ID: 934527004

View in Genome Browser
Species Human (GRCh38)
Location 2:95058262-95058284
Sequence GGGCCCGGGAGCCACTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934527004_934527013 18 Left 934527004 2:95058262-95058284 CCAGCAGAGTGGCTCCCGGGCCC No data
Right 934527013 2:95058303-95058325 CTTCATGTCTCACTGTGACAGGG No data
934527004_934527012 17 Left 934527004 2:95058262-95058284 CCAGCAGAGTGGCTCCCGGGCCC No data
Right 934527012 2:95058302-95058324 GCTTCATGTCTCACTGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934527004 Original CRISPR GGGCCCGGGAGCCACTCTGC TGG (reversed) Intergenic
No off target data available for this crispr