ID: 934528228

View in Genome Browser
Species Human (GRCh38)
Location 2:95066295-95066317
Sequence ACACATGTATTTTCTCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934528225_934528228 17 Left 934528225 2:95066255-95066277 CCAACAGCGCTATAACTCATGCC No data
Right 934528228 2:95066295-95066317 ACACATGTATTTTCTCTGCAAGG No data
934528227_934528228 -4 Left 934528227 2:95066276-95066298 CCTGAACAAAGCTGGTCTAACAC No data
Right 934528228 2:95066295-95066317 ACACATGTATTTTCTCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934528228 Original CRISPR ACACATGTATTTTCTCTGCA AGG Intergenic
No off target data available for this crispr