
1180857367 22:19057032-19057054 GGCACCACGACCTCCACAGCTGG - Exonic
1181277202 22:21694583-21694605 GCCCCCAACAACCCTGCAGCAGG - Exonic
1182474976 22:30572380-30572402 GGCTCCACCACCCCCCAAGCTGG + Intronic
1183373458 22:37448824-37448846 GCCCCCACCACCCCTCCAGAGGG + Intergenic
1183543060 22:38441057-38441079 GGCCCCAGCAGCCCCACAGATGG + Intronic
1184934824 22:47713728-47713750 TGCCCCACCACCCCCAGATCTGG - Intergenic
1185032853 22:48453826-48453848 GGATCCACCACCCCTTCTGCCGG - Intergenic
1185334058 22:50263654-50263676 GCCCCCACCATCCCTGCTGCTGG - Intergenic
950076910 3:10193825-10193847 GCCCCCACCTCCCCTGCTGCTGG + Intronic
950186830 3:10950669-10950691 AGCCCCATCACCCCCACACCTGG + Intergenic
950465937 3:13153665-13153687 GTCCCCACCCCTCCTGCAGCAGG + Intergenic
950577026 3:13838109-13838131 GGCCCCACCGCACCCTCAGCTGG - Intronic
953703094 3:45211658-45211680 GGCACCAACAGCCCTACAGCAGG + Intergenic
955228558 3:57079722-57079744 GGCGCCCCCACCCCCACCGCTGG + Intergenic
955337329 3:58097616-58097638 GGCCCCTTCAGCCATACAGCTGG - Intronic
956172343 3:66442867-66442889 GGCTCCCCCAACCCCACAGCTGG + Intronic
963037859 3:141048021-141048043 GGCCCCCTCACCTCTACTGCTGG - Intergenic
964499261 3:157330686-157330708 GGCTCCATGATCCCTACAGCTGG - Intronic
964695717 3:159505619-159505641 GGCCCCACCCACCCTACAACAGG + Intronic
966950278 3:184811078-184811100 GGCCACACCACGGCTACATCAGG + Intergenic
968501405 4:951857-951879 GCCCCCAACAGCCCAACAGCTGG - Intronic
969873036 4:10116509-10116531 GGCCCCGCCACGCCTCCGGCCGG + Intronic
970507109 4:16742924-16742946 TGCCTCCCAACCCCTACAGCAGG + Intronic
973945320 4:55949087-55949109 GGCGCCACCACCGCCGCAGCTGG - Intronic
976080666 4:81351319-81351341 AGCCTCACCACCCCTCCAGGAGG + Intergenic
979986753 4:127325202-127325224 GGGACCACCACCCCTTCAGTAGG - Intergenic
983051629 4:163054782-163054804 TCACCCACCACCCCTCCAGCAGG + Intergenic
985808948 5:2069059-2069081 GGGCCCTGCACCCCTGCAGCAGG - Intergenic
986391693 5:7293254-7293276 GGCCACCCCTACCCTACAGCTGG - Intergenic
990720826 5:58694082-58694104 AGCCCCTCCACCCCCACAACAGG + Intronic
990984036 5:61625880-61625902 GGTTCCACCACCCCCACCGCGGG - Intergenic
992850422 5:80801554-80801576 GCCCCCACCACCCCTGCCCCAGG - Intronic
999726771 5:154445006-154445028 GGCACCACCTCCCCTCCAGGAGG - Intergenic
1003665335 6:8106519-8106541 GTGCCCACCACCACCACAGCTGG - Intergenic
1005940394 6:30555969-30555991 TCCCCCACCCCCCCTACATCTGG - Intronic
1006188379 6:32192782-32192804 GCCCCCTCCACTCCTGCAGCTGG - Exonic
1006285772 6:33092727-33092749 GGCCCTCCCATCCCTCCAGCTGG + Intergenic
1006370962 6:33643334-33643356 GCCCCCACCACCCCCACCTCGGG + Intronic
1007259943 6:40556328-40556350 GGCCCCTCTTGCCCTACAGCAGG + Intronic
1007878512 6:45134902-45134924 GGCAGCTCTACCCCTACAGCAGG + Intronic
1008727752 6:54442208-54442230 GGCCCCACAGCCACCACAGCTGG + Intergenic
1008727878 6:54442977-54442999 CGCTCCCCCACCCCCACAGCAGG - Intergenic
1019428812 7:989135-989157 GGCCCCCCAGCACCTACAGCTGG + Exonic
1019971036 7:4541072-4541094 GGCCCATCCATCCCTTCAGCTGG + Intergenic
1022955748 7:35378405-35378427 GCCCCCCCCACCCCCACAGTGGG - Intergenic
1022981724 7:35610733-35610755 GGCACCACCTCCACTACTGCGGG - Intergenic
1025280590 7:57624266-57624288 AGCCCCACCTCCCCTACTTCAGG + Intergenic
1025304140 7:57841241-57841263 AGCCCCACCTCCCCTACTTCAGG - Intergenic
1025813397 7:64889329-64889351 GTCCCCTCCGCCCCAACAGCTGG + Intronic
1027628573 7:80574835-80574857 TGCCCCACTACCCCAGCAGCAGG - Intronic
1028466039 7:91153049-91153071 ATTCCCACCAGCCCTACAGCTGG - Intronic
1029551269 7:101238292-101238314 GGCCCCACCATCCATTCACCAGG + Exonic
1030614869 7:111728812-111728834 GCCCCCAGCACCCCCAAAGCCGG + Intronic
1034622114 7:152464172-152464194 TGCCCCACCCCCACTACCGCGGG - Intergenic
1034980190 7:155470940-155470962 GCCCCAACCACCTCTACAGGTGG + Intergenic
1035074432 7:156168947-156168969 CCCCCAACCACCCCCACAGCTGG - Intergenic
1035238350 7:157514725-157514747 GGGCCTCCCACCCCCACAGCTGG - Intergenic
1035351819 7:158252602-158252624 GGCCCCACCACCCCATCTCCAGG + Intronic
1039311488 8:36322104-36322126 GGCCCCTCCACCGGTCCAGCTGG + Intergenic
1043548559 8:81342733-81342755 GCTCTCACGACCCCTACAGCGGG + Intergenic
1046355744 8:113082242-113082264 GGGCCCATCACCCCCACTGCTGG + Intronic
1049205515 8:141361769-141361791 TGCCCCGCCACACCTGCAGCAGG - Intronic
1049661904 8:143823316-143823338 GTCCTCACCACCCTCACAGCTGG + Intronic
1049729166 8:144167182-144167204 GGCCACTCCACCCCAACAACCGG - Intronic
1049729186 8:144167243-144167265 GGCCACTCCACCCCAACAACCGG - Intronic
1049729211 8:144167322-144167344 GGCCACTCCACCCCAACAACCGG - Intronic
1049729238 8:144167403-144167425 GGCCACTCCACCCCAACAACCGG - Intronic
1049729267 8:144167503-144167525 GGCCACTCCACCCCAACAACCGG - Intronic
1056576628 9:87859805-87859827 GGCCCCTCCACCGGTCCAGCTGG + Intergenic
1056750985 9:89351033-89351055 GGACCCACCTGCCCTACAGAGGG - Intronic
1060477353 9:123996691-123996713 GGGCCCCACACCCCTACATCTGG + Intergenic
1060611410 9:124968803-124968825 GGCCCCAGCAGCCATAGAGCGGG + Intronic
1061044813 9:128159482-128159504 GGACCCAACACCCCTACCCCTGG - Intergenic
1061750928 9:132776524-132776546 GGATCCACCGCCCCCACAGCAGG - Intronic
1061991233 9:134159775-134159797 GGCCCCAGGACCCCCACAGCAGG - Exonic
1062426491 9:136508523-136508545 CTCCCCACCACCCCCACACCAGG + Intronic
1062690072 9:137837101-137837123 GGCTCCACCAGCCCTGCAGGGGG + Intronic
1188519510 X:31021973-31021995 GGCTCCACAACCCATGCAGCTGG - Intergenic
1189515710 X:41711830-41711852 GGCCCCCCCACCCCTGCAGTCGG - Intronic
1190537873 X:51447243-51447265 GACCCCCCAACCCCTACAGCAGG - Intergenic
1190739641 X:53280656-53280678 GCCCCCACCACCCCTAGTGCAGG + Intronic
1191105287 X:56768642-56768664 GCACCCACCTCACCTACAGCAGG + Intergenic
1191106280 X:56774044-56774066 GCACCCACCTCACCTACAGCAGG + Intergenic
1191107273 X:56779446-56779468 GCACCCACCTCACCTACAGCAGG + Intergenic
1191780809 X:64863204-64863226 CTCCCCACCTCCCCCACAGCAGG + Intergenic
1192431904 X:71118532-71118554 GGCCCCACCTCCTCTGCAGTCGG + Intergenic
1194200849 X:90951566-90951588 GGGCAAACCACCCCTACAGGTGG + Intergenic
1195148748 X:102044202-102044224 AACCCCTCCACCACTACAGCTGG + Intergenic
1196466087 X:115972924-115972946 CTCCCCACCACCCCAACAGAGGG + Intergenic
1198549446 X:137729377-137729399 GGCCCCACCTCACCTCCAACAGG + Intergenic