ID: 934529710

View in Genome Browser
Species Human (GRCh38)
Location 2:95077237-95077259
Sequence AACCTGCAGGGACCCTACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934529701_934529710 1 Left 934529701 2:95077213-95077235 CCGCTATCCTGGCGGGGCGCCCC No data
Right 934529710 2:95077237-95077259 AACCTGCAGGGACCCTACCAGGG No data
934529694_934529710 28 Left 934529694 2:95077186-95077208 CCTGGTGAAACAGGGAGGTTTTC No data
Right 934529710 2:95077237-95077259 AACCTGCAGGGACCCTACCAGGG No data
934529702_934529710 -6 Left 934529702 2:95077220-95077242 CCTGGCGGGGCGCCCCCAACCTG No data
Right 934529710 2:95077237-95077259 AACCTGCAGGGACCCTACCAGGG No data
934529700_934529710 6 Left 934529700 2:95077208-95077230 CCTGGCCGCTATCCTGGCGGGGC No data
Right 934529710 2:95077237-95077259 AACCTGCAGGGACCCTACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934529710 Original CRISPR AACCTGCAGGGACCCTACCA GGG Intergenic
No off target data available for this crispr