ID: 934537365

View in Genome Browser
Species Human (GRCh38)
Location 2:95146491-95146513
Sequence TTGCAGGCTGAGATGTGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1481
Summary {0: 1, 1: 0, 2: 4, 3: 111, 4: 1365}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934537358_934537365 8 Left 934537358 2:95146460-95146482 CCCCGGCTGATAGAACAGCTAAG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 934537365 2:95146491-95146513 TTGCAGGCTGAGATGTGGAAAGG 0: 1
1: 0
2: 4
3: 111
4: 1365
934537361_934537365 6 Left 934537361 2:95146462-95146484 CCGGCTGATAGAACAGCTAAGGT 0: 1
1: 0
2: 0
3: 6
4: 90
Right 934537365 2:95146491-95146513 TTGCAGGCTGAGATGTGGAAAGG 0: 1
1: 0
2: 4
3: 111
4: 1365
934537359_934537365 7 Left 934537359 2:95146461-95146483 CCCGGCTGATAGAACAGCTAAGG 0: 1
1: 0
2: 0
3: 15
4: 184
Right 934537365 2:95146491-95146513 TTGCAGGCTGAGATGTGGAAAGG 0: 1
1: 0
2: 4
3: 111
4: 1365
934537357_934537365 9 Left 934537357 2:95146459-95146481 CCCCCGGCTGATAGAACAGCTAA 0: 1
1: 0
2: 0
3: 4
4: 39
Right 934537365 2:95146491-95146513 TTGCAGGCTGAGATGTGGAAAGG 0: 1
1: 0
2: 4
3: 111
4: 1365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934537365 Original CRISPR TTGCAGGCTGAGATGTGGAA AGG Intronic
900359075 1:2279269-2279291 AGGCAGGCTGAGGGGTGGAAGGG + Intronic
900822676 1:4901382-4901404 TTACAGGCTCATAGGTGGAAGGG - Intergenic
900939737 1:5790917-5790939 TTACAGGCTCATAGGTGGAAGGG + Intergenic
901335365 1:8444399-8444421 TTACAGGCTCATAGGTGGAAGGG + Intronic
901905108 1:12401807-12401829 GCTCAGGCTGAGATGTGGAAAGG - Intronic
902814251 1:18907214-18907236 CTCCAAGCTGAGATTTGGAAGGG + Exonic
903380780 1:22895690-22895712 TTGCAGGGAGAGATGTGGGTAGG + Intronic
903429352 1:23280957-23280979 TGGGAGGCTGAGAGGTGGGAGGG - Intergenic
904057297 1:27679895-27679917 TTACAGGCTCATAGGTGGAAGGG - Intergenic
904427424 1:30437971-30437993 TTACAGGCTCATAGGTGGAAGGG + Intergenic
906125257 1:43423471-43423493 TAGCGGGGTGAGGTGTGGAAGGG + Intronic
906612740 1:47214476-47214498 TTCCACGCTGAGGTCTGGAAGGG - Intergenic
906835829 1:49082820-49082842 TTACAGGCTCATAGGTGGAAGGG - Intronic
906937410 1:50226224-50226246 TTACAGGCTCATAGGTGGAAGGG + Intergenic
907343931 1:53758727-53758749 TTACAGGCTTATAGGTGGAAGGG - Intergenic
907522402 1:55032717-55032739 TTACAGGCTCATAGGTGGAAGGG + Intergenic
907556001 1:55344658-55344680 TTACAGGCTCACAGGTGGAAGGG + Intergenic
907863086 1:58372435-58372457 TTACAGGCTCAGAGGTGGAAGGG + Intronic
907921103 1:58912648-58912670 TTGCTGTCTGAGATGTGCAGAGG - Intergenic
908011788 1:59785937-59785959 TTACAGGCTCATAGGTGGAAAGG - Intergenic
908068508 1:60433669-60433691 TTACAGGCTTATAGGTGGAAGGG - Intergenic
908091124 1:60686406-60686428 TTACAGGCTCATAGGTGGAAGGG + Intergenic
908124132 1:61013439-61013461 TTGCAAACTCAGATGTGGATGGG - Intronic
908571483 1:65415953-65415975 TACCAGGCTGATGTGTGGAATGG - Intergenic
908624686 1:66027602-66027624 TTACAGGCTCATAGGTGGAAGGG - Intronic
908879127 1:68710720-68710742 TTACAGGCTCATAGGTGGAAAGG + Intergenic
908932192 1:69330999-69331021 TTACAGGCTCACAGGTGGAAGGG - Intergenic
908967749 1:69786973-69786995 TTACAGGCTCATAGGTGGAAGGG - Intronic
909043892 1:70686330-70686352 GTGCTGGCTGAGATAGGGAAGGG + Intergenic
909083798 1:71147503-71147525 TTACAGGCTCATAAGTGGAAGGG + Intergenic
909364217 1:74800500-74800522 TTTCAGCATGAGATGTGGAGAGG + Intergenic
909422667 1:75484228-75484250 TTACAGGCTTATAGGTGGAAGGG - Intronic
909632784 1:77785179-77785201 TTACAGGCTTATAGGTGGAAGGG - Intronic
909681362 1:78295151-78295173 TTACAGGCTCATAGGTGGAAGGG + Intergenic
909756958 1:79239268-79239290 TTACAGGCTCATAGGTGGAAGGG - Intergenic
909813311 1:79959106-79959128 TTGCAGGCTCATAGGTGGAAGGG - Intergenic
909860761 1:80602434-80602456 TTTCAGCATGAGATTTGGAAGGG + Intergenic
910013697 1:82495935-82495957 TTACAGGCTCATAAGTGGAAGGG - Intergenic
910055928 1:83032792-83032814 TTACAGGCTCATAGGTGGAAGGG + Intergenic
910109735 1:83669943-83669965 TTACAGGCTGAGAGGCAGAAGGG + Intergenic
910460543 1:87444190-87444212 TTGCAGGCTTATATTTGGAAGGG - Intergenic
910546041 1:88420345-88420367 TTACAGGCTGGTAAGTGGAAGGG + Intergenic
910623823 1:89285057-89285079 TTACAGGCTCATAGGTGGAAGGG + Intergenic
910642622 1:89480355-89480377 TTACAGGCTCATAGGTGGAAGGG - Intergenic
911071863 1:93838200-93838222 CTGCAGGCTGAGAAGTTCAAGGG + Intronic
911275079 1:95850438-95850460 TTGCAGGCTCATAGGTGGAATGG + Intergenic
911358591 1:96849766-96849788 TTCCAGGCTCATAGGTGGAAGGG + Intergenic
911529110 1:99022793-99022815 TTGCAATATGAGATTTGGAAGGG - Intergenic
911535072 1:99090005-99090027 TTACAGGCTCATAGGTGGAAGGG + Intergenic
911708230 1:101040077-101040099 TTACAGGCTCATAGGTGGAAGGG - Intergenic
911791010 1:102015084-102015106 TTGCAGGCTCATAGGTGGAAGGG + Intergenic
912004425 1:104879094-104879116 TTGCAGGCTCATAGGTGGAAGGG + Intergenic
912042757 1:105412123-105412145 TTACAGGCTCATAAGTGGAAGGG + Intergenic
912051969 1:105541340-105541362 TTACAGGCTCAAAGGTGGAAGGG - Intergenic
912135423 1:106655710-106655732 TTACAGGCTCATAGGTGGAAAGG - Intergenic
912263479 1:108131819-108131841 TTACAGGCTCATAGGTGGAAGGG - Intergenic
912610229 1:111034925-111034947 TTACAGGCTCATAGGTGGAAGGG + Intergenic
912615552 1:111096539-111096561 TTTCAGCATGAGATTTGGAAGGG + Intergenic
912861068 1:113214421-113214443 TTACAGGCTCACAGGTGGAAGGG - Intergenic
912906989 1:113718060-113718082 TTACAGGCTCATAGGTGGAAGGG - Intronic
913240886 1:116828238-116828260 TTTCAGCATGAGATGTGGAGGGG + Intergenic
913428012 1:118756352-118756374 TTTAAGGCTGGGCTGTGGAATGG - Intergenic
913709896 1:121472652-121472674 TTACAGGCTCATAGGTGGAAGGG - Intergenic
914317777 1:146530476-146530498 TTACAGGCTCATATTTGGAAGGG - Intergenic
914496580 1:148202882-148202904 TTACAGGCTCATATTTGGAAGGG + Intergenic
914857507 1:151363283-151363305 TTACAGGCTCATAGGTGGAAGGG + Intergenic
915804259 1:158828301-158828323 TTACAGGCTCATAGGTGGAAGGG - Intergenic
916044355 1:160988037-160988059 TTGAAGGCTGGGATGTGCTAAGG - Intergenic
916296663 1:163227718-163227740 TTACAGGCTCATAAGTGGAAGGG - Intronic
916688994 1:167172823-167172845 TTACAGGCTCATAGGTGGAAGGG + Intergenic
916734710 1:167597646-167597668 TTACAGGCTCATAGGTGGAAGGG - Intergenic
916829999 1:168481206-168481228 TTGCAGGCTGAGAATTGAAGGGG + Intergenic
916959316 1:169872912-169872934 TTACAGGCTCATAGGTGGAAGGG + Intronic
917043763 1:170834227-170834249 TTACAGGCTCATAGGTGGAAGGG + Intergenic
917082735 1:171272807-171272829 TTACAGGCTCATAGGTGGAAGGG + Intronic
917190650 1:172415050-172415072 TTCCAGCCTGAGGAGTGGAATGG + Intronic
917245647 1:172997514-172997536 TTACAGGCTCATAGGTGGAAGGG + Intergenic
917355816 1:174125214-174125236 TTACAGGCTCATAGGTGGAAGGG + Intergenic
917577989 1:176344476-176344498 TTACAGGCTCATAGGTGGAAGGG - Intergenic
917699874 1:177569573-177569595 ATGCAGGCTGAGAGGTAGAGGGG - Intergenic
918094199 1:181321235-181321257 TTTCAGCATGAGATTTGGAAGGG + Intergenic
918119990 1:181529834-181529856 TTACAGGCTCATAGGTGGAAGGG + Intronic
918230684 1:182528462-182528484 TTACAGGCTCACAGGTGGAAGGG - Intronic
918322975 1:183382525-183382547 TTACAGGCTCATAGGTGGAAGGG - Intronic
918633611 1:186748327-186748349 TTGCAAGCTCATAGGTGGAAGGG + Intergenic
919291825 1:195643108-195643130 TTACAGGCTCATAGGTGGAAGGG - Intergenic
919311755 1:195918046-195918068 TTACAGGCTCATAAGTGGAAGGG + Intergenic
919362511 1:196612328-196612350 TTACAGGCTCATAGGTGGAAGGG + Intergenic
919366718 1:196670187-196670209 TTACAAGCTCATATGTGGAAGGG + Intronic
919554200 1:199031083-199031105 TTACAGGCTCATAGGTGGAAGGG - Intergenic
919782129 1:201227834-201227856 TTGCAGGCTGAGAGATGAACAGG + Intronic
919798282 1:201334809-201334831 TGGCAGCCTAAGCTGTGGAAAGG + Intergenic
919960220 1:202459797-202459819 TTGCATTCTGAGCTGTGGACTGG - Intronic
920860217 1:209699741-209699763 TTACAGGCTGATAGGCGGAAGGG - Intronic
921000684 1:211039813-211039835 TTACAGGCTCATAGGTGGAAGGG + Intronic
921279040 1:213547546-213547568 TTTCAGTGTGAGATTTGGAAGGG - Intergenic
921386792 1:214577744-214577766 TTACAGGCTCATAGGTGGAAGGG + Intergenic
921424443 1:214985440-214985462 TTACAGGCTCATAGGTGGAAGGG + Intergenic
921909139 1:220528513-220528535 TGGCAGGATGAGGCGTGGAAGGG - Intronic
922058339 1:222063431-222063453 TTACAGGCTCATAGGTGGAAGGG - Intergenic
922115278 1:222607483-222607505 TTACAGGCTCATAGGTGGAAGGG - Intergenic
922530614 1:226342196-226342218 TTACAGGCTCATAGGTGGAAGGG + Intergenic
922667689 1:227487041-227487063 TTACAGGCTCATAGGTGGAAGGG - Intergenic
922972274 1:229752746-229752768 TTGCATGCTCAGCAGTGGAATGG - Intergenic
923339345 1:232994474-232994496 TTACAGGCTCATAGGTGGAAGGG + Intronic
923461307 1:234211712-234211734 TTACAGGCTCATAGGTGGAAGGG + Intronic
923860336 1:237886500-237886522 ATGTAGGCTGAAATGTAGAATGG + Intronic
924351220 1:243116292-243116314 TTGCGGGGAGAGATGTGGCAGGG - Intergenic
924664432 1:246056261-246056283 TTGCAGGATGAAATGAGGAAAGG - Intronic
924806697 1:247367017-247367039 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1062801177 10:381686-381708 TTGCAGGCAGAACTGTGGAAGGG - Intronic
1063335536 10:5210007-5210029 TTACAGGCTTATAGGTGGAAGGG - Intronic
1063710498 10:8472611-8472633 TTTCAGCCTGAGATTTGGAGGGG + Intergenic
1064403201 10:15038240-15038262 TTACAGGCTGATAGGCGGAAGGG + Intronic
1064676135 10:17762216-17762238 TAGCAGACTGAGATGTGGCGTGG - Intronic
1064960188 10:20954868-20954890 TTGCAGGCAGAAGTGTGAAATGG + Intronic
1065271364 10:24036842-24036864 TTGGAGGTTGAGACTTGGAAGGG + Intronic
1065311099 10:24416700-24416722 CTGCAGGCTGGGATGTGGGGGGG - Intronic
1065433590 10:25684286-25684308 TTTCAGCATGAGTTGTGGAAGGG + Intergenic
1065484805 10:26227430-26227452 TTGCAGAGTGAGGTGTGGGAGGG + Intronic
1066040670 10:31545732-31545754 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1066046349 10:31598892-31598914 TTTCAGTGTGAGATTTGGAAGGG - Intergenic
1066083592 10:31955772-31955794 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1066273219 10:33843944-33843966 TTACAGGCTTATAGGTGGAAGGG - Intergenic
1066451961 10:35537762-35537784 TTTCAGGCTCATAGGTGGAAGGG + Intronic
1066977732 10:42384966-42384988 ATACAGGCAGAGATATGGAAGGG + Intergenic
1067351637 10:45481247-45481269 TTACAGGCTCACAGGTGGAAGGG + Intronic
1068184296 10:53564804-53564826 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1068284966 10:54922455-54922477 TTACAGGCTCATATGTGGAAAGG + Intronic
1068305344 10:55200462-55200484 TTACAGGCTCATAGGTGGAAGGG + Intronic
1069077262 10:64051666-64051688 TTGCAGTCTCATAGGTGGAAGGG - Intergenic
1069424602 10:68278508-68278530 TTACAGGCTCATAAGTGGAAGGG + Intergenic
1069532125 10:69227270-69227292 TTCCGGGCTGAGATGGAGAAGGG + Exonic
1069754722 10:70766704-70766726 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1069947225 10:71996095-71996117 TTGCCAGCTGTGGTGTGGAATGG + Intronic
1070375883 10:75830882-75830904 TTACAGGCTCATAGGTGGAAGGG - Intronic
1070974723 10:80597286-80597308 TTCCAGGCTGAGATTTTGAGGGG - Intronic
1071098819 10:82011574-82011596 TTACAGGCTCATAGGTGGAAGGG - Intronic
1071338461 10:84621256-84621278 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1071549969 10:86559417-86559439 TTACAGGCTCACAGGTGGAAGGG - Intergenic
1071667031 10:87568424-87568446 TTACAGGCTCATAGGTGGAAAGG + Intergenic
1071671382 10:87612273-87612295 TTACAGGCTCATAGGTGGAAAGG + Intergenic
1071812361 10:89197695-89197717 CTGCAGGCTGGGATCTGGGATGG + Intergenic
1071873355 10:89818455-89818477 TTACAGGCTCATAAGTGGAAGGG - Intergenic
1072358340 10:94633914-94633936 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1072866406 10:99066912-99066934 TTACAGGCTCATAGGTGGAAAGG - Intronic
1073135173 10:101216251-101216273 TAGCACGCTGAGATGTGGGAAGG + Intergenic
1073734119 10:106326534-106326556 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1074266232 10:111906353-111906375 TTTCAAGATGAGATTTGGAAGGG - Intergenic
1074804018 10:117029310-117029332 TTACAGGCTTATATGGGGAAGGG + Intronic
1074920957 10:118010760-118010782 TTGCAGGCAGAAATGCGTAATGG + Intronic
1075409362 10:122216042-122216064 TTGCTGGCTCAGATTTGGAGGGG - Intronic
1075562061 10:123475040-123475062 TTGGAGGCTGGGATCTGGACTGG + Intergenic
1075737053 10:124670443-124670465 TTGCAGGCTGGGGTGAGGAGCGG - Intronic
1076115780 10:127898360-127898382 TTCCAGGCTACGGTGTGGAAGGG - Intergenic
1076643942 10:131938516-131938538 TAGCAGGCTGAAATGGGGAGGGG - Intronic
1076763718 10:132619142-132619164 TTGCAGGTTCATAGGTGGAAAGG - Intronic
1077223547 11:1427758-1427780 TTGCAGGGGGAGATGATGAAGGG + Intronic
1077426119 11:2478840-2478862 TTACAGGCTCATAGGTGGAAGGG - Intronic
1077913283 11:6593140-6593162 TTGCAGGGGGAGAGATGGAAAGG - Intronic
1077984940 11:7342303-7342325 TTACAGGCTCATAGGTGGAAGGG - Intronic
1078365128 11:10700112-10700134 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1078482313 11:11688096-11688118 TTACAGGCTCACAGGTGGAAGGG + Intergenic
1078496625 11:11824320-11824342 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1078686709 11:13538729-13538751 TTGCAGGCTTATAGGTGGAAGGG + Intergenic
1078712590 11:13809115-13809137 TGGCAGCCTGAGGTGAGGAATGG + Intergenic
1078978697 11:16506445-16506467 TTACAGGCTCATAGGTGGAAGGG + Intronic
1079049906 11:17145078-17145100 TTACAGGCTCATAGGTGGAAGGG + Intronic
1079117137 11:17647045-17647067 TTGCAGAGTGGGGTGTGGAAGGG - Intronic
1079686175 11:23362592-23362614 TTACAGGCTCATAGGTGGAAAGG - Intergenic
1079739275 11:24036900-24036922 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1079835074 11:25323717-25323739 TTACAGGCTCATAAGTGGAAGGG + Intergenic
1080167896 11:29261881-29261903 GTGCTGGCTGTGATGTGGAAGGG + Intergenic
1080215281 11:29832721-29832743 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1080359234 11:31493669-31493691 TTGTAGGCTCATAGGTGGAAAGG - Intronic
1080715761 11:34798197-34798219 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1080739419 11:35049683-35049705 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1080817537 11:35772755-35772777 TTACAGGCTCATAGGTGGAAGGG + Intronic
1080830971 11:35893001-35893023 TTTCAGCATGAGATTTGGAAGGG - Intergenic
1080997346 11:37619681-37619703 TTACAGGCTGATATGAGAAAGGG + Intergenic
1081002883 11:37696217-37696239 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1081119961 11:39254770-39254792 TTACAGGCTCATAAGTGGAAGGG - Intergenic
1081136831 11:39449751-39449773 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1081175558 11:39922739-39922761 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1081224208 11:40500911-40500933 TTACAGGCTCATAGGTGGAAGGG - Intronic
1081358525 11:42144116-42144138 TTGCAGGCTCATAGGTGGAAGGG - Intergenic
1081769131 11:45636475-45636497 TTACAGGCTTATAGGTGGAAGGG + Intergenic
1081782056 11:45719905-45719927 TAGCATGCTGGGATGTGGCATGG - Intergenic
1082766083 11:57169153-57169175 TTGCAGGCTCATAGGTGAAAGGG - Intergenic
1082827098 11:57587823-57587845 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1082934762 11:58645286-58645308 TTACAGGCTCATAAGTGGAAGGG - Intronic
1082982002 11:59132338-59132360 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1083496386 11:63057959-63057981 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1084309872 11:68310865-68310887 GAGCAGGGTGAGATGTGGGAAGG + Intergenic
1085236600 11:75020209-75020231 TTACAGGCTCATAGGTGGAAAGG + Intergenic
1085526453 11:77166899-77166921 GTGCAGGGTGAGATGGGGAGAGG - Intronic
1085755124 11:79195698-79195720 TTACAGGCTCATAGGTGGAAGGG + Intronic
1085856694 11:80183262-80183284 TTGCATGCTGGAAGGTGGAAGGG - Intergenic
1085875835 11:80405217-80405239 TTGCAGGCTGATAGGCAGAAGGG + Intergenic
1085890429 11:80572933-80572955 TTGCAGGCTCATAGGTAGAAGGG - Intergenic
1085906932 11:80774940-80774962 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1085941729 11:81213546-81213568 TTACAGGCTCACAGGTGGAAGGG - Intergenic
1086035345 11:82408060-82408082 TTGCTGCCTGAGATATGGTAAGG - Intergenic
1086519139 11:87650454-87650476 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1086580261 11:88391293-88391315 TTACAGGCTCATAGGTGGAAAGG - Intergenic
1086605088 11:88686379-88686401 TTACAGGCTCATAGGTGGAAGGG + Intronic
1086729210 11:90227463-90227485 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1086764408 11:90676433-90676455 TTACAGGCTCACAGGTGGAAAGG + Intergenic
1086848579 11:91782523-91782545 TTACAGGCTTATAGGTGGAAGGG - Intergenic
1086933727 11:92722148-92722170 TTACAGGCTCATAGGTGGAAGGG - Intronic
1087497430 11:98908619-98908641 TTACAGGCTTATAGGTGGAAGGG + Intergenic
1087511503 11:99101457-99101479 TTACAGGCTCATAGGTGGAAGGG - Intronic
1087576866 11:100000227-100000249 TTACAGGCTCATAGGTGGAAAGG - Intronic
1087675715 11:101158807-101158829 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1087793736 11:102433516-102433538 TTACAGGCTCATAGGTGGAAGGG + Intronic
1088014127 11:105038195-105038217 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1088188858 11:107205070-107205092 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1088953762 11:114598002-114598024 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1089025767 11:115268330-115268352 TTTCAGCCTGTGAGGTGGAAAGG + Intronic
1089042577 11:115466959-115466981 TGTCAGGCTGATTTGTGGAAAGG - Intronic
1090756258 11:129794502-129794524 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1090842868 11:130507918-130507940 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1090972371 11:131654545-131654567 TTTCAGCATGAGATTTGGAAGGG - Intronic
1091011948 11:132009460-132009482 CTGCAGACAGTGATGTGGAAAGG + Intronic
1091065787 11:132510269-132510291 TTACAGGCTCATAGGTGGAAGGG + Intronic
1091350809 11:134892545-134892567 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1091618707 12:2069163-2069185 TTGCAGGCTGTGATGTCTACAGG - Intronic
1091961918 12:4702964-4702986 TTGCAGGCTTTGATGAGGGAGGG + Intronic
1092458994 12:8670303-8670325 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1092993627 12:13927106-13927128 TTTCAGGCTGAGATGTTGGGTGG - Intronic
1093313119 12:17616811-17616833 TTACAGGCTTATAGGTGGAAGGG - Intergenic
1093324669 12:17759478-17759500 TTACAGGCTGATTGGTGGAAGGG - Intergenic
1093350918 12:18102676-18102698 TTGCAGGCTCAGAGGCAGAAGGG - Intronic
1093426230 12:19032236-19032258 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1093478856 12:19584040-19584062 TTACAGGCTCATAAGTGGAAGGG + Intronic
1093596936 12:20973159-20973181 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1093656748 12:21703511-21703533 TTGGAGACTCAGAGGTGGAAGGG - Intronic
1093682992 12:22024161-22024183 TTACAGGCTTATAGGTGGAAAGG + Intergenic
1093846398 12:23977302-23977324 TTGGAGGCTGGGAGGTGGAAGGG - Intergenic
1093967170 12:25340140-25340162 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1094420356 12:30264289-30264311 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1094798376 12:34001927-34001949 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1095235112 12:39785965-39785987 TTACAGGCTCATAGGTGGAAGGG + Intronic
1095242721 12:39879698-39879720 TTACAGGCTCAAAAGTGGAAGGG + Intronic
1095765080 12:45886090-45886112 TTACAGGCTGATAGGTGGAAGGG - Intronic
1096236818 12:49934141-49934163 TTTCAGCATGAGATTTGGAAGGG + Intergenic
1097136962 12:56865008-56865030 TTACAGGCTCACAGGTGGAAGGG + Intergenic
1097481117 12:60126839-60126861 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1097580781 12:61454069-61454091 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1097654591 12:62344179-62344201 TTACAGGCTCATAGGTGGAAGGG - Intronic
1097757816 12:63426668-63426690 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1098296887 12:69012996-69013018 TTTCAGCATGAGATTTGGAAGGG - Intergenic
1098319926 12:69232699-69232721 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1099104972 12:78486131-78486153 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1099128325 12:78794540-78794562 TTGAATCCTGAGATATGGAAAGG + Intergenic
1099360585 12:81695072-81695094 TTTCAGGCTCATAGGTGGAAGGG + Intronic
1099674575 12:85742482-85742504 TTACAGGCTCATAAGTGGAAGGG - Intergenic
1099769064 12:87029381-87029403 TTACAGGCTTATAGGTGGAAGGG - Intergenic
1099892949 12:88611543-88611565 TTTCAGTATGAGATTTGGAAAGG + Intergenic
1100060177 12:90565859-90565881 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1100147672 12:91697936-91697958 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1100398163 12:94202879-94202901 TTGCAGACTGAGGTGCTGAAAGG + Intronic
1100937820 12:99690437-99690459 TTACAGGCTTATAGGTGGAAGGG - Intronic
1101027443 12:100625007-100625029 ATGGAGGCTGGGATGAGGAAAGG + Intronic
1101083858 12:101215317-101215339 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1101113367 12:101507370-101507392 TTACAGGCTCATAGGTGGAAAGG + Intergenic
1101256113 12:102978355-102978377 TTGCCGGCACAGATATGGAAGGG - Intergenic
1101692856 12:107097432-107097454 TTACAGGCTTATAGGTGGAAGGG + Intergenic
1102310362 12:111840291-111840313 CTGAAGGATTAGATGTGGAAGGG - Intergenic
1102437437 12:112936331-112936353 CTGGAGGCAGAGATGAGGAAAGG + Intergenic
1103401199 12:120644058-120644080 TTTGAGGCTAAGGTGTGGAATGG + Intronic
1103629761 12:122250700-122250722 TTGCAGTCTGAGAGCTGAAATGG + Intronic
1103880677 12:124163683-124163705 TTACAGGCTCATAGGTGGAAGGG - Intronic
1104421834 12:128642418-128642440 TTGCAGCATGAGATTTGGAGGGG - Intronic
1104807950 12:131601466-131601488 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1105285678 13:19001517-19001539 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1105379911 13:19877255-19877277 CTGCAAGCTGAGAAGTTGAAGGG + Intergenic
1105504103 13:20995399-20995421 ATGCATGCCAAGATGTGGAAAGG + Intronic
1105609341 13:21954582-21954604 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1105647810 13:22339633-22339655 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1105650439 13:22371699-22371721 TTGTAGGCTTATAGGTGGAAGGG - Intergenic
1105824344 13:24108724-24108746 TTGAAAGGTGAGATGAGGAAAGG - Intronic
1106262209 13:28077766-28077788 TTACAGGCTCATAGGTGGAAGGG - Intronic
1106614542 13:31314617-31314639 TTACAGGCTCATAGGTGGAAGGG + Intronic
1106614838 13:31316665-31316687 TTGCAGGCTTATAGGTGGAAGGG + Intronic
1106678414 13:31985291-31985313 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1107209701 13:37837652-37837674 TTACAGGCTCATAGGTGGAAGGG + Intronic
1108419580 13:50234483-50234505 TTACAGGCTCATAGGTGGAAGGG + Intronic
1108724234 13:53163185-53163207 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1108850952 13:54728411-54728433 TTGCAGGCTCATAGGTGAAAGGG + Intergenic
1108950712 13:56088447-56088469 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1108981603 13:56522107-56522129 TTATAGGCTCAGAGGTGGAAGGG + Intergenic
1108984650 13:56570193-56570215 CTGCAGGCTGAGAAGTTCAAGGG - Intergenic
1109342320 13:61076899-61076921 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1109346842 13:61125312-61125334 TTACAGGCTCATAGGTGGAAAGG - Intergenic
1109393574 13:61725081-61725103 TTACAGGCTTATAGGTGGAAGGG - Intergenic
1109482360 13:62973286-62973308 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1109523035 13:63536990-63537012 TTGCTGCCTGAGATTGGGAAAGG - Intergenic
1109609552 13:64745656-64745678 TGTCAGGCTGAGATGTAAAAAGG - Intergenic
1109718437 13:66246681-66246703 TTACAGGCTCATAGGTGGAAAGG + Intergenic
1109750609 13:66685941-66685963 TTACAGGCTTATAGGTGGAAGGG + Intronic
1109828326 13:67753274-67753296 TTGCATGCTGAGCTTGGGAATGG + Intergenic
1109853652 13:68101584-68101606 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1110033932 13:70654739-70654761 TTACAGGCTCATAAGTGGAAGGG + Intergenic
1110054890 13:70955129-70955151 TTGCAGACTGAGAAGTGTGATGG - Intergenic
1110083292 13:71345231-71345253 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1110189595 13:72715355-72715377 TTACAGGCTCATAGGTGGAAGGG + Intronic
1110208537 13:72946577-72946599 TTGCAGGCTCATAGGCGGAAGGG - Intronic
1110341859 13:74401988-74402010 TTTCAGGCTCATATGTTGAAGGG - Intergenic
1110396013 13:75029926-75029948 TTACAGGCTCAAAGGTGGAAGGG + Intergenic
1110511535 13:76356430-76356452 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1111029963 13:82583715-82583737 TTGGATGCAGAGATGAGGAAGGG - Intergenic
1111144805 13:84166430-84166452 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1111219166 13:85181313-85181335 TTGCCGGCTCATAGGTGGAAGGG + Intergenic
1111318143 13:86587170-86587192 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1111325734 13:86694346-86694368 TTACAGGCTCATAAGTGGAAGGG - Intergenic
1111594213 13:90390026-90390048 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1111606568 13:90546971-90546993 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1111609453 13:90584492-90584514 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1111621686 13:90732493-90732515 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1111629010 13:90826173-90826195 TTACAGGCTCATAAGTGGAAGGG - Intergenic
1111716559 13:91886552-91886574 TTACAGGCTTATAGGTGGAAGGG - Intronic
1111718903 13:91917101-91917123 TTACAGGCTCATACGTGGAAGGG - Intronic
1112162959 13:96888549-96888571 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1112194086 13:97207806-97207828 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1112259213 13:97863252-97863274 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1112264392 13:97909626-97909648 TTAAAGGCAGAGATGTGGAAAGG - Intergenic
1112363635 13:98739200-98739222 GTGCAGGCTCATAGGTGGAAAGG + Intronic
1112512334 13:100020780-100020802 TTACAGGCTCACAGGTGGAAGGG + Intergenic
1112742856 13:102495032-102495054 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1112861165 13:103830801-103830823 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1113345496 13:109473873-109473895 TTTCATGCTGAGATGCTGAAGGG + Intergenic
1113512136 13:110864845-110864867 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1113645388 13:111991309-111991331 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1114380599 14:22199234-22199256 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1114661987 14:24352609-24352631 TTGGAGACTCAGATGTGGGAAGG + Intergenic
1114687475 14:24547854-24547876 TTACAGGCTCACAGGTGGAAGGG - Intergenic
1114689147 14:24563972-24563994 TTACAGGCTCATAGGTGGAAAGG + Intergenic
1114812623 14:25917926-25917948 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1114926194 14:27402617-27402639 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1114948503 14:27716576-27716598 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1115012427 14:28565429-28565451 TTCCATGGTGAGAGGTGGAAGGG - Intergenic
1115021370 14:28684758-28684780 TTACAGGCTCACAGGTGGAAGGG + Intergenic
1115121497 14:29942392-29942414 TTACAGGCTCACAGGTGGAAGGG + Intronic
1115132793 14:30073413-30073435 TTACAGGCTAATAGGTGGAAGGG + Intronic
1115159139 14:30373507-30373529 TTGGAGGCTGGGAGATGGAATGG - Intergenic
1115277394 14:31623283-31623305 TTACAGACTCATATGTGGAAGGG + Intronic
1115608955 14:35033923-35033945 TTACAGGCTCAGAGGTGGAAGGG - Intergenic
1115878876 14:37892457-37892479 TTACAGGCTCATAGGTGGAAGGG + Intronic
1115929853 14:38478611-38478633 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1115942933 14:38628824-38628846 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1116126953 14:40800485-40800507 TTACAGGCTCACAGGTGGAAGGG - Intergenic
1116263656 14:42661421-42661443 TTACAGGCTCATAAGTGGAAGGG + Intergenic
1116296563 14:43119127-43119149 TTACAGGCTCATAAGTGGAAGGG - Intergenic
1116362212 14:44014361-44014383 TTGCAGGTTTATAGGTGGAAGGG + Intergenic
1116369431 14:44110419-44110441 TTACAGGCTCATAAGTGGAAGGG + Intergenic
1116533972 14:46007618-46007640 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1116559414 14:46359435-46359457 TTACAGGCTCATACGTGGAAAGG - Intergenic
1116714076 14:48406466-48406488 TTACAGGCTTAGAGGTGAAAGGG - Intergenic
1116780959 14:49236875-49236897 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1116854283 14:49938082-49938104 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1117182055 14:53201041-53201063 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1117186391 14:53244680-53244702 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1117304428 14:54459790-54459812 TTACAGGCTTATAGGTGGAAGGG + Intergenic
1117396018 14:55311543-55311565 TTACAGGCTGCTAGGTGGAAGGG - Intronic
1117751576 14:58929592-58929614 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1117886830 14:60372497-60372519 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1117984456 14:61373978-61374000 TTACAGGCTCATAGGTGGAAGGG - Intronic
1118046408 14:61975944-61975966 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1118092407 14:62497236-62497258 TTATAGGCTCAGAGGTGGAAGGG - Intergenic
1118151530 14:63195471-63195493 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1118835869 14:69477531-69477553 TTACAGGCTCATAAGTGGAAGGG - Intergenic
1119025871 14:71151718-71151740 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1119040484 14:71269976-71269998 TTACAGGCTGATAGGTGGAAGGG + Intergenic
1119150937 14:72358691-72358713 TTACAGGCTCATAGGTGGAAGGG + Intronic
1119208008 14:72809190-72809212 CTGCAGGCTGAGAAGTTCAAGGG - Intronic
1119769765 14:77213195-77213217 CTCCAAGCTGAGATGTGAAAGGG - Intronic
1119934098 14:78574692-78574714 TTACAGGCTCATAGGTGGAAGGG + Intronic
1120043211 14:79777006-79777028 TTGCAGGTGGAGGTGTGGGAAGG - Intronic
1120225946 14:81790934-81790956 TTACAGGCTCATAAGTGGAAGGG + Intergenic
1120270756 14:82310167-82310189 TTACAGGCTTATAAGTGGAAGGG + Intergenic
1120413893 14:84194526-84194548 TTTCAGGCTCATAGGTGGAAGGG + Intergenic
1120480846 14:85047367-85047389 TTGCAGGCTCATAGGTGGAAGGG + Intergenic
1120793540 14:88607559-88607581 TTGCAGGGTGAGATGGGGGATGG - Intronic
1120793579 14:88607750-88607772 TTGCAGGGTAAGATGGGGGATGG - Intronic
1120793591 14:88607802-88607824 TTGCAGGCTGAGGTGGGGGATGG - Intronic
1120793598 14:88607828-88607850 TTGCAGGCTGAGGTGGGGGATGG - Intronic
1120793605 14:88607854-88607876 TTGCAGGGTGAGATAGGGGATGG - Intronic
1120793624 14:88607931-88607953 TTGCAGGGTGAGATGGGGGATGG - Intronic
1120793631 14:88607961-88607983 TTGCAGGGTGAGATGGGGGATGG - Intronic
1120793638 14:88607987-88608009 TTGCAGGGTGAGATGGGGGATGG - Intronic
1120793645 14:88608017-88608039 TTGCAAGGTGAGATGGGGGATGG - Intronic
1120793651 14:88608043-88608065 TTGCAGGGTGAGATGGGGGATGG - Intronic
1120793658 14:88608069-88608091 TTGCAGGGTGAGATGGGGGATGG - Intronic
1120793674 14:88608145-88608167 TTGCAGGGTGAGATGGGGGATGG - Intronic
1120793681 14:88608171-88608193 TTGCAGGGTGAGATGGGGGATGG - Intronic
1120793688 14:88608197-88608219 TTGCAGGGTAAGATGGGGGATGG - Intronic
1120793707 14:88608285-88608307 TTGCAGGGTGAGATGGGGGATGG - Intronic
1121147109 14:91593639-91593661 TTACAGGCTCATAGGTGGAAGGG + Intronic
1121166613 14:91807664-91807686 TTGCAGGCTCATAGGCGGAAGGG + Intronic
1121458403 14:94054388-94054410 CTGCTGGCAAAGATGTGGAAGGG - Intronic
1121499158 14:94419737-94419759 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1121515387 14:94546249-94546271 TAGAAGGCTGAGATCTGGAAAGG - Intergenic
1121525386 14:94615801-94615823 TTGCAGGCTGAGGTTTGCATTGG - Intronic
1121707585 14:96010632-96010654 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1122023866 14:98860322-98860344 TTGCAGGATGGGAGGTGGAACGG - Intergenic
1122120839 14:99552624-99552646 TTGCTGTCTGAGGTGTGGGAGGG + Intronic
1122364346 14:101185618-101185640 TTGCAGGCTGCTGTGTGGACAGG - Intergenic
1122554672 14:102571314-102571336 TTGCAGGCTGGGCTGGGAAATGG + Intergenic
1122656843 14:103267806-103267828 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1123197428 14:106629854-106629876 TTACAGGCTTATAAGTGGAAAGG + Intergenic
1123737459 15:23199570-23199592 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1123821089 15:24031180-24031202 TAGCAGGCTGAGTAGGGGAAAGG + Intergenic
1123831209 15:24139593-24139615 TTCCAGGCTGTGGTGTGGCACGG - Intergenic
1123836158 15:24195319-24195341 TTCCAGGCTGTGGTGTGGCACGG - Intergenic
1123843810 15:24276625-24276647 TTCCAGGCTGTGGTGTGGCATGG - Intergenic
1123858889 15:24442906-24442928 TTCCAGGCTGTGGTGTGGCACGG - Intergenic
1123863527 15:24493295-24493317 TTCCAGGCTGTGGTGTGGCACGG - Intergenic
1123876245 15:24626811-24626833 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1123878553 15:24651301-24651323 TTCCAGGCTGTGGTGTGGCATGG - Intergenic
1124066372 15:26347640-26347662 TTACAGGCTGATAGGTGGAAGGG + Intergenic
1124226358 15:27898097-27898119 TTGCAGGCTCATAGGCGGAAGGG + Intronic
1124288673 15:28428233-28428255 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1124294553 15:28489081-28489103 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1124508970 15:30306274-30306296 TTACAGGCTCATAGGTGGAAAGG - Intergenic
1124663272 15:31568450-31568472 TTACAGGCTCACAGGTGGAAGGG + Intronic
1124691298 15:31825714-31825736 TTACAGGCTAATAGGTGGAAGGG - Intronic
1124734588 15:32232388-32232410 TTACAGGCTCATAGGTGGAAAGG + Intergenic
1124846997 15:33301002-33301024 CTGCAGGGAGAGATGTGGATGGG - Intergenic
1125231433 15:37461780-37461802 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1125246571 15:37647559-37647581 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1126190460 15:45873121-45873143 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1126242498 15:46461317-46461339 TTACAGGCTGAGATGAGGTCAGG - Intergenic
1126272978 15:46844312-46844334 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1126316568 15:47376296-47376318 ATGCAGGTTGAGATGAAGAAAGG - Intronic
1127043351 15:55001279-55001301 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1127161474 15:56191484-56191506 GTGCAGGCTCAGATGTGCATTGG - Intronic
1127164607 15:56231764-56231786 TTACAGGCTCATAGGTGGAAGGG - Intronic
1127284174 15:57518057-57518079 TGGGAGGCTGAGAGGTGGGAGGG + Intronic
1128331672 15:66760254-66760276 TTGCAGGCAGAGATGTGTCTCGG + Intronic
1128688743 15:69707186-69707208 TTACAGGCTCACAGGTGGAAGGG - Intergenic
1128814087 15:70592917-70592939 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1129682192 15:77664202-77664224 TGGCAGGCGGAGGGGTGGAAAGG + Intronic
1130266646 15:82411022-82411044 TAGAAGGCTGAGATGTTAAATGG + Intergenic
1130505380 15:84535864-84535886 TAGAAGGCTGAGATGTCAAATGG - Intergenic
1130677154 15:85963144-85963166 CTGCAGGCTGAGAAGTTCAAGGG + Intergenic
1131724655 15:95207899-95207921 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1132303315 15:100789686-100789708 CTGGAGCCTGAGATGTGGGAGGG - Intergenic
1133434118 16:5764606-5764628 TTGCATGCTGAGACCTGGTAAGG + Intergenic
1134393250 16:13839255-13839277 TTGCAGACTGGGATGGGGGAAGG - Intergenic
1135497069 16:22962116-22962138 TTGCAGCATGAGGTATGGAAGGG + Intergenic
1135725970 16:24854119-24854141 TGGCAGGCAGAGGTCTGGAAGGG + Intronic
1135881599 16:26263109-26263131 CTGCAGGCTGAGAAGTTCAAGGG + Intergenic
1136642468 16:31578361-31578383 TTACAGGCTTACAGGTGGAAGGG + Intergenic
1136710056 16:32229465-32229487 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1136757853 16:32699946-32699968 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1136810253 16:33170429-33170451 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1136816729 16:33280509-33280531 TTACAGGCTCATAGGTGGAAGGG + Intronic
1136872403 16:33819653-33819675 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1137993798 16:53186447-53186469 TTACAGGCTCATAGGTGGAAGGG + Intronic
1138424924 16:56925145-56925167 TTGCATTCTGAGATGGGGACAGG - Intergenic
1138859874 16:60743705-60743727 TTGCAGGCTCATAGGGGGAAGGG - Intergenic
1138989026 16:62367983-62368005 TTTCAACATGAGATGTGGAAGGG - Intergenic
1139033231 16:62911163-62911185 TTACAGGCTCACAGGTGGAAGGG - Intergenic
1139067250 16:63332846-63332868 CTGAAAGCTGAGATGTGAAAAGG + Intergenic
1139083817 16:63560621-63560643 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1139295083 16:65893695-65893717 TCGCAGGCTGAGATGGTGGAAGG + Intergenic
1140568864 16:76078331-76078353 TTGCAGGCTGAGAAGTTTAAGGG + Intergenic
1141214312 16:82009651-82009673 TTACAGGCTTATAGGTGGAAGGG + Intronic
1141272680 16:82555527-82555549 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1141312992 16:82933645-82933667 TTACAGGCTCATAGGTGGAAGGG - Intronic
1141852944 16:86659768-86659790 TTGAAGGCTGGCATGTGGCAAGG + Intergenic
1142435685 16:90055456-90055478 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1203060003 16_KI270728v1_random:960295-960317 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1203099769 16_KI270728v1_random:1296415-1296437 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1144499997 17:15778253-15778275 TTGCAGGCTCATAGGTGGAAGGG - Intergenic
1144705016 17:17362463-17362485 TTGCAGGCTTCTAGGTGGAAGGG - Intergenic
1145753754 17:27374657-27374679 TTACAGGCTTATAGGTGGAAGGG + Intergenic
1146929537 17:36767807-36767829 TTTCAGGCTGAGGTGGGGAGGGG + Intergenic
1147228563 17:39000620-39000642 TTTCAAGCTGAGAAATGGAAGGG - Intergenic
1148553650 17:48565021-48565043 TTGAGGGAGGAGATGTGGAATGG + Intronic
1149064764 17:52466324-52466346 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1149140682 17:53429051-53429073 TTACAGGCTGATAGGTGGAAGGG + Intergenic
1149146050 17:53494133-53494155 TTGGAGGCTGAGAAGTGTAGGGG + Intergenic
1149159059 17:53668264-53668286 TTACAGGCTTATAGGTGGAAGGG + Intergenic
1149189963 17:54049849-54049871 TTGCAGGCTCATAAATGGAAGGG - Intergenic
1149337154 17:55647321-55647343 TTAAAGGGTGATATGTGGAAAGG + Intergenic
1149680727 17:58505300-58505322 GTGTTGGCTGAGAAGTGGAAGGG + Intronic
1149988889 17:61369389-61369411 TTGCAGGGAGGCATGTGGAACGG - Intronic
1150436674 17:65159515-65159537 TTGGAGGCTGAGCTATGGGATGG + Intronic
1150515820 17:65808303-65808325 TTACAGGCTCATAGGTGGAAGGG + Intronic
1150687486 17:67332233-67332255 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1150830792 17:68517850-68517872 TTACAGGCTCATAGGTGGAAGGG - Intronic
1150969536 17:70011448-70011470 TTTCAGCGTGAGATTTGGAAAGG - Intergenic
1151408685 17:73906469-73906491 TTTCAGGCTGATCTCTGGAATGG + Intergenic
1151898499 17:76996612-76996634 GAGCAGGCTGAGCTGGGGAAGGG - Intergenic
1151989222 17:77563770-77563792 AACCAGGCTGAGATGTGGGAAGG + Intergenic
1152233365 17:79125831-79125853 TTCCAGGCAGAAATGGGGAAGGG + Intronic
1153019566 18:614581-614603 TTGCAGGGTGAGAAATGGGAGGG - Intronic
1153108078 18:1550677-1550699 TTACAGGCTTATAGGTGGAAGGG + Intergenic
1153214679 18:2808889-2808911 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1153615700 18:6931103-6931125 TTTCAGCTTGAGATTTGGAAAGG - Intergenic
1155463861 18:26114232-26114254 TTACAGGCTCATAAGTGGAAGGG + Intergenic
1155607396 18:27622674-27622696 TAGCAGGCTGAGAAATGAAAAGG - Intergenic
1155707740 18:28837645-28837667 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1155886477 18:31214911-31214933 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1156233409 18:35177713-35177735 TTGCTGCCTGAGCTGAGGAAGGG + Intergenic
1156351138 18:36302173-36302195 ATGCACGCTGAAATGTGGACAGG - Intronic
1156464888 18:37342556-37342578 TTCCAGTCTGGGATGAGGAAGGG - Intronic
1156651207 18:39228685-39228707 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1156769231 18:40698911-40698933 TTACAGGCTTATAGGTGGAAGGG + Intergenic
1157003000 18:43549844-43549866 TTACAGGCTTATAGGTGGAAGGG - Intergenic
1157377929 18:47182977-47182999 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1157394825 18:47332747-47332769 GTCCAGGCTGAGAGGTGGAAAGG + Intergenic
1157408917 18:47447273-47447295 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1157811268 18:50697866-50697888 TTCCAGACTGACTTGTGGAAAGG + Intronic
1158020504 18:52836402-52836424 TTGCAAGCTCAGAGGTGGAAGGG - Intronic
1158056447 18:53286038-53286060 TTACAGGCTTACAGGTGGAAGGG + Intronic
1158071529 18:53476160-53476182 TTACAGGCTGATAGGTGGAAAGG + Intronic
1158166639 18:54547845-54547867 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1158342543 18:56482252-56482274 TTTCAACCTGAGTTGTGGAAAGG - Intergenic
1158693800 18:59685222-59685244 TTGCACCCTGAGATTTGGAATGG + Intronic
1158786612 18:60721038-60721060 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1159055003 18:63454644-63454666 TGGCAGCCGGCGATGTGGAAGGG - Intergenic
1159265427 18:66073185-66073207 TTGCAGGTTCATAGGTGGAAGGG - Intergenic
1159453421 18:68631456-68631478 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1159461099 18:68723447-68723469 TTGCAGGCTGATAGGTGGAAGGG - Intronic
1159493927 18:69176006-69176028 TTGCAGGCTGAGAAATACAAAGG - Intergenic
1159695718 18:71553838-71553860 TTGTAGGCTCATAGGTGGAAGGG + Intergenic
1159750959 18:72302418-72302440 TTACAGGCTCATAGGTGGAAAGG - Intergenic
1159892218 18:73963814-73963836 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1159962315 18:74565420-74565442 TTACAGGCTCATAGGTGGAAGGG - Intronic
1159966700 18:74601813-74601835 TTTCAGCCTGAGATTTGGAGGGG + Intronic
1160373749 18:78395536-78395558 TTCTAGGCTGTGATGGGGAATGG + Intergenic
1161639994 19:5416212-5416234 TTGCTGGCAGAGATGTGAAATGG - Intergenic
1161971326 19:7582524-7582546 CTGCATGCTGAGATGGGGACAGG - Intergenic
1162658695 19:12152800-12152822 ATCCAGGCTGGGATGTGCAATGG - Intronic
1162833166 19:13299424-13299446 TGGGAGGCTGAGATGTGGGTTGG - Intronic
1163430614 19:17264909-17264931 TTGGAGGCTGAGAAGAGGAGGGG - Intronic
1164515292 19:28929748-28929770 TTGCAGGCTGAAGTGTTGACAGG + Intergenic
1164587010 19:29482209-29482231 TTACAGGCTCATAAGTGGAATGG - Intergenic
1164758690 19:30710507-30710529 TCCCAGCCTGAGATGAGGAACGG + Intronic
1165248142 19:34509700-34509722 TTACAGGCTCATAGGTGGAAGGG - Exonic
1165301133 19:34969943-34969965 TTGCAACCTGAGATTTGGAGGGG + Intergenic
1165888292 19:39095241-39095263 TTACAGGCTCATAGGTGGAAGGG - Intronic
1166072526 19:40395355-40395377 ATCCAGGCTGAGCTGTGGGATGG + Exonic
1166252641 19:41582010-41582032 TTACAGGCTTATAGGTGGAAGGG - Intronic
1166399292 19:42466171-42466193 TTGCAGCCTGGGATGTGAAACGG + Intergenic
1166716783 19:44973513-44973535 TTGCAGAGGGAGATGTGCAAGGG + Intronic
1166998096 19:46729409-46729431 TGGGGGGCTGACATGTGGAAGGG - Intronic
1167019634 19:46863605-46863627 TTGCTGGCTTAGAGGTGGAAGGG - Intergenic
1167202324 19:48074604-48074626 TTCCAACATGAGATGTGGAAGGG + Intronic
1167225618 19:48237448-48237470 TTTCAGCATGAGATTTGGAAGGG + Intronic
1167403578 19:49289177-49289199 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1167563063 19:50238075-50238097 TGGCAGGCAGAGATGTAAAATGG - Intronic
925094448 2:1184959-1184981 TTACAGGCTTATAGGTGGAAGGG - Intronic
925245678 2:2380318-2380340 TTACAGGCTCATAGGTGGAAGGG + Intergenic
925449339 2:3954588-3954610 TTGCCGGCTTAGAGCTGGAAGGG + Intergenic
925489358 2:4375073-4375095 TTACAGGCTCATAGGTGGAAGGG - Intergenic
925499057 2:4484007-4484029 TTACAGGCTCATAGGTGGAAGGG + Intergenic
925526923 2:4813533-4813555 TTACAGGCTTATAGGTGGAAAGG - Intergenic
925554511 2:5114897-5114919 TTACAGGCTCATAGGTGGAAGGG + Intergenic
925805538 2:7644566-7644588 TTACAGGCTCATAGGTGGAAGGG - Intergenic
925816941 2:7763118-7763140 TTACAGGCTTATAGGTGGAAGGG - Intergenic
926461584 2:13136133-13136155 ATGCAGGCTGAGAAGTTCAAGGG - Intergenic
926464990 2:13176918-13176940 TTACAGGCTCATAGGTGGAAGGG - Intergenic
926791395 2:16575239-16575261 TTACAGGCTCATAGGTGGAAGGG + Intronic
926870326 2:17408544-17408566 TTACAGGCTTATAGGTGGAAGGG + Intergenic
926947534 2:18204115-18204137 TTACAGGCTCATAGGTGGAAGGG + Intronic
927170775 2:20367633-20367655 TTACAGGCTCACAGGTGGAAGGG - Intergenic
927636910 2:24823144-24823166 TTGTAGGATGTGATGTGGAATGG + Intronic
928594377 2:32846126-32846148 TTACAGACTGATAGGTGGAAGGG + Intergenic
928731563 2:34238156-34238178 TTACAGGCTCATAGGTGGAAGGG + Intergenic
928761110 2:34584081-34584103 TTGGAGACTGAGAAGTGGGAAGG + Intergenic
928933328 2:36648257-36648279 TTGCAGGCAGGGATGTGGGAAGG + Intergenic
929081704 2:38128184-38128206 TTACAGGCTCATAGGTGGAAGGG + Intergenic
929129176 2:38549466-38549488 TGGCAGGGTCAGATATGGAAAGG + Intergenic
929770922 2:44891515-44891537 TTACAGGCTCATAGGTGGAAGGG - Intergenic
930006879 2:46904705-46904727 TTACAGGCTCATAGGTGGAAGGG + Exonic
930230227 2:48835578-48835600 TTGCAGGCTCATAGGTGGAAGGG + Intergenic
930558400 2:52929292-52929314 TTTCAGGCTGATAAGTGGAAAGG - Intergenic
931079537 2:58753449-58753471 TTACAGGCTCATAGGTGGAAGGG + Intergenic
931272223 2:60713113-60713135 TTACAGCCTCATATGTGGAAGGG + Intergenic
931431134 2:62209790-62209812 CTGCAGGCTGTGATGTTGGAGGG + Intronic
931494014 2:62782942-62782964 TTACAGGCTCATAGGTGGAAGGG - Intronic
932024432 2:68119320-68119342 CTGCAGGCTGAGAAGTTCAAGGG - Intergenic
932428188 2:71657055-71657077 TTACAGGCTCATAGGTGGAAGGG - Intronic
932709440 2:74051148-74051170 TTGCAGGATGGGATGTTGCAAGG + Intronic
933008161 2:77022499-77022521 TTACAGGCTCATAGGTGGAAGGG - Intronic
933047688 2:77558804-77558826 TTACAGGCTCATAGGTGGAAGGG + Intronic
933397759 2:81754034-81754056 GTGCAGGCTTATAGGTGGAAAGG - Intergenic
933454441 2:82502812-82502834 TTACAGGCTTATAGGTGGAAGGG + Intergenic
933508023 2:83203728-83203750 TTTCAGGCTCACAGGTGGAAGGG - Intergenic
933548056 2:83740114-83740136 TTACAGGCTCATAGGTGGAAGGG - Intergenic
933598013 2:84302208-84302230 TTGGAGGCTGAGAAGTTCAAGGG + Intergenic
934071975 2:88392729-88392751 TTTCAACATGAGATGTGGAAGGG - Intergenic
934113108 2:88760291-88760313 TTACAGGCTCATAGGTGGAAGGG + Intergenic
934126237 2:88893729-88893751 TTTCCTGCTAAGATGTGGAAAGG - Intergenic
934537365 2:95146491-95146513 TTGCAGGCTGAGATGTGGAAAGG + Intronic
934960590 2:98669003-98669025 TTACAGGCTCATAGGTGGAAGGG + Intronic
935233110 2:101116494-101116516 TTACAGGCTGAATTTTGGAAGGG + Intronic
935239837 2:101168790-101168812 TTACAGGCTCACAGGTGGAAGGG + Intronic
935334190 2:102000037-102000059 TCTCAGGCTGGGCTGTGGAATGG + Intronic
935724147 2:106008293-106008315 TTACAGGCTCATAGGTGGAAGGG + Intergenic
936096825 2:109536540-109536562 TTACAGGCTCATAGGTGGAAGGG + Intergenic
936257635 2:110930422-110930444 TTACAGGCTCATAGGTGGAAGGG + Intronic
936721040 2:115253482-115253504 TTGCAGGCTCATAGGTGTAAGGG - Intronic
936898419 2:117455362-117455384 TTACAGGCTCATAGGTGGAAAGG + Intergenic
937009014 2:118544735-118544757 TTACAGGCTCATAAGTGGAAGGG + Intergenic
937142343 2:119612902-119612924 TTACAGGCTCATAGGTGGAAGGG - Intronic
937491296 2:122371140-122371162 TTACAGGCTCACAGGTGGAAGGG - Intergenic
937751131 2:125477210-125477232 TTACAGGCTTATAGGTGGAAGGG + Intergenic
937800710 2:126077520-126077542 TTACAGGCTCATAGGTGGAAAGG + Intergenic
938510323 2:131936042-131936064 TTACAGGCTCATAGGTGGAAGGG - Intergenic
939053345 2:137332452-137332474 TTACAGGCTCAGAGGTGGAAAGG + Intronic
939106173 2:137951166-137951188 TTGGAGACTCAGAAGTGGAAGGG - Intergenic
939155784 2:138523555-138523577 TTACAGGCTCACAGGTGGAAGGG - Intronic
939164004 2:138620737-138620759 TTGCAGGCTGTGATGGGAAGGGG + Intergenic
939445890 2:142309998-142310020 TTACAGGCTCATAGGTGGAAGGG - Intergenic
939784554 2:146493911-146493933 TTACAGGCTCCTATGTGGAAGGG - Intergenic
939830508 2:147064966-147064988 TTACAGGCTCACAGGTGGAAGGG + Intergenic
940120181 2:150255766-150255788 TTGCTGTCTGTAATGTGGAATGG - Intergenic
940136013 2:150436450-150436472 TTACAGGCTCATAGGTGGAAGGG + Intergenic
940381256 2:153017623-153017645 TTACAGGCTCATAGGTGGAAGGG - Intergenic
940790678 2:158027230-158027252 TTACAGGCTCATAAGTGGAAGGG - Intronic
940825708 2:158409596-158409618 TTACAGGCTTATAGGTGGAAGGG + Intronic
940896394 2:159085285-159085307 CTGCAGGCTGAGAAGTTCAAGGG - Intronic
941057550 2:160806289-160806311 TTACAGGCTCATAGGTGGAAGGG - Intergenic
941142717 2:161805470-161805492 TTACAGGCTCACAGGTGGAAGGG - Intronic
941322563 2:164073548-164073570 TTGCAGGCTGGGAACTTGAAAGG + Intergenic
941477678 2:165968662-165968684 TTACAGGCTCATAGGTGGAAGGG + Intergenic
941513111 2:166437906-166437928 TTACAGGCTCATAGGTGGAAGGG + Intronic
941888476 2:170553564-170553586 TTACAGGCTTATAGGTGGAAGGG + Intronic
942234417 2:173890155-173890177 TTACAGGCTCATAGGTGGAAGGG + Intergenic
942283485 2:174390468-174390490 TTACAGGCTCATAGGTGGAAGGG + Intronic
942649701 2:178154126-178154148 TTACAGGCTCATAGGTGGAAGGG - Intergenic
942805699 2:179929415-179929437 TTACAGGCTTATAGGTGGAAGGG - Intergenic
942880630 2:180857160-180857182 TTACAGGCTCATAGGTGGAAGGG - Intergenic
942981792 2:182092569-182092591 TTACAGGCTTATAGGTGGAAGGG - Intronic
943072090 2:183153384-183153406 TTACAGGCTCATAGGTGGAAGGG - Intronic
943144039 2:184018947-184018969 TTACAGGCTTATAGGTGGAAGGG + Intergenic
943387944 2:187225627-187225649 TTACAGGCTCATAGGTGGAAGGG - Intergenic
943417885 2:187631026-187631048 TTACAGGCTCATAGGTGGAAGGG + Intergenic
943579577 2:189669662-189669684 TTGCATTTTGAGATGTGGGATGG + Intronic
943670329 2:190653461-190653483 TTGCAGGCTGTGTTGGGGGAAGG + Intronic
943832993 2:192485854-192485876 TTACAGGCTCATAGGTGGAAGGG + Intergenic
943998165 2:194797668-194797690 TTACAGGCTTATAGGTGGAAGGG + Intergenic
944021916 2:195115235-195115257 TTACAGGCTCATAGGTGGAAGGG + Intergenic
944307369 2:198193857-198193879 TTACAGGCTCATATGTGGAAGGG - Intronic
944458092 2:199916524-199916546 TTACAGGCTCATAGGTGGAAGGG - Intronic
944668436 2:201975583-201975605 TTGCAGGCTGAGGGATGGTATGG + Intergenic
944872767 2:203931080-203931102 TTACAGGCTCATAGGTGGAAGGG + Intergenic
945096067 2:206220731-206220753 TGGGAGGCTGAGATGTGAGACGG + Intergenic
945166556 2:206953267-206953289 TTACAGGCTTATAGGTGGAAGGG - Intronic
945515469 2:210758766-210758788 TTACAGGCTCACAGGTGGAAGGG - Intergenic
945713569 2:213330578-213330600 TTACAGGCTCATAGGTGGAAGGG + Intronic
945767665 2:213999969-213999991 TTACAGGCTCATAGGTGGAAGGG + Intronic
946480871 2:220055436-220055458 TTACAGGCTCATAGGTGGAAGGG + Intergenic
946562395 2:220927725-220927747 TTACAGGCTGATAGGTGAAAGGG - Intergenic
946575468 2:221071216-221071238 TTACAGGGTGATAGGTGGAAGGG - Intergenic
946757653 2:222963431-222963453 TTACAGGCTCATAGGTGGAAGGG + Intergenic
946760492 2:222988854-222988876 TTACAGGCTCATAGGTGGAAGGG - Intergenic
946937525 2:224737129-224737151 TTACAGGCTCATAAGTGGAAGGG + Intergenic
947011414 2:225570872-225570894 TTACAGGCTCATAGGTGGAAGGG - Intronic
947443268 2:230141671-230141693 TTACAGGCTCATATGTGAAAGGG + Intergenic
947932935 2:233978942-233978964 CTACAGTCTCAGATGTGGAAGGG - Intronic
948165269 2:235856511-235856533 CTGCTGGCTTAGATGTGGAAAGG - Intronic
1169164949 20:3415169-3415191 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1169482927 20:6001677-6001699 TTTCAGGAAGAAATGTGGAAAGG + Intergenic
1169709953 20:8550114-8550136 TTACAGGCTCATACGTGGAAGGG + Intronic
1169985117 20:11435544-11435566 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1169985390 20:11437668-11437690 TTGCAGGGTGAGATGTCAAATGG - Intergenic
1170065185 20:12303210-12303232 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1170079099 20:12451332-12451354 TTACAGGCTTATAGGTGGAAGGG + Intergenic
1171076964 20:22137404-22137426 TTACAGGCTTATAGGTGGAAGGG - Intergenic
1171244524 20:23600869-23600891 TTGCACGCTGAATTGGGGAAGGG - Intergenic
1172779654 20:37428615-37428637 ATCCAAGTTGAGATGTGGAATGG - Intergenic
1172960859 20:38798468-38798490 CTGCAGGCTGAGAAGTTCAAGGG - Intergenic
1173023631 20:39287984-39288006 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1173066489 20:39718138-39718160 TTCCAGGCAGAAATGTGTAATGG + Intergenic
1173323314 20:42009492-42009514 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1173412850 20:42829329-42829351 TTACAGGCTCATAGGTGGAAGGG + Intronic
1173684725 20:44915077-44915099 TTTCAGGATGAGAGGTGGAGGGG + Intronic
1173711136 20:45156539-45156561 TTACAGGCTGATAGGTGGAAGGG + Intergenic
1174536240 20:51253716-51253738 TCGGAGGCTGAGTTGGGGAAGGG + Intergenic
1174869509 20:54170084-54170106 TTGCTTGCCCAGATGTGGAAGGG - Intronic
1174965392 20:55208334-55208356 TTACAGGCTCGGAGGTGGAAGGG + Intergenic
1176519324 21:7812954-7812976 ATTCAAGATGAGATGTGGAAGGG + Intergenic
1176687403 21:9862909-9862931 TTACAGGCTTATAGGTGGAAGGG + Intergenic
1176688386 21:9875319-9875341 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1176688948 21:9881288-9881310 TTACAGGCTCATAAGTGGAAGGG - Intergenic
1176783505 21:13227284-13227306 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1176877669 21:14149573-14149595 TTACAGGCTCATAGGTGGAAGGG - Intronic
1176998618 21:15584572-15584594 TTTCAGGCTGAGGTATGGATTGG - Intergenic
1177037008 21:16056838-16056860 TTGCCTGCTGTGATGAGGAATGG - Intergenic
1177068041 21:16464627-16464649 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1177222920 21:18217740-18217762 TTGCAGGCTCATAGGTGAAAGGG - Intronic
1177271185 21:18850937-18850959 TTACAGGCTCATAAGTGGAAGGG + Intergenic
1177393709 21:20507659-20507681 GTGCTGGCTGAGATGGGGAGGGG + Intergenic
1177471190 21:21563191-21563213 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1177487403 21:21777470-21777492 TCACAGGCTCATATGTGGAAGGG - Intergenic
1177654790 21:24003634-24003656 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1177981148 21:27916052-27916074 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1178013791 21:28318473-28318495 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1178174076 21:30076475-30076497 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1178221931 21:30669770-30669792 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1178349301 21:31860812-31860834 TTACATGTTGAGATTTGGAAAGG + Intergenic
1178653352 21:34442967-34442989 ATTCAAGATGAGATGTGGAAGGG + Intergenic
1179065229 21:38018368-38018390 TTACAGGCTCATAGGTGGAAGGG + Intronic
1179178459 21:39025667-39025689 TTTCAGCATGAGATTTGGAAGGG + Intergenic
1179528034 21:41996546-41996568 TTGCAGGCTCATAGGCGGAAGGG + Intronic
1179720421 21:43313331-43313353 GTGCAGCCTGGGATGTGGAGGGG + Intergenic
1179732526 21:43375687-43375709 CTGCAGGCTGAGAAGTTCAAGGG + Intergenic
1181811696 22:25407014-25407036 TAGCAGGGTGAGATGTGGGAAGG - Intergenic
1182101228 22:27658970-27658992 CTGCAGGCAGAGGTGTGGAGCGG - Intergenic
1182933633 22:34199023-34199045 TTGCAAACTGTGATGTGTAATGG + Intergenic
1182957766 22:34443163-34443185 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1183847483 22:40554139-40554161 TTACAGGCTCATAGGTGGAAGGG + Intronic
1183947627 22:41335705-41335727 TGGCAGGCTCAGGTGTGGGAAGG + Intronic
1184338981 22:43875124-43875146 TTGCAGGCTCATAGGCGGAAGGG + Intergenic
1184507325 22:44912186-44912208 TTACAGGCTCATAGGTGGAAGGG + Intronic
1184707465 22:46224415-46224437 TTGCTTTCTGAGATGTGTAAGGG - Intronic
1184992136 22:48177948-48177970 TGACAGGCTGACATGTGCAAAGG - Intergenic
950126194 3:10511171-10511193 CTCCAGGCAGAGAAGTGGAAAGG - Intronic
950853067 3:16081348-16081370 TTACAGGCTCATAGGTGGAAGGG - Intergenic
950905537 3:16534406-16534428 TTTCAGCATGAGATTTGGAAGGG + Intergenic
950955942 3:17053634-17053656 TTACAGGCTTATAGGTGGAAGGG - Intronic
950972556 3:17203356-17203378 TTACAGGCTCATAGGTGGAAGGG + Intronic
951192610 3:19787288-19787310 TTACAGGCTCATAAGTGGAAGGG + Intergenic
951271700 3:20632830-20632852 GTTAAGTCTGAGATGTGGAATGG - Intergenic
951452105 3:22851782-22851804 TTACAGGCTCATAGGTGGAACGG - Intergenic
951756363 3:26095872-26095894 TTACAGGCTCATAGGTGGAAGGG - Intergenic
951801643 3:26603181-26603203 TTACAGGCTTATAGGTGGAAGGG - Intergenic
951936225 3:28025585-28025607 TTTCAGGCTCATAGGTGGAAGGG + Intergenic
952132598 3:30383035-30383057 TTACAGGCTCATAGGTGGAAGGG - Intergenic
952284025 3:31950613-31950635 TTTCAGCCTGAGATTTGGAGAGG - Intronic
952504432 3:33995294-33995316 TTACAGGCTCATAGGTGGAAGGG - Intergenic
952596699 3:35027511-35027533 TTACAGGCTCATAGGTGGAAGGG - Intergenic
953624735 3:44561577-44561599 TTACAGGCTCATAGGTGGAAGGG - Intronic
954150524 3:48654955-48654977 TGGCAGGATGGGATGAGGAATGG + Intronic
954384672 3:50237809-50237831 TTGTAGGCTGAGAAGTGCATGGG + Intronic
954591664 3:51788494-51788516 TTACAGGCTCATAGGTGGAAGGG + Intergenic
954838579 3:53492989-53493011 TTGCTGGCTCAGATTTGGAATGG - Intergenic
954920265 3:54184597-54184619 TGGCTGGCTGACATGTGAAATGG + Intronic
955498350 3:59560116-59560138 ATGCAGGCTCAGCTGTGGAATGG - Intergenic
956246183 3:67186108-67186130 TTACAGGCTCATAGGTGGAAGGG - Intergenic
956337011 3:68175669-68175691 TTACAGGCTCATAGGTGGAAGGG + Intronic
956558718 3:70550515-70550537 TTACAGGCTCATAGGTGGAAGGG - Intergenic
956946988 3:74234491-74234513 TGGCAGGCTCATAGGTGGAAGGG - Intergenic
957011585 3:75011965-75011987 TTTCAGTATGAGATTTGGAAAGG - Intergenic
957374399 3:79337104-79337126 TTACAGGCTCATAAGTGGAAGGG + Intronic
957380778 3:79426473-79426495 TGGGAGGCTGAGGTGGGGAATGG - Intronic
957407410 3:79789982-79790004 TTACAGGCTCATAGGTGGAAAGG - Intergenic
957463769 3:80558758-80558780 TTTCAGGCTCATAGGTGGAAGGG + Intergenic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
957630425 3:82710665-82710687 TTACAGGCTCATAGGTGGAAGGG - Intergenic
957693068 3:83596839-83596861 TTACAGGCTCATAGGTGGAAGGG + Intergenic
957704088 3:83756568-83756590 TTACAGGCTCATAGGTGGAAAGG + Intergenic
958042695 3:88245291-88245313 TTACAGGCTTATAGGTGGAAGGG + Intergenic
958256651 3:91332649-91332671 TTACAGGCTCATAGGTGGAAGGG + Intergenic
958463346 3:94426903-94426925 TTACAGGCTCATAGGTGGAAGGG + Intergenic
958611796 3:96436177-96436199 TTGCAGGCTCATAGATGGAAAGG - Intergenic
958639001 3:96780374-96780396 TTACAGGCTCATAGGTGGAAGGG + Intergenic
958857056 3:99398245-99398267 TTACAGGCTCATAGGTGGAAGGG - Intergenic
959031737 3:101307871-101307893 TTACAGGCTCATAGGTGGAAGGG - Intronic
959113717 3:102151643-102151665 TTACAGGCTGATAGGTGGAAGGG - Intronic
959182020 3:102993243-102993265 TTACAGGCTAATAGGTGGAAGGG + Intergenic
959284485 3:104390729-104390751 TTACAGGCTCAGATGTGGGAGGG - Intergenic
959342389 3:105148332-105148354 TTACAGGCTTATAGGTGGAAGGG - Intergenic
959439902 3:106361943-106361965 TTACAGGCTTATATGTGGAAGGG + Intergenic
959720215 3:109478645-109478667 TTTCAGCATGAGATTTGGAAGGG - Intergenic
959729910 3:109590051-109590073 TTACAGGCTCATAAGTGGAAGGG - Intergenic
959756416 3:109905393-109905415 TTACAGGCTCATAAGTGGAAGGG - Intergenic
959788733 3:110332091-110332113 TTACAGGCTCATGTGTGGAAGGG - Intergenic
959809093 3:110594282-110594304 TTACAGGCTCATAGGTGGAAGGG + Intergenic
959846700 3:111041097-111041119 TTACAGGCTCATAGGTGGAAGGG + Intergenic
960486593 3:118259873-118259895 TTACAGGCTCATAGGTGGAAGGG + Intergenic
960535346 3:118809153-118809175 TTGCACCCAGAGAGGTGGAAAGG + Intergenic
960564308 3:119117739-119117761 TTACAGGCTCATAGGTGGAAGGG - Intronic
960724637 3:120658216-120658238 TTACAGGCTCATAGGTGGAAGGG - Intronic
961065218 3:123869586-123869608 TTGCAGACTGGGATATGGAGAGG - Intronic
962006033 3:131351157-131351179 TTGTAGGCTGAGAAGTTCAACGG + Intergenic
962027472 3:131563663-131563685 TTACAGGCTAAGCTGTGGAGTGG + Intronic
962067094 3:131992516-131992538 TTACAGGCTCATAGGTGGAAGGG + Intronic
962162076 3:133011123-133011145 TTACAGGCTCACAGGTGGAAGGG - Intergenic
962440088 3:135405754-135405776 TTACAGGCTCATAGGTGGAAGGG - Intergenic
962461106 3:135613289-135613311 TTTCAGGCTGATAGGTGGAAGGG + Intergenic
962845921 3:139273699-139273721 GTGCAAGCTAAGGTGTGGAATGG + Intronic
963022611 3:140886598-140886620 TTACAGGCTCATAGGTGGAAGGG + Intergenic
963031369 3:140981472-140981494 TTACAGGCTGACATGGGGAGGGG + Intergenic
963339674 3:144019591-144019613 TTACAGGCTCATAGGTGGAAGGG - Intronic
963421987 3:145072792-145072814 TTACAGGCTCATAGGTGGAAGGG - Intergenic
963574981 3:147048753-147048775 TAGCAGGCTGAAAGGTAGAAGGG - Intergenic
963671707 3:148259081-148259103 TTACAGGCTCATAGGTGGAAGGG + Intergenic
963777169 3:149451380-149451402 TTGCAGGCTCATAGGTAGAAGGG - Intergenic
964026353 3:152079457-152079479 TTACAGGCTCATAGGTGGAAGGG - Intergenic
964605626 3:158556868-158556890 TTACAGGCTCATAGGTGGAAGGG + Intergenic
964719275 3:159755699-159755721 TTACAGGCTCATAGGTGGAAGGG - Intronic
964912515 3:161800270-161800292 TTACAGGCTCATAGGTGGAAGGG - Intergenic
965203542 3:165692282-165692304 TTACAGGCTCATAGGTGGAAGGG - Intergenic
965500118 3:169446024-169446046 TTACAGGCTCATAGGTGGAAGGG + Intronic
965662221 3:171053462-171053484 TTACAGGCTCATAGGTGGAAGGG + Intergenic
965838912 3:172881127-172881149 TTACAGGCTTATAGGTGGAAGGG + Intergenic
965854767 3:173074152-173074174 TTACAGGCTCATAGGTGGAAGGG + Intronic
965929869 3:174029504-174029526 TTACAGGCTCACAGGTGGAAGGG + Intronic
966059089 3:175733705-175733727 TTACAGGCTCATAGGTGGAAAGG - Intronic
967406291 3:189119335-189119357 TTACAGGCTCATAGGTGGAAGGG + Intronic
967412412 3:189180382-189180404 TTACAGGCTCATAGGTGGAAGGG - Intronic
967470465 3:189854910-189854932 TTGCAGGCTGAGATGTAAAGAGG + Intronic
967547260 3:190745812-190745834 CTGCAGGCTGAGAAGTTCAAGGG - Intergenic
967551571 3:190801251-190801273 TTACAGGCTCATAGGTGGAAGGG + Intergenic
967585985 3:191215503-191215525 TTACAGGCTCATAGGTGGAAGGG - Intronic
967596424 3:191330087-191330109 TTGAAGGCTGGGAAGTGGAGAGG + Intronic
967622459 3:191650359-191650381 TTTCAGGCTCATAGGTGGAAGGG - Intergenic
967791530 3:193554689-193554711 TCGCAGGCTGAGAAGTGGGATGG + Intronic
968265658 3:197361021-197361043 TTACAGGCTAATAGGTGGAAGGG + Intergenic
968387600 4:155664-155686 TTACAGGCTCATAGGTGGAAGGG + Intronic
968767278 4:2479234-2479256 TTACAGGCTCATAGGTGGAAGGG + Intronic
969072680 4:4552032-4552054 TTACAGGCTCATAGGTGGAAGGG + Intergenic
969103707 4:4789274-4789296 TTACAGGCTCATAGGTGGAAAGG + Intergenic
969152002 4:5177618-5177640 TTACAGGCTCATAGGTGGAAGGG - Intronic
969194728 4:5551534-5551556 TTACAGGCTCATAGGTGGAAGGG + Intronic
969321133 4:6413623-6413645 GTGCAGGCTGAGAGGCGGCAGGG - Intronic
969517278 4:7654710-7654732 TGACAGGCTGAGCAGTGGAAGGG - Intronic
969610421 4:8224978-8225000 TTGCAGGCTGAGGTGTTGCAGGG - Intronic
969610432 4:8225040-8225062 TTGAGGGCTGAGATGTTGCAGGG - Intronic
969967604 4:11013238-11013260 TTCCAGGGTGAGAAGTGAAATGG - Intergenic
969995425 4:11307442-11307464 TTGGAGGCTGAACTGTGGGATGG - Intergenic
970088918 4:12380860-12380882 TTTCAGCATGAGATTTGGAAAGG + Intergenic
970222618 4:13825969-13825991 TTACAGGCTCATAGGTGGAAGGG + Intergenic
970553711 4:17210225-17210247 TTGCAGTATTAGATTTGGAAGGG - Intergenic
970678169 4:18476781-18476803 TTGCAGGCTCACAGGCGGAAGGG - Intergenic
970742155 4:19251177-19251199 TTACAGGCTCACAGGTGGAAGGG + Intergenic
970800347 4:19965955-19965977 TTACAGGCTCATAGGTGGAAGGG - Intergenic
971149865 4:24020682-24020704 TTGAAGGCAGAGATGAGAAAGGG + Intergenic
971591422 4:28473826-28473848 TTACAGGCTCACAGGTGGAAGGG + Intergenic
971598879 4:28567908-28567930 TTACAGGCTCATAGGTGGAAGGG - Intergenic
971831756 4:31704320-31704342 TTTTAGGCTGATAGGTGGAAGGG - Intergenic
971844802 4:31905667-31905689 TTACAGGCTCAGAGGTGGAAGGG - Intergenic
971858829 4:32078778-32078800 TTACAGGCTCATAAGTGGAAGGG - Intergenic
971969529 4:33604063-33604085 TTACAGGCTCATAGGTGGAAGGG - Intergenic
972033723 4:34494262-34494284 TTACAGGCTCATAGGTGGAATGG + Intergenic
972079705 4:35136077-35136099 TTACAGGCTCACAGGTGGAAGGG - Intergenic
972140915 4:35958105-35958127 TTACAGGCTTATAGGTGGAAGGG + Intronic
972200055 4:36703322-36703344 TTACAGGCTCATAGGTGGAAGGG + Intergenic
972228029 4:37036630-37036652 TTACAGGCTCATAGGTGGAAGGG - Intergenic
972413324 4:38814872-38814894 TTACAGGCTCATAGGTGGAAGGG - Intronic
972510418 4:39763685-39763707 TTGCAGCATGAGATTTGGAGAGG + Intronic
973094580 4:46180314-46180336 TTACAGGCTCATATGTGAAAGGG + Intergenic
973183044 4:47291864-47291886 TTACAGGCTCATAGGTGGAAGGG + Intronic
973780296 4:54282761-54282783 TTACAGGCTCATAGGTGGAAGGG - Intronic
974125765 4:57693573-57693595 TTACAGGCTCATAAGTGGAAGGG + Intergenic
974154602 4:58055231-58055253 TTACAGGCTCATAGGTGGAAGGG - Intergenic
974215639 4:58842556-58842578 TTACAGGCTGATAGATGGAAGGG + Intergenic
974271090 4:59652155-59652177 TTACAGGCTCATAGGTGGAAGGG + Intergenic
974430500 4:61791201-61791223 TTACAGGCTCATAGGTGGAAGGG - Intronic
974480594 4:62438044-62438066 TTACAGGCTTATATGTGGAAGGG - Intergenic
974563373 4:63552538-63552560 TTACAGGCTCATAGGTGGAAGGG - Intergenic
974694193 4:65344195-65344217 TTGCAGGCTGAGATGTAATTGGG + Intronic
974725505 4:65794144-65794166 TTACAGGCTCATAGGTGGAAGGG - Intergenic
974742162 4:66021291-66021313 TCACAGGCTCAGAGGTGGAAGGG - Intergenic
974779232 4:66529472-66529494 TTACAGGCTTATAGGTGGAAGGG + Intergenic
974843487 4:67323895-67323917 TTACAGGCTCATAGGTGGAAGGG + Intergenic
974872586 4:67661100-67661122 TTACAGGCTCATAGGTGGAAGGG + Intronic
974915593 4:68174197-68174219 TTCCAGGCTCATAGGTGGAACGG + Intergenic
974963257 4:68730196-68730218 TTACAGGCTCATATGTGGAAGGG - Intergenic
975230328 4:71924775-71924797 TTACAGGCTCATAGGTGGAAGGG + Intergenic
975279295 4:72541372-72541394 TTACAGGCTCATAGGTGGAAGGG + Intronic
975629118 4:76381569-76381591 TTACAGGCTTATAGGTGGAACGG + Intronic
975792093 4:77964317-77964339 ATGCTGGGAGAGATGTGGAATGG + Intergenic
976002821 4:80392206-80392228 TTACAGGCTCATAGGTGGAAGGG + Intronic
976172526 4:82318652-82318674 TTACAGGCTCATAGGTGGAAGGG + Intergenic
976283267 4:83346388-83346410 TTACAAGCTCAGACGTGGAAGGG - Intergenic
976286339 4:83374935-83374957 TTACAGGCTTATAGGTGGAAGGG - Intergenic
976312259 4:83623696-83623718 TTACAGGCTCATAGGTGGAAGGG + Intergenic
976444902 4:85118617-85118639 TTACAGGCTCATAAGTGGAAGGG + Intergenic
976503039 4:85814364-85814386 TTACAGGCTTATAGGTGGAAGGG - Intronic
976533261 4:86180836-86180858 CTGGAGGCTGAGATGGGTAAGGG + Intronic
976602231 4:86948976-86948998 TTGGAGGGAGAGATGTGAAAGGG - Intronic
976726833 4:88223131-88223153 TTACAGGCTCATAGGTGGAAGGG + Intronic
976952565 4:90850713-90850735 TTACAGGCTTATAGGTGGAAAGG + Intronic
977093810 4:92714055-92714077 TTACAGGCTGATAGGTGGAAGGG - Intronic
977169553 4:93743783-93743805 TTTCAGCATGAGATTTGGAAGGG + Intronic
977973153 4:103233714-103233736 TTACAGGCTCATAGGTGGAAGGG + Intergenic
977982500 4:103341183-103341205 TTGCAGGCTGACATACAGAATGG - Intergenic
978034578 4:103977130-103977152 TTACAGGCTCATAGGTGGAAGGG + Intergenic
978087066 4:104667469-104667491 TTACAGGCTCATAGGTGGAAGGG - Intergenic
978252560 4:106650211-106650233 TTACAGGCTCATAGGTGGAAGGG + Intergenic
978262317 4:106774269-106774291 TTACAGGCTCATAGGTGGAAGGG + Intergenic
978344965 4:107757079-107757101 TTACAGGCTCATAGGTGGAAGGG + Intergenic
978917460 4:114144524-114144546 TTACAGGCTCATAGGTGGAAGGG + Intergenic
978934049 4:114354403-114354425 TTACAGGCTCATAGGTGGAAGGG - Intergenic
979060804 4:116058653-116058675 TTACAGGCTCATAGGTGGAAGGG - Intergenic
979183502 4:117758536-117758558 TTACAGGCTCATAGGTGGAAGGG + Intergenic
979356658 4:119713153-119713175 TTACAGGCTCATAGGTGGAAGGG + Intergenic
979390022 4:120117422-120117444 TTACAGGCTCAGAGGTGGATGGG - Intergenic
979405826 4:120309892-120309914 TTACAGGCTCACAGGTGGAAGGG - Intergenic
979414382 4:120417975-120417997 TTACAGGCTCATAGGTGGAAGGG + Intergenic
979601629 4:122592071-122592093 CTGCAGGCTGAGAAGTTCAAGGG + Intergenic
979699921 4:123656156-123656178 TTACAGGCTCATAGGTGGAAGGG - Intergenic
979733126 4:124048877-124048899 TTGCAGGCTGAGAAGTTCAAGGG - Intergenic
979764318 4:124446241-124446263 TTACAGGCTCATATGTGGAAGGG - Intergenic
979805040 4:124960810-124960832 TTACAGGCTCATATGTGAAAGGG - Intergenic
979922914 4:126524177-126524199 TTTCAGGCTCATAGGTGGAAGGG - Intergenic
980065849 4:128187548-128187570 TTACAGGCTCATAGGTGGAAGGG + Intronic
980083506 4:128368666-128368688 TTACAGGCTCATAAGTGGAAGGG - Intergenic
980350803 4:131681019-131681041 TTACAGGCTCATAGGTGGAAGGG + Intergenic
980351762 4:131693118-131693140 TTACAGGCTCATAGGTGGAAGGG - Intergenic
980352333 4:131699107-131699129 TTACAGGCTCATAAGTGGAAGGG - Intergenic
980368701 4:131839316-131839338 TTACAGGCTCATAGGTGGAAGGG + Intergenic
980509793 4:133771232-133771254 TTCCAGGCTCATAGGTGGAAGGG - Intergenic
980767005 4:137320525-137320547 TTACAGGCTCATAGGTGGAAAGG - Intergenic
980850312 4:138373722-138373744 TTACTGGCTCAGAGGTGGAAGGG - Intergenic
981061785 4:140432432-140432454 TTACAGGCTCATAGGTGGAAGGG + Intergenic
981260154 4:142709228-142709250 TTACAGGCTCATAGGTGGAAAGG + Intronic
981309710 4:143285064-143285086 TTGCAGACTGTGAGGTGGCATGG - Intergenic
981351424 4:143734142-143734164 TTACAGGCTCAGAAGTGGAAGGG - Intergenic
981363098 4:143870426-143870448 TTACAGGCTCATAGGTGGAAGGG - Intergenic
981373827 4:143991221-143991243 TTACAGGCTCATAGGTGGAAGGG - Intergenic
981391631 4:144197476-144197498 TTACAGGCTCATAGGTGGAAGGG + Intergenic
981799253 4:148636897-148636919 TTACAGGCTTACAGGTGGAAGGG - Intergenic
981862999 4:149379656-149379678 TTACAGGCTCACAGGTGGAAGGG + Intergenic
982041155 4:151398197-151398219 TTTCAACATGAGATGTGGAAGGG + Intergenic
982279239 4:153666646-153666668 TTACAGGCTCATAGGTGGAAGGG + Intergenic
982280933 4:153683535-153683557 TTGCATGGTGAGAAGTGGGATGG + Intergenic
982310083 4:153975353-153975375 TTACAGGCTCATAGGTGGAAGGG + Intergenic
982424884 4:155247026-155247048 TTACAGGCTCATAGGTGGAAGGG - Intergenic
982432501 4:155338672-155338694 TTACAAGCTCAGAGGTGGAAGGG + Intergenic
982524878 4:156466251-156466273 TTACAGGCTGATAGGTGGAAGGG - Intergenic
982603423 4:157482576-157482598 TTGCAGGCTGTGCTATGGACTGG + Intergenic
982645864 4:158025179-158025201 TTGCAGGTGAAGATGTGGACGGG + Intergenic
982834603 4:160108765-160108787 TTACAGGCTTATAGGTGGAAAGG - Intergenic
982966426 4:161913888-161913910 TTACAGGCTCATAGGTGGAAGGG + Intronic
983083482 4:163415277-163415299 TTACAGGCTCATAGGTGGAAGGG + Intergenic
983463008 4:168049556-168049578 TTACAGGCTCATAGGTGGAAGGG + Intergenic
983475891 4:168211240-168211262 TTGGAGGCTGAGAAGTCCAAGGG - Intergenic
983847396 4:172537082-172537104 TTACAGGCTAATAGGTGGAAGGG + Intronic
984131173 4:175877872-175877894 TTACAGGCTCATAGGTGGAAGGG - Intronic
984512186 4:180692826-180692848 TTACAGGCTCATAGGTGGAATGG - Intergenic
984516906 4:180752547-180752569 TTACAGGCTCACAGGTGGAAGGG - Intergenic
984539974 4:181024950-181024972 TGGCAGGAAGAGAGGTGGAAAGG + Intergenic
985201522 4:187489431-187489453 TTACAGGCTCATAGGTGGAAGGG + Intergenic
985220415 4:187697618-187697640 TTACAGGCTGATAGGTGGCAAGG + Intergenic
985304421 4:188522636-188522658 TTACAGGCTCATAGGTGGAAGGG + Intergenic
985337614 4:188913508-188913530 TTACAGGCTCATAGGTGGAAGGG - Intergenic
985809296 5:2071220-2071242 TTACAGGCTCATAGGTGGAAAGG + Intergenic
986053342 5:4110854-4110876 CTGCAGGATTAGATGTGGGAGGG + Intergenic
986111537 5:4723882-4723904 TTGGAGGGTGAAATCTGGAATGG + Intergenic
986137738 5:4998731-4998753 TTACAGGCTCATAAGTGGAAAGG - Intergenic
986231494 5:5868294-5868316 TTTCAGGCTGAGATCTGAAGGGG - Intergenic
986258620 5:6123365-6123387 TTACAGGCTCATAGGTGGAAGGG - Intergenic
986679991 5:10224045-10224067 TTACAGGCTCATAGGTGGAAGGG - Intergenic
986960241 5:13202378-13202400 TTACAGGCTCATAGGTGGAAGGG - Intergenic
986983541 5:13475522-13475544 TTACAGGCTCATAGGTGGAAGGG + Intergenic
987003871 5:13689163-13689185 TTACAGGCTCACAGGTGGAAGGG + Intergenic
987082296 5:14436579-14436601 TTACAGGCTCATAGGTGGAAGGG - Intronic
987226053 5:15842421-15842443 TTACAGGCTCATAGGTGGAAGGG + Intronic
987332916 5:16873109-16873131 TTACAGGCTCATAGGTGGAAGGG - Intronic
987358671 5:17086932-17086954 TGGGAGGCTGAGGTGGGGAATGG + Intronic
987422683 5:17738910-17738932 TTGCAGGCTTAGTTCTTGAAGGG + Intergenic
987433647 5:17865961-17865983 TTACAGGCTCATAGGTGGAAGGG + Intergenic
987511588 5:18847152-18847174 TTACAGGCTCATAGGTGGAAGGG - Intergenic
987650312 5:20732684-20732706 TTACAGGCTCATAGGTGGAAGGG - Intergenic
987708938 5:21485447-21485469 TTACAGGCTCACAGGTGGAAGGG - Intergenic
987722996 5:21663009-21663031 TTACAGGCTCATAGGTGGAAGGG - Intergenic
987794456 5:22608461-22608483 TTACAGGCTCATAGGTGGAAGGG + Intronic
987800621 5:22691997-22692019 TTGCAACATGAGATGTGGAGGGG - Intronic
987873369 5:23648258-23648280 TTACAGGCTCATAGGTGGAAGGG + Intergenic
987918474 5:24248163-24248185 TTACAGGCTCATAGGTGGAAGGG - Intergenic
987951552 5:24683161-24683183 TTACAGGCTCATAGGTGGAAGGG + Intergenic
987983820 5:25121142-25121164 TTACAGGCTTATAGGTGGAAGGG - Intergenic
988009313 5:25462353-25462375 TTACAGGCTCATAGGTGGAAGGG + Intergenic
988009695 5:25465659-25465681 TTACAAGCTCAGAGGTGGAAGGG + Intergenic
988038687 5:25860719-25860741 TTACAGGCTCACAGGTGGAAGGG - Intergenic
988129016 5:27079350-27079372 TTACAGGCTCATAGGTGGAAGGG - Intronic
988196965 5:28016046-28016068 TTACAGGCTCATAGGTGGAAGGG + Intergenic
988310229 5:29548021-29548043 TTACAGGCTCATAGGTGGAAGGG - Intergenic
988319222 5:29670492-29670514 TTACAGGCTCATAGGTGGAAGGG + Intergenic
988396402 5:30701678-30701700 TTACAGGCTCATAGGTGGAAGGG + Intergenic
988471833 5:31547015-31547037 TTACAGGCTCATAGGTGGAAGGG - Intronic
988473784 5:31565115-31565137 TTACAGGCTCAAAGGTGGAAGGG - Intergenic
988668845 5:33359768-33359790 TTACAGGCTTATAGGTGGAAGGG - Intergenic
988750674 5:34188699-34188721 TTACAGGCTCACAGGTGGAAGGG + Intergenic
988886492 5:35563790-35563812 TTACAGGCTCATAGGTGGAAGGG + Intergenic
989067702 5:37480856-37480878 TTACAGGCTCATAGGTGGAAGGG - Intronic
989144565 5:38235687-38235709 TTACAGGCTCATAGGTGGAAGGG + Intergenic
989501794 5:42176921-42176943 TTGCAGGCTCAGAGGTGGACAGG - Intergenic
989523565 5:42427704-42427726 TTACAGGCTCATAGGTGGAAGGG - Intronic
989609624 5:43278623-43278645 ATGCAGGCTGAGAAGTGAATTGG - Intronic
989662714 5:43816433-43816455 TTACAGGCTCAGAGGTGGAAGGG + Intergenic
989817119 5:45750230-45750252 TTACAGGCTCATAGGTGGAAGGG - Intergenic
989966971 5:50475797-50475819 TTACAGGCTCATAGGTGGAAGGG + Intergenic
989984841 5:50686118-50686140 TTACAGGCTCACAGGTGGAAGGG - Intronic
990083488 5:51945433-51945455 TTACAGGCTCATAGGTGGAAGGG + Intergenic
990193207 5:53285769-53285791 TTACAGGCTCATAGGTGGAAGGG - Intergenic
990264691 5:54062197-54062219 TTACAGGCTCATAGGTGGAAGGG + Intronic
990429258 5:55718230-55718252 TTACAGGCTCATAGGTGGAAGGG + Intronic
990526172 5:56629592-56629614 TTACAGGCTCATAGGTGGAAGGG + Intergenic
991092341 5:62705370-62705392 TAGAAGGCTGAGATGAGGATAGG + Intergenic
991666650 5:69006141-69006163 TTTCAGGCTGGGATGAGGGAAGG + Intergenic
991735814 5:69630624-69630646 TTACAGGCTCATAGGTGGAAGGG + Intergenic
991738942 5:69651912-69651934 TTACAGGCTCATAGGTGGAAGGG + Intergenic
991759256 5:69904519-69904541 TTACAGGCTCATAGGTGGAAGGG - Intergenic
991788080 5:70213603-70213625 TTACAGGCTCATAGGTGGAAGGG + Intergenic
991790517 5:70231653-70231675 TTACAGGCTCATAGGTGGAAGGG + Intergenic
991812308 5:70486263-70486285 TTACAGGCTCATAGGTGGAAGGG + Intergenic
991815267 5:70506740-70506762 TTACAGGCTCATAGGTGGAAGGG + Intergenic
991818403 5:70528029-70528051 TTACAGGCTCATAGGTGGAAGGG + Intergenic
991838485 5:70779585-70779607 TTACAGGCTCATAGGTGGAAGGG - Intergenic
991880527 5:71213967-71213989 TTACAGGCTCATAGGTGGAAGGG + Intergenic
991882964 5:71231988-71232010 TTACAGGCTCATAGGTGGAAGGG + Intergenic
992279793 5:75162457-75162479 TTACAGGCTTATAGGTGGAAGGG + Intronic
992805664 5:80335090-80335112 TTGCTAGCAAAGATGTGGAATGG + Intergenic
993026171 5:82649475-82649497 TTGTAGACTGAGACATGGAAGGG + Intergenic
993139377 5:84011014-84011036 TTACACGCTGAGATGTGACATGG - Intronic
993164206 5:84331154-84331176 TTACAGGCTCATAGGTGGAAGGG + Intronic
993215781 5:85021327-85021349 TTACAGGCTCATAGGTGGAAGGG - Intergenic
993310091 5:86318993-86319015 TTTCAAGATGAGATTTGGAAGGG - Intergenic
993390882 5:87318881-87318903 TTACAGGCTCATAGGTGGAATGG - Intronic
993561763 5:89418446-89418468 TTACAGGTTCATATGTGGAAGGG + Intergenic
993703983 5:91149068-91149090 TTACAGGCTCAGAGGTGGAAGGG + Intronic
993792456 5:92224019-92224041 TTACAGGCTCACAAGTGGAAGGG - Intergenic
993946507 5:94122447-94122469 TTGCAGGCTCATAGGTGGGAGGG - Intergenic
994421062 5:99526796-99526818 TTACAGGCTCATAGGTGGAAGGG - Intergenic
994485979 5:100387518-100387540 TTACAGGCTCATAGGTGGAAGGG + Intergenic
994507887 5:100665015-100665037 TTACAGGCTCATAGGTGGAAGGG - Intergenic
994553259 5:101262844-101262866 TTACAGGCTCATAGGTGGAAGGG + Intergenic
994580201 5:101632164-101632186 TTACAGGCTTATATGTGGAAGGG - Intergenic
994755537 5:103789893-103789915 TTACAGGCTCATAGGTGGAAGGG - Intergenic
994764635 5:103900702-103900724 TTACAGGCTCATACGTGGAAGGG + Intergenic
994828634 5:104747707-104747729 TTACAGGCTCATAGGTGGAATGG + Intergenic
995129381 5:108613417-108613439 TTACAGGCTCATAGGTGGAAGGG + Intergenic
995150035 5:108832360-108832382 ATGCAGGTTAAGATGTGGATGGG + Intronic
995212152 5:109552193-109552215 TTACAGGCTCATAGGTGGAAGGG + Intergenic
995608191 5:113880642-113880664 TTACAGGCTCATAGGTGGAAAGG + Intergenic
995630433 5:114126780-114126802 TTACAGGCTCATAGGTGGAAGGG - Intergenic
995781471 5:115780628-115780650 ATGTAGGCTAAGATGTGGGAAGG - Intergenic
996177708 5:120379416-120379438 TTACAGGCTCATAGGTGGAAGGG + Intergenic
996214230 5:120848248-120848270 TTACAGGCTCATAGGTGGAAGGG - Intergenic
996222909 5:120954396-120954418 TTTCAGGCTCATAGGTGGAAGGG + Intergenic
996243204 5:121227440-121227462 TTACAGGCTCATAGGTGGAAGGG + Intergenic
996471064 5:123860993-123861015 GGGCAGGCTGGGATTTGGAATGG - Intergenic
996495740 5:124153712-124153734 TTGCTGGATGAAATGTGAAATGG + Intergenic
996954643 5:129168366-129168388 TAGAAGACTGTGATGTGGAAGGG - Intergenic
997088243 5:130826457-130826479 TTACAGGCTCATAGGTGGAAGGG - Intergenic
997159728 5:131594926-131594948 TTACAGGCTCATAGGTGGAAGGG + Intronic
997692973 5:135839499-135839521 TTACAGGCTTATAAGTGGAAGGG + Intronic
998138387 5:139686406-139686428 TTGGAGACTGAGATGTGAATGGG + Intergenic
998144853 5:139721525-139721547 TTACAGGCTCATAGGTGGAAGGG + Intergenic
998589629 5:143463844-143463866 TTACAGGCTCATAGGTGGAAGGG - Intergenic
998697003 5:144652236-144652258 TTACAGGCTTATAGGTGGAATGG - Intergenic
998712625 5:144843995-144844017 TTTCAGCCTGAGATTTGGAGGGG - Intergenic
998730683 5:145072591-145072613 TTTCAGCCTGAGATTTGGAGGGG + Intergenic
999274308 5:150318849-150318871 GTGCAGGGTGAGATGTGGGCAGG + Intronic
1000470868 5:161640288-161640310 TTACAGGCTCATAGGTGGAAGGG + Intronic
1000515591 5:162233691-162233713 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1000564788 5:162834387-162834409 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1000574973 5:162966185-162966207 TTACAGGCTCATATGTGTAAGGG - Intergenic
1000676242 5:164126335-164126357 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1001257620 5:170196440-170196462 TTGCAGCCTGAGAAGAGGAAAGG + Intergenic
1001597260 5:172906274-172906296 AGGCAGCCTGAGCTGTGGAAAGG + Intronic
1001684826 5:173585572-173585594 TTACAGGCTTATAGGTGGAAGGG - Intergenic
1001869143 5:175135473-175135495 ATGGAGGCTGAGATGAGAAATGG + Intergenic
1002167408 5:177356971-177356993 CTGGAGGCTGAGATGTCCAAGGG - Intergenic
1002471902 5:179440439-179440461 TTTCAGCCTGAGATGTGGGCAGG + Intergenic
1002858359 6:1057723-1057745 TTACTGGGTGGGATGTGGAAGGG - Intergenic
1003047237 6:2744907-2744929 TTCCAGGCGCGGATGTGGAACGG + Intronic
1003659406 6:8045852-8045874 TTGCAGGCTTACAGGTGAAAGGG + Intronic
1003720240 6:8693361-8693383 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1004015281 6:11726567-11726589 CTGCAGGCTGAGAAGTTCAAGGG - Intronic
1004756639 6:18617784-18617806 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1005113594 6:22313152-22313174 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1005180266 6:23096306-23096328 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1005543362 6:26836532-26836554 TTACAGGCTCATAGGTGGAATGG + Intergenic
1005548745 6:26895004-26895026 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1005655175 6:27928563-27928585 TTACAGGCTTATAAGTGGAAGGG - Intergenic
1006240534 6:32673841-32673863 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1006263352 6:32895020-32895042 TTGCAGGGTGAGATTTGAGACGG + Intergenic
1006367089 6:33622012-33622034 CTGGAGGCTGAGTTGGGGAAGGG + Intronic
1006575361 6:35041342-35041364 TTGCAGGCTGAGATTGGAGATGG + Intronic
1007975175 6:46094395-46094417 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1008220776 6:48851678-48851700 TTGCAGGCTCCTAGGTGGAAGGG - Intergenic
1008260913 6:49365975-49365997 TTACAGGCTTATAGGTGGAAGGG - Intergenic
1008337401 6:50324120-50324142 TTACAGGCTCATAGGTGGAAAGG - Intergenic
1008998689 6:57688511-57688533 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1009014187 6:57878702-57878724 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1009019498 6:57936116-57936138 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1009187172 6:60587890-60587912 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1009300385 6:62010353-62010375 TTACAGGCTCATAGGTGGAAGGG + Intronic
1009377406 6:62990076-62990098 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1009490419 6:64284156-64284178 TTACAGGCTCATAAGTGGAAGGG - Intronic
1009620123 6:66064340-66064362 TTACAGGCTCACAGGTGGAAGGG + Intergenic
1009780218 6:68259938-68259960 TTACAGGCTCATAAGTGGAATGG - Intergenic
1009804847 6:68590154-68590176 TTACAGGCTCATAAGTGGAAGGG - Intergenic
1009899828 6:69797142-69797164 CTGCAAGCTGAGATGTGGGAGGG + Intergenic
1009960636 6:70516638-70516660 TGGGAGGCTGAGATGGAGAATGG - Intronic
1009982306 6:70741248-70741270 TTACAGGCTCATAGGTGGAAGGG - Intronic
1010265901 6:73866560-73866582 CTGCAGGCTGAGAAGTTCAAGGG - Intergenic
1010323999 6:74544340-74544362 TTGCAGGCTTATAGGTGGATGGG - Intergenic
1010508562 6:76689501-76689523 TTTCAGCATGAGATTTGGAAGGG - Intergenic
1010660860 6:78569423-78569445 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1010713975 6:79207081-79207103 TTACAGGCTCACAAGTGGAAGGG + Intronic
1010735769 6:79442584-79442606 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1010821789 6:80422837-80422859 TTACAGGCTTATAGGTGGAAGGG + Intergenic
1010898301 6:81393013-81393035 TTGCAGGCTCATAGGTGGAAGGG + Intergenic
1010920280 6:81672641-81672663 TTGCAGACTCAAAAGTGGAAGGG - Intronic
1011122177 6:83965541-83965563 TTACAGGCTCATAAGTGGAAGGG + Exonic
1011152432 6:84289497-84289519 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1011169371 6:84489085-84489107 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1011236852 6:85227901-85227923 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1011343682 6:86346191-86346213 TTTCAGGCTCATAGGTGGAAGGG - Intergenic
1011346031 6:86370475-86370497 TTCCAGGCTGATAGGTGGAAGGG - Intergenic
1011347787 6:86390410-86390432 TTACAGGCTTATAGGTGGAAAGG + Intergenic
1011348925 6:86401417-86401439 TTCCAGGCTGATCGGTGGAAGGG - Intergenic
1011784306 6:90826837-90826859 TTACAGGCTTATAGGTGGAAGGG + Intergenic
1011805910 6:91072298-91072320 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1011821924 6:91263005-91263027 TATCAGGCTGGGATTTGGAAGGG + Intergenic
1011876694 6:91971212-91971234 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1011950515 6:92958899-92958921 TTACAGGCTCATAGGTGGAAAGG - Intergenic
1012254522 6:97016559-97016581 TTACAGGCTTATAGGTGGAAGGG + Intronic
1012490111 6:99773385-99773407 TTTCAACCTGAGATTTGGAAGGG + Intergenic
1013502940 6:110770738-110770760 TTACAGGCTCATAGGTGGAAGGG - Intronic
1013915950 6:115336894-115336916 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1013927643 6:115492825-115492847 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1013935468 6:115588001-115588023 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1013985978 6:116194434-116194456 TCAGAGGCTAAGATGTGGAAGGG + Intronic
1014068042 6:117150161-117150183 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1014133681 6:117863872-117863894 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1014248015 6:119087642-119087664 TTGCTGGTTGAAATGTGAAATGG + Intronic
1014327518 6:120017827-120017849 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1014407612 6:121070011-121070033 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1014450178 6:121572810-121572832 TTGCAGGCTGATAGGCAGAAGGG + Intergenic
1014715707 6:124862351-124862373 TTACAGGCTCATAGGTGGAACGG - Intergenic
1014863142 6:126496065-126496087 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1014933876 6:127364444-127364466 TTACAGGCTGATAGGTGGAAGGG + Intergenic
1015039944 6:128704275-128704297 TTGCAGGCTCATAGGTGGAAGGG + Intergenic
1015045094 6:128767621-128767643 TTATAGGCTCAGAGGTGGAAGGG - Intergenic
1015171466 6:130259532-130259554 TTTCAGCATGAGATTTGGAAGGG + Intronic
1015347182 6:132174354-132174376 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1015523274 6:134152232-134152254 TTACAGGCTCATAAGTGGAAAGG + Intergenic
1015677010 6:135761800-135761822 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1016172050 6:141030068-141030090 TTGGAGGCTGAGAAGGAGAATGG - Intergenic
1016176413 6:141081974-141081996 TTGTAGGCTCATAGGTGGAAGGG + Intergenic
1016208555 6:141501050-141501072 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1016230718 6:141800786-141800808 TTGCAGGCTCATAGGCGGAAGGG + Intergenic
1016264232 6:142213085-142213107 TTACAGGCTCATAGGTGGAAAGG - Intronic
1016281688 6:142426213-142426235 TTACAGGCTCACAGGTGGAAGGG - Intronic
1016284867 6:142462196-142462218 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1016296073 6:142574709-142574731 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1016424270 6:143916840-143916862 TTACAGGCTCATAGGTGGAAGGG + Intronic
1016477271 6:144441251-144441273 TTGCAGGCTCATAGGCGGAAGGG - Intronic
1017525289 6:155237058-155237080 TTACAGGCTCATAGGTGGAAGGG - Intronic
1017654333 6:156613436-156613458 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1018035200 6:159875700-159875722 TTGCAGGGTGAGAAGTTCAAGGG - Intergenic
1018177281 6:161188167-161188189 TTACAGGCAGAAATGTGGAAGGG + Intronic
1018378703 6:163238014-163238036 TTGAAGGAAGAGCTGTGGAAGGG + Intronic
1018395636 6:163376284-163376306 TGGCAGGCTGTGCTGTGGAGGGG - Intergenic
1018432044 6:163730300-163730322 CTGCAGGGTGAGGTGAGGAAGGG + Intergenic
1018877163 6:167832412-167832434 AAGCAGGCTGAGAGGTGGCAAGG + Intronic
1019003430 6:168775917-168775939 TTTTAGGCTGAGATGTGAGAAGG - Intergenic
1019326068 7:438824-438846 ATGAGGGCTGAGATGGGGAAGGG + Intergenic
1020159523 7:5758769-5758791 TTACAGGCTCATAGGTGGAAGGG + Intronic
1020195426 7:6034435-6034457 GTGATGGTTGAGATGTGGAAGGG - Intronic
1020409088 7:7870726-7870748 TGGCATGCTGAGAGCTGGAAGGG - Intronic
1020579128 7:9971899-9971921 TTACAGGCTTATAGGTGGAAGGG + Intergenic
1020611203 7:10400719-10400741 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1021287458 7:18798480-18798502 ATGCAGGCTGTGATTTGGTAAGG - Intronic
1021479590 7:21101677-21101699 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1021529725 7:21631452-21631474 TTACAGGCTCATATGTGGAAGGG - Intronic
1023030950 7:36089968-36089990 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1023188426 7:37554650-37554672 TTACAGGCTCACAGGTGGAAAGG - Intergenic
1023275766 7:38517041-38517063 TTACAGGCTCATAGGTGGAAGGG + Intronic
1023485527 7:40682191-40682213 TTCCAGGCTGAGATGGAGCAGGG - Intronic
1023532433 7:41172513-41172535 TTTCAGCCTGAGATTTGGAGGGG - Intergenic
1023650424 7:42363829-42363851 TTACAGGCTGATAGGTGGAAGGG - Intergenic
1024289894 7:47795000-47795022 TTACAGGCTCATAGGTGGAAGGG + Intronic
1024548102 7:50539098-50539120 TGGCATGCTGTGATGTGTAAAGG - Intronic
1024814941 7:53257409-53257431 TTACAGGCTCATAAGTGGAAGGG + Intergenic
1025038654 7:55619855-55619877 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1025256662 7:57388615-57388637 GTGCAGGCTGAGGTGGGAAAAGG - Intergenic
1026105685 7:67419049-67419071 TAGCAGGCTGAGTTGTGGGTGGG - Intergenic
1026856325 7:73757573-73757595 TTGGTGGCTGGGATGTGGAAGGG + Intergenic
1026867952 7:73834897-73834919 GAGCAGGCTGGGATGTGGGAAGG - Exonic
1027506454 7:79021663-79021685 TTACAGGCTCATAGGTGGAAGGG + Intronic
1027586587 7:80066054-80066076 TTACAGGCTCACAGGTGGAAGGG - Intergenic
1027695371 7:81404107-81404129 TTACAGGCTCATAAGTGGAAGGG - Intergenic
1028011286 7:85648215-85648237 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1028054093 7:86222243-86222265 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1028086771 7:86645296-86645318 TTGCAGGCAGAGGTGGGCAACGG + Intronic
1028134355 7:87210434-87210456 TTACAGGCTCATAGGTGGAAGGG - Intronic
1028207325 7:88032492-88032514 TTACAGGCTCATAGGTGGAAAGG + Intronic
1028314581 7:89384264-89384286 TTATAGGCTCATATGTGGAAGGG + Intergenic
1028359912 7:89955472-89955494 TTACAGGCTCATAGGTGGAAAGG - Intergenic
1028623823 7:92854651-92854673 TTGAAGGCTGAGACTTGGAAAGG - Intergenic
1028775523 7:94671781-94671803 CTGCAGGCTGAGAAGTTCAAGGG + Intergenic
1028784336 7:94774483-94774505 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1028790250 7:94845134-94845156 TTACAGGCTCATAAGTGGAAGGG + Intergenic
1029269233 7:99366830-99366852 TTTCAGCGTGAGATTTGGAAGGG + Intronic
1029948208 7:104555804-104555826 TTACAGGCTCATAGGTGGAAGGG - Intronic
1030032846 7:105385511-105385533 TTGGAGGCTTACATGTGGAAGGG - Intronic
1030510809 7:110480439-110480461 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1030784670 7:113645150-113645172 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1030807072 7:113931762-113931784 TTACAGGCTCATAGGTGGAATGG - Intronic
1030841571 7:114359825-114359847 TTACAGGCTCATAGGTGGAAGGG + Intronic
1030850966 7:114486609-114486631 TTACAGGCTGATAGGTAGAAGGG - Intronic
1031282300 7:119819312-119819334 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1031400877 7:121325353-121325375 TTGCAGGCTGAGAGGGGCAGTGG - Intronic
1031725216 7:125229912-125229934 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1031783399 7:125998125-125998147 TTGCAGGCTCATAGGTGGAAGGG + Intergenic
1031807379 7:126324777-126324799 TTGCAGGTTGAAATGTGGAAAGG - Intergenic
1032053260 7:128663009-128663031 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1032547722 7:132757698-132757720 CTGCAGGCTGAGAAGTTCAAGGG + Intergenic
1032742658 7:134754207-134754229 CTGGGGCCTGAGATGTGGAAAGG + Intronic
1033482939 7:141759969-141759991 TTACAGGCTCATAGGTGGAAGGG - Intronic
1033491933 7:141852856-141852878 TTACAGGCTCAAAGGTGGAAGGG - Intergenic
1033580202 7:142726146-142726168 TTGCAGGCTCATAGGTGGAAGGG - Intergenic
1033805735 7:144952834-144952856 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1033833160 7:145277062-145277084 TTACAGGCTCACAGGTGGAAGGG + Intergenic
1033953415 7:146813571-146813593 TTACAGGCTTATAGGTGGAAGGG + Intronic
1034011131 7:147530855-147530877 TTACAGGCTCATAGGTGGAAAGG - Intronic
1034540936 7:151757606-151757628 TTTCTGCCAGAGATGTGGAATGG - Intronic
1034689200 7:153000442-153000464 TTACAGGCTAATAGGTGGAAGGG - Intergenic
1034739781 7:153463035-153463057 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1034904705 7:154933967-154933989 TTACAGGCTCATAGGTGGAAGGG - Intronic
1035120647 7:156564001-156564023 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1035128700 7:156630571-156630593 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1035371236 7:158380273-158380295 TTACAGGCTCATAGGTGGAAGGG - Intronic
1035900836 8:3457005-3457027 GTCCAGGATGAGATGTGCAAGGG - Intronic
1037019514 8:13952110-13952132 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1037050471 8:14366767-14366789 TTACAGGCTGATAAGTAGAAGGG - Intronic
1037117922 8:15247873-15247895 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1037167404 8:15847564-15847586 TGGCAGGCTGTGATTTGTAATGG + Intergenic
1037394990 8:18432305-18432327 CTTCAGCCTGAGATTTGGAAAGG - Intergenic
1037484270 8:19332590-19332612 TGGGAGGCTGAGGTGGGGAACGG + Intronic
1037746512 8:21649824-21649846 TTACAGGCTCATAGGTGGAAAGG - Intergenic
1038139134 8:24823134-24823156 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1038915806 8:32021251-32021273 CTGCAGGCTGAGAAGTTCAACGG + Intronic
1040858093 8:51970768-51970790 TTGTAGACTCAGAAGTGGAAGGG - Intergenic
1041430769 8:57778332-57778354 TTACAGGCTTATAGGTGGAAAGG + Intergenic
1041576753 8:59406093-59406115 GTGAAGGCTGAATTGTGGAAGGG + Intergenic
1041894555 8:62908294-62908316 TTACAGGCTCATAGGTGGAAGGG + Intronic
1041902397 8:62996613-62996635 TTACAGGCTCATAGGTGGAAGGG - Intronic
1041953948 8:63536847-63536869 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1042072232 8:64949001-64949023 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1042080501 8:65046405-65046427 TTACAGGCTCATAAGTGGAAGGG - Intergenic
1042297047 8:67231692-67231714 ATGCAGGCTGAAAGGTGGAGAGG + Intronic
1042407448 8:68422254-68422276 TTCCAGGCTGATAGATGGAAGGG - Intronic
1042412617 8:68481830-68481852 TTACAGGCTCATATGTAGAAGGG + Intronic
1042466261 8:69132884-69132906 TTGCAGGCTCATAGGCGGAAGGG - Intergenic
1042602634 8:70513182-70513204 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1042923239 8:73940528-73940550 TTACAGGCTCATAGGTGGAAGGG + Intronic
1043062034 8:75517405-75517427 TTACAGGCTCATAAGTGGAAGGG - Intronic
1043210155 8:77504027-77504049 CTGCAGGCTGAGAAGTTCAAGGG + Intergenic
1043262455 8:78219667-78219689 TTACAGGCTTATAGGTGGAAGGG - Intergenic
1043265965 8:78267582-78267604 TTACAGGCTTATAGGTGGAAGGG + Intergenic
1043345906 8:79297335-79297357 TTACAGGCTTATAGGTGGAAGGG + Intergenic
1043426203 8:80150806-80150828 TTACAGGCTCATAGGTGGAAAGG + Intronic
1043779346 8:84312466-84312488 TTACAGGCTCATAAGTGGAAGGG - Intronic
1043993223 8:86781235-86781257 TTATAGGCTTATATGTGGAAGGG + Intergenic
1044087105 8:87955272-87955294 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1044324736 8:90847095-90847117 TTACAGGCTCATAGGTGGAAGGG - Intronic
1044327001 8:90869719-90869741 TTACAGGCTCAGAGGTGGAAGGG + Intronic
1044504591 8:93003681-93003703 TTACAGGCTCATAGGTGGAAGGG - Intronic
1044538139 8:93381156-93381178 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1044846634 8:96388491-96388513 TTTCAAGCTGAGATTTGGATGGG - Intergenic
1044887352 8:96793708-96793730 TTGCAGGCTTATAAGTGGACAGG - Intronic
1044900384 8:96937606-96937628 GTGCAGGCTGAGCTGTGTCATGG - Intronic
1045449197 8:102303601-102303623 TTTCAGGCTGAGTTTTGGGATGG - Intronic
1045597105 8:103669510-103669532 TTACAGGCTCATAGGTGGAAGGG - Intronic
1045784211 8:105902231-105902253 TTACAGGCTTATAGGTGGAAAGG - Intergenic
1046129364 8:109947296-109947318 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1046161829 8:110376436-110376458 TTGCAGGCTCATAGGTGGAAGGG + Intergenic
1046232389 8:111374259-111374281 TTACAGGCTCATAAGTGGAAGGG + Intergenic
1046243665 8:111531588-111531610 TTACAGGCTCACAGGTGGAAGGG - Intergenic
1046352524 8:113033615-113033637 TTACAGGCTGATATGTGGAAGGG + Intronic
1046358451 8:113117952-113117974 TTGCAGGCTCATAGGTGGAAGGG + Intronic
1046495543 8:115009741-115009763 TTACAGGCTTATAGGTGGAAAGG - Intergenic
1046703135 8:117423510-117423532 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1046786387 8:118271593-118271615 TTACAGGCTCATAGGTGGAAGGG - Intronic
1046826094 8:118694074-118694096 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1046889059 8:119401092-119401114 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1047630391 8:126700122-126700144 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1047923287 8:129657204-129657226 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1047924597 8:129670186-129670208 TTACAGGCTTATAGGTGGAAGGG + Intergenic
1047941353 8:129830268-129830290 TTGCAGGATCATAGGTGGAAGGG - Intergenic
1048180084 8:132186232-132186254 TTTGAGGCTAAGATGGGGAAAGG + Intronic
1048217503 8:132509906-132509928 TTACAGGCTCATAGGTGGAAAGG - Intergenic
1048537614 8:135312295-135312317 TTACAGGCTGCTAGGTGGAAGGG - Intergenic
1048745941 8:137615265-137615287 TTGCAGGCTCATAAGCGGAAGGG - Intergenic
1048985652 8:139733431-139733453 TAGCAGGCTAAGATGTGGGGTGG + Intronic
1049363387 8:142224956-142224978 CTGCAGGCTCAGGTGGGGAAGGG - Intronic
1049542862 8:143216216-143216238 TTGCAGCCTTGGATGGGGAAGGG + Intergenic
1050255280 9:3787082-3787104 TTACAGGATCATATGTGGAAGGG - Intergenic
1050456488 9:5839679-5839701 TTGCAGGCTGTGTCCTGGAACGG + Intergenic
1050858045 9:10386995-10387017 TTGCTGGTTCAAATGTGGAAGGG + Intronic
1050904448 9:10986492-10986514 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1050953637 9:11627913-11627935 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1051309899 9:15758464-15758486 TTACAGGCTCATAGGTGGAAGGG + Intronic
1051450582 9:17193335-17193357 TTACAGGCTCATAGGTGGAAGGG - Intronic
1051868964 9:21714816-21714838 TTACAGGCTCACAGGTGGAAAGG - Intergenic
1051957533 9:22713813-22713835 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1052267341 9:26590085-26590107 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1052351667 9:27465135-27465157 TTGCAGGCTTATAGGTGGAAGGG - Intronic
1052414136 9:28156662-28156684 TTACAGGCTCATAGGTGGAAGGG - Intronic
1052428713 9:28338363-28338385 TTACAGGCTTATAGGTGGAATGG + Intronic
1052689807 9:31802553-31802575 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1052834414 9:33240057-33240079 TTGCACGCTGACATCCGGAAAGG - Intronic
1052969334 9:34367441-34367463 TTACAGGCTCATAGGTGGAAGGG - Exonic
1053246127 9:36536008-36536030 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1053354400 9:37433954-37433976 TTGCAGGCTGGGGTGGGGGAGGG - Intronic
1053572048 9:39319404-39319426 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1053633070 9:39965040-39965062 TTGCAGGGTCATAGGTGGAAGGG + Intergenic
1053780379 9:41600607-41600629 TTACAGGCTCATAAGTGGAAGGG + Intergenic
1053780955 9:41606583-41606605 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1053882555 9:42610936-42610958 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1053890114 9:42683366-42683388 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1054093604 9:60878115-60878137 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1054115087 9:61154035-61154057 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1054125097 9:61299607-61299629 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1054168321 9:61810764-61810786 TTACAGGCTCATAAGTGGAAGGG + Intergenic
1054168898 9:61816740-61816762 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1054169853 9:61828847-61828869 TTACAGGCTTATAGGTGGAAGGG - Intergenic
1054210818 9:62285657-62285679 TTGCAGGGTCATAGGTGGAAGGG - Intergenic
1054221582 9:62418404-62418426 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1054229132 9:62490769-62490791 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1054592669 9:67028499-67028521 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1054667685 9:67751968-67751990 TTACAGGCTTATAGGTGGAAGGG + Intergenic
1054668632 9:67764071-67764093 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1054669208 9:67770054-67770076 TTACAGGCTCATAAGTGGAAGGG - Intergenic
1054732110 9:68712022-68712044 TTTCAACCTGAGATTTGGAAGGG - Intronic
1054868226 9:70025003-70025025 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1055174260 9:73298640-73298662 TTACAGGCTTATAGGTGGAAGGG - Intergenic
1055334885 9:75223717-75223739 TTACAGGCTCATATGTGGAAGGG - Intergenic
1055413104 9:76052791-76052813 TTACAGGCTCATAGGTGGAAGGG - Intronic
1055698741 9:78917830-78917852 TTACAGGCTCATAGGTGGAAAGG + Intergenic
1055713239 9:79088469-79088491 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1055848426 9:80595030-80595052 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1055856320 9:80692093-80692115 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1056129110 9:83566551-83566573 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1056192587 9:84198952-84198974 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1056595253 9:88002560-88002582 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1056924298 9:90819868-90819890 TTACAGGCTCAGAGATGGAAGGG - Intronic
1057285249 9:93748532-93748554 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1057303475 9:93899617-93899639 TGGGAGACTGAGATGTGGAGAGG - Intergenic
1057519713 9:95751563-95751585 ATGGAGCCTGAGCTGTGGAAGGG + Intergenic
1057794772 9:98147313-98147335 TTGCATACTGACATGTGGTAGGG + Intronic
1057905494 9:98980050-98980072 TGGGAGGCTGAGAGGTGGAAGGG + Intronic
1058076621 9:100657804-100657826 TTGTAGGCTCATAGGTGGAAGGG + Intergenic
1058240286 9:102548864-102548886 TTGTAGGCTTATAGGTGGAAGGG + Intergenic
1058292148 9:103256425-103256447 TTACAGGCTCATAAGTGGAAAGG - Intergenic
1058380534 9:104372374-104372396 TTACAGGCTCATATGTGGAAGGG + Intergenic
1058498941 9:105591312-105591334 TTACAGGCTCATAGGTGGAAGGG - Intronic
1058774113 9:108267115-108267137 TTGCAGGCTCATAGGTGGAAGGG + Intergenic
1058810111 9:108630979-108631001 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1059110655 9:111555998-111556020 TTACAGGCTCATAGGTGGAAGGG - Intronic
1059418829 9:114178587-114178609 TTGCAGCCTGGGGTGGGGAAGGG + Intronic
1059513905 9:114875447-114875469 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1059753521 9:117271578-117271600 TTACAGGCTCATAGGTGGAAGGG - Intronic
1059766865 9:117391777-117391799 TTACAGGCTCAAAGGTGGAAGGG - Intronic
1059986388 9:119824235-119824257 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1060016373 9:120089835-120089857 CTGCAGGCTGAGAAGTTTAAGGG - Intergenic
1060029708 9:120203867-120203889 ATGCAGCCTGAGCTGTGTAATGG + Intergenic
1060770700 9:126329809-126329831 TTGCAGGTTGGGTTGTGGAGGGG + Intronic
1062121523 9:134836442-134836464 TTTCAACCTGAGATTTGGAAGGG + Intronic
1062431855 9:136529880-136529902 TTGGGGGCTGCGATGTGGGATGG + Intronic
1185653959 X:1669363-1669385 TTGCAGGCTGAGGAGTGGAAAGG + Intergenic
1185797839 X:2981926-2981948 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1185893727 X:3841338-3841360 TTACAGGCTCATAGGTGGAAGGG + Intronic
1185898842 X:3879762-3879784 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1185903959 X:3918191-3918213 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1186222815 X:7367213-7367235 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1186700397 X:12083928-12083950 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1186704541 X:12127732-12127754 TTACAGGCTTATAGGTGGAAGGG - Intergenic
1186926127 X:14335301-14335323 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1187214765 X:17265347-17265369 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1187615679 X:20991209-20991231 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1188014170 X:25089609-25089631 TTGCAGCATGAGATTTGGAGGGG + Intergenic
1188062398 X:25617654-25617676 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1188106712 X:26155834-26155856 TTACAGGCTCATACGTGGAAGGG - Intergenic
1188196496 X:27240995-27241017 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1188576337 X:31655340-31655362 TTGCAGGCTCAGAGATGGAAGGG + Intronic
1188748140 X:33872764-33872786 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1188753733 X:33935547-33935569 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1188755068 X:33952466-33952488 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1188794117 X:34441506-34441528 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1188804396 X:34569890-34569912 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1188833316 X:34927888-34927910 TTACAGGCTGATAGGTGAAAGGG - Intergenic
1188925858 X:36043394-36043416 TTACAGGCTCATATGTGGAAGGG - Intronic
1188962293 X:36507436-36507458 TTCCAGGCTCATAGGTGGAAGGG - Intergenic
1190169682 X:48102134-48102156 TTTCAGCCTGAGATTTGGAGGGG - Intergenic
1190414258 X:50166024-50166046 TGGCAGACTGTGAAGTGGAAAGG + Intergenic
1190514397 X:51207612-51207634 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1190772629 X:53527704-53527726 TTACAGGCTCATAAGTGGAAGGG + Intergenic
1190974626 X:55387197-55387219 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1191034810 X:56013349-56013371 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1191052206 X:56206364-56206386 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1191083960 X:56545091-56545113 TTACAGGCTCAAAGGTGGAAGGG - Intergenic
1191211368 X:57888851-57888873 TTACAGGCTCATAGGTGGAATGG - Intergenic
1191689862 X:63928300-63928322 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1191696682 X:63997205-63997227 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1191737915 X:64406912-64406934 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1191887023 X:65899254-65899276 TTACAGGCTCAAAGGTGGAAGGG - Intergenic
1192003416 X:67181840-67181862 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1192071002 X:67941282-67941304 TTGCAGGCTCATAAGTGGAAGGG - Intergenic
1192634548 X:72805229-72805251 CTGCAGGCTGGGAAGTTGAAGGG + Intronic
1192647165 X:72915572-72915594 CTGCAGGCTGGGAAGTTGAAGGG - Intronic
1192676480 X:73202346-73202368 TTACAGGCTAATAGGTGGAAGGG - Intergenic
1192842032 X:74866407-74866429 TTACAGGCTCATAGGTGGAAGGG + Intronic
1192856444 X:75017661-75017683 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1193008221 X:76644535-76644557 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1193196003 X:78632052-78632074 TTGCATGCTTATAGGTGGAAGGG + Intergenic
1193210960 X:78806428-78806450 TTGCAGGCTCATAGGTGGAAGGG + Intergenic
1193256562 X:79355567-79355589 TTACAGGCTCATAGGTGGAAAGG + Intergenic
1193279452 X:79629246-79629268 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1193388277 X:80895753-80895775 TTACAGGCTCACAGGTGGAAGGG + Intergenic
1193471213 X:81906809-81906831 TTACAGGCTTATAGGTGGAAGGG - Intergenic
1193518804 X:82503727-82503749 TTACAGGCATATATGTGGAAAGG + Intergenic
1193592281 X:83404569-83404591 CTGCAGACTGAGAAGTTGAAGGG - Intergenic
1193820317 X:86154445-86154467 TTGCAGGTTGAGATGGTGAAAGG - Intronic
1193845606 X:86466593-86466615 TTACAGGCTCATAGGTGGAAGGG - Intronic
1194019421 X:88668635-88668657 TTACAGGCTCATAAGTGGAAAGG - Intergenic
1194043249 X:88970021-88970043 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1194082817 X:89489615-89489637 TTACAGGCTCATAAGTGGAAGGG - Intergenic
1194184915 X:90764539-90764561 TTGCAGGCTCATAGGTGGAAGGG - Intergenic
1194192870 X:90858461-90858483 TTACAGGCTCATAGGTGGAAAGG + Intergenic
1194332561 X:92601076-92601098 TTACAGGCTCATAGGTGGAAGGG + Intronic
1194418192 X:93638555-93638577 TTGCAGGCTCATAGGTAGAAGGG + Intergenic
1194496247 X:94620785-94620807 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1194548489 X:95268738-95268760 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1194566521 X:95494979-95495001 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1194756402 X:97743936-97743958 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1194828866 X:98596483-98596505 TTACAGGCTCACAGGTGGAAGGG - Intergenic
1194893365 X:99407316-99407338 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1194929499 X:99868512-99868534 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1195087609 X:101427324-101427346 TTGCAGGCTGGGAAGTTCAAGGG + Intronic
1195428419 X:104761631-104761653 TTACAGGCTCATAGGTGGAAGGG - Intronic
1195816863 X:108897286-108897308 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1195819564 X:108929898-108929920 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1196103529 X:111872102-111872124 CTGCAGGCTGAGAAGTTCAAGGG - Intronic
1196158051 X:112452533-112452555 TAGAAGGGTGAGATATGGAAAGG + Intergenic
1196522311 X:116687723-116687745 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1196946981 X:120836934-120836956 TTGCAGGATGGGATGGGGATTGG + Intergenic
1196973783 X:121137379-121137401 TTACAGGCTTATAGGTGGAAGGG - Intergenic
1197004644 X:121481193-121481215 TTACAGGCTCATAGGTGGAAAGG + Intergenic
1197054377 X:122098545-122098567 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1197059014 X:122154448-122154470 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1197160472 X:123317424-123317446 TTACAGGCTCATAGGTGGAAGGG - Intronic
1197341125 X:125267098-125267120 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1197349047 X:125359742-125359764 TTTCAGGCTTATAGGTGGAAGGG + Intergenic
1197464374 X:126784722-126784744 TTACAGGCTCACAGGTGGAAGGG + Intergenic
1197544958 X:127812917-127812939 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1197798167 X:130319725-130319747 TTGCAGGCTCATAGGTAGAAGGG + Intergenic
1197886918 X:131227938-131227960 TTGTAGGCTGAGATTTTGAAGGG - Intergenic
1197914670 X:131521633-131521655 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1198608783 X:138373718-138373740 TTACAGGCTTATAGGTGGAATGG + Intergenic
1198629164 X:138616197-138616219 TTACAGGCTTATAGGTGGAAGGG - Intergenic
1198775375 X:140173349-140173371 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1198817628 X:140609104-140609126 TTACAGGCTTATAGGTGGAAGGG + Intergenic
1198872920 X:141194458-141194480 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1198913312 X:141637951-141637973 TTGCAGGCTCATAGGTAGAAGGG - Intronic
1198991561 X:142520636-142520658 TTGCAGGCTCATAGGTGGAAGGG - Intergenic
1199112915 X:143955871-143955893 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1199161262 X:144614887-144614909 TTTCAACCTGAGATTTGGAAGGG - Intergenic
1199279042 X:145977834-145977856 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1199306282 X:146270436-146270458 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1199325581 X:146494231-146494253 TTACAGGCTCATAGGTGGAAGGG + Intergenic
1199329457 X:146542372-146542394 TTTCAGGCTTATACGTGGAAGGG - Intergenic
1199908659 X:152261403-152261425 TTACAGGCTCATAGGTGGAAAGG - Intronic
1199929676 X:152505952-152505974 TTACAGGCTCATAGGTGGAAGGG - Intergenic
1200040150 X:153359128-153359150 TTACAGGCTCATAAGTGGAAGGG + Intronic
1200435469 Y:3145496-3145518 TTACAGGCTCATAAGTGGAAGGG - Intergenic
1200531538 Y:4346648-4346670 TTGCAGGCTCATAGGTGGAAGGG - Intergenic
1200539494 Y:4440909-4440931 TTACAGGCTCATAGGTGGAAAGG + Intergenic
1200641261 Y:5720128-5720150 TTACAGGCTCATAGGTGGAAGGG + Intronic
1202168240 Y:22014955-22014977 ATGCAGACTCAGATGTGGAAGGG + Intergenic
1202223121 Y:22571413-22571435 ATGCAGACTCAGATGTGGAAGGG - Intergenic
1202319994 Y:23624247-23624269 ATGCAGACTCAGATGTGGAAGGG + Intergenic
1202364573 Y:24148759-24148781 TAGAAGGCTGAGATGTCAAATGG + Intergenic
1202506208 Y:25521363-25521385 TAGAAGGCTGAGATGTCAAATGG - Intergenic
1202550774 Y:26045809-26045831 ATGCAGACTCAGATGTGGAAGGG - Intergenic
1202575497 Y:26320147-26320169 TTGCATTCTGAGCTGTGGACTGG + Intergenic