ID: 934529945

View in Genome Browser
Species Human (GRCh38)
Location 2:95079029-95079051
Sequence GTACAGGATCGCTTCATCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934529941_934529945 5 Left 934529941 2:95079001-95079023 CCTGTGGCCAGTTACACTGGAGG No data
Right 934529945 2:95079029-95079051 GTACAGGATCGCTTCATCCCAGG No data
934529943_934529945 -2 Left 934529943 2:95079008-95079030 CCAGTTACACTGGAGGCTGAAGT No data
Right 934529945 2:95079029-95079051 GTACAGGATCGCTTCATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934529945 Original CRISPR GTACAGGATCGCTTCATCCC AGG Intergenic
No off target data available for this crispr