ID: 934529943

View in Genome Browser
Species Human (GRCh38)
Location 2:95079008-95079030
Sequence ACTTCAGCCTCCAGTGTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934529943_934529945 -2 Left 934529943 2:95079008-95079030 CCAGTTACACTGGAGGCTGAAGT No data
Right 934529945 2:95079029-95079051 GTACAGGATCGCTTCATCCCAGG No data
934529943_934529946 7 Left 934529943 2:95079008-95079030 CCAGTTACACTGGAGGCTGAAGT No data
Right 934529946 2:95079038-95079060 CGCTTCATCCCAGGAAGTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934529943 Original CRISPR ACTTCAGCCTCCAGTGTAAC TGG (reversed) Intergenic
No off target data available for this crispr