ID: 934538943

View in Genome Browser
Species Human (GRCh38)
Location 2:95159169-95159191
Sequence GCGCCGCGCTGGGCGCACCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934538943_934538949 -10 Left 934538943 2:95159169-95159191 CCCCGGTGCGCCCAGCGCGGCGC 0: 1
1: 0
2: 1
3: 18
4: 169
Right 934538949 2:95159182-95159204 AGCGCGGCGCACTGCTGCCCGGG 0: 1
1: 0
2: 1
3: 11
4: 120
934538943_934538950 -9 Left 934538943 2:95159169-95159191 CCCCGGTGCGCCCAGCGCGGCGC 0: 1
1: 0
2: 1
3: 18
4: 169
Right 934538950 2:95159183-95159205 GCGCGGCGCACTGCTGCCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 89
934538943_934538953 17 Left 934538943 2:95159169-95159191 CCCCGGTGCGCCCAGCGCGGCGC 0: 1
1: 0
2: 1
3: 18
4: 169
Right 934538953 2:95159209-95159231 TGCTCTTCCCTCGCCAAGTCCGG 0: 1
1: 0
2: 0
3: 5
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934538943 Original CRISPR GCGCCGCGCTGGGCGCACCG GGG (reversed) Intronic
900100899 1:961567-961589 GGGCGGCGCTGGGGGCTCCGTGG + Intronic
900284059 1:1890892-1890914 GGGCCGCGCTGCGCGCTCCGCGG + Exonic
900513367 1:3070416-3070438 GAGCCGCGCTGGCCGGGCCGCGG - Intronic
901066502 1:6497090-6497112 GCGCCGCTCTGCCCCCACCGCGG - Exonic
901280001 1:8026440-8026462 GCGTTGCGCCGGGCCCACCGTGG + Intergenic
902505891 1:16938944-16938966 GAGCGGCTCTGAGCGCACCGCGG + Exonic
902600853 1:17539587-17539609 GCGGCGCGCTGGGAGCAGGGAGG + Intergenic
904500233 1:30908854-30908876 GCCCCGCGGGGGGCGCACTGGGG - Intergenic
905789835 1:40784066-40784088 GCGCCGGGCTGGGGGCGCCGGGG - Exonic
906650299 1:47508213-47508235 ACGCCGCGGCGGGCGCCCCGCGG - Intergenic
906650405 1:47508637-47508659 GGGCTGCGCTGGGCACGCCGAGG + Intergenic
908128079 1:61050308-61050330 GGGCCGAGCTTGGCGCTCCGGGG + Intronic
908195537 1:61742854-61742876 CCGCCGCGCAGGGCTCGCCGAGG + Intronic
911638826 1:100266119-100266141 GAGCCGCGCTGGGAACACTGCGG - Intergenic
914902947 1:151721572-151721594 GCGCTGCGCTAAGCGCCCCGGGG - Exonic
918040693 1:180912594-180912616 GAGGCGCGCGGGGCGCACGGAGG - Intergenic
919926405 1:202194027-202194049 GCGCCGCGCTGTGCGCTTCCCGG + Exonic
922730780 1:227947924-227947946 GCTCCGCGCAGGGCGCGCCGCGG + Intergenic
922730956 1:227948408-227948430 GCCCCGAGCTGGGCGCTGCGCGG + Intergenic
923986371 1:239386966-239386988 GCCCCGCGGTGTGCGCTCCGGGG - Intronic
1064354315 10:14604057-14604079 GCGCCGCGCGGGGTGACCCGTGG + Intronic
1065099945 10:22322023-22322045 GGGCCGCGCGCGGCGCGCCGGGG - Intronic
1065968133 10:30785208-30785230 GGGCGGCGCTGGGCGGCCCGGGG - Intergenic
1067025025 10:42837075-42837097 GAGCCGCGCTGGGGGCGCCTCGG - Intergenic
1068955357 10:62815615-62815637 GCCCGGGGCTGGGCGCGCCGGGG + Intronic
1068955727 10:62817632-62817654 GGACCGCGCTGGGCTCACCGAGG - Intronic
1069456969 10:68561006-68561028 GCGCCGGGTTGGGGGCAGCGGGG + Intronic
1070800820 10:79243510-79243532 GCTCCGCGCTGCCCGCTCCGAGG - Intronic
1073292384 10:102419638-102419660 GGGGCGCGCGGGGCTCACCGCGG + Intronic
1073461591 10:103668747-103668769 GCGCCGCGCTCGGCCAGCCGCGG + Intronic
1074121681 10:110498076-110498098 GCCCCGCGCCGCGCGCCCCGCGG - Exonic
1075054484 10:119207462-119207484 GCCCCGCGCCGCGAGCACCGAGG + Intergenic
1076096328 10:127737171-127737193 GGGCCGGGCTGGTCGCACCCGGG + Intergenic
1076917782 10:133433103-133433125 GCCCCGCCCTGGGTGCAGCGTGG + Intergenic
1076935563 10:133566148-133566170 CTGCCGCGCTGGGGCCACCGTGG + Intronic
1076937776 10:133577178-133577200 GCCCCGCCCTGGGTGCAGCGTGG + Intergenic
1078474776 11:11621300-11621322 GCGCCGCGCGGGGCACTCCCGGG + Intronic
1078514316 11:12009259-12009281 GCGGCGCGGTGGGCGGGCCGCGG + Intronic
1081672409 11:44949633-44949655 GCGCCCCGCTGGGCGGGGCGGGG - Intronic
1083176146 11:60951556-60951578 GCTCCGGGCTGGGCCCCCCGCGG + Exonic
1084573796 11:69975930-69975952 GGGCAGGGCTGGGGGCACCGAGG - Intergenic
1085982831 11:81744865-81744887 GGGCGGCGCTGGGCGCTCCTGGG - Intergenic
1086064907 11:82733809-82733831 GCGCCGCGCGCGCCGCGCCGGGG - Exonic
1088823320 11:113474764-113474786 GTGCTGCCCTGGGCGCCCCGCGG + Intronic
1090799099 11:130159721-130159743 GCGGCGGGCTGGGCGGGCCGAGG + Exonic
1091616161 12:2052805-2052827 GCACGGCGCGGGGCGCACGGCGG - Intronic
1091740924 12:2959817-2959839 CCGCTCCGCTGGGCGCACCGGGG + Intronic
1092318087 12:7440394-7440416 TGGCCGGGCTGGGCGCGCCGCGG - Intronic
1094025856 12:25959000-25959022 GCGCGGCGCGGGGAGCGCCGGGG + Intergenic
1094155352 12:27332823-27332845 CCGCCGCTCTGGGCGCCGCGGGG - Intergenic
1095946705 12:47758004-47758026 GCCCAGCTCTGGGAGCACCGCGG - Exonic
1096647664 12:53047384-53047406 GCGCCGCGCTGGGCGGGCGGCGG + Intronic
1098006573 12:66003687-66003709 GCGTCGCACTGGCCCCACCGAGG + Intergenic
1099440083 12:82687836-82687858 GAGGCGCGCTGGGCGGGCCGAGG + Intronic
1099956223 12:89354112-89354134 GCGCCGCGCCGGCCGCACACAGG - Intergenic
1100869389 12:98894833-98894855 GCCCGGCGCTCGGCGCAGCGCGG - Intronic
1103561671 12:121796132-121796154 GGGCCGCGCTGGGCCCACTGAGG + Intronic
1103764780 12:123272029-123272051 GCCCCGCGCCCGGCGCCCCGGGG + Exonic
1105349338 13:19601865-19601887 TGGCCGGGCTGGGCGCGCCGCGG + Intergenic
1105964562 13:25372435-25372457 GCGGCGCGCTGGCCGCACGGGGG + Intronic
1106498786 13:30307481-30307503 GCCGCGCGGTGGGCGCAGCGCGG + Exonic
1108662641 13:52600445-52600467 GGGCTGGGCTGGGCGCGCCGCGG - Intergenic
1108689199 13:52846991-52847013 GGGCCGCACTGTGCGCAGCGGGG + Exonic
1113082731 13:106535210-106535232 GCGCCGCGCCGGACGCAGCTCGG + Intergenic
1113797491 13:113066846-113066868 GGGCCGTGCGGGGCGCACCCAGG + Intronic
1113806165 13:113110861-113110883 CCGCGGCGCGGGGCGCCCCGAGG - Intronic
1118887587 14:69879609-69879631 GAGGCGCGCTGTGCGCCCCGCGG + Exonic
1122208340 14:100159479-100159501 GCGCCGCGCGGGGCCCACCCCGG - Intronic
1122302217 14:100737681-100737703 GCACCGCGCTGGGCTCCCTGGGG - Exonic
1122545059 14:102517358-102517380 GGACCGCGCTGGGCGCAGGGAGG + Intergenic
1123412999 15:20074401-20074423 GCGGCGCGCTCGGAGCCCCGAGG - Intergenic
1123425652 15:20168537-20168559 GAGCCGCGCTGGGGGCGCCTCGG - Intergenic
1123522341 15:21081514-21081536 GCGGCGCGCTCGGAGCCCCGAGG - Intergenic
1123534879 15:21175064-21175086 GAGCCGCGCTGGGGGCGCCTCGG - Intergenic
1129334294 15:74843192-74843214 GGGCGGCGCTGGGGGCAGCGTGG - Exonic
1129468723 15:75738532-75738554 GGGCCGGGCTGGGGGCACGGCGG + Intergenic
1129832829 15:78681838-78681860 GGGCCTCCCTGGGTGCACCGGGG + Intronic
1132719832 16:1310033-1310055 GCCCCGCGCCAGGCGCACCTCGG - Intronic
1132991702 16:2798861-2798883 GCCCCCCGCTGCGCGCACCCCGG + Intergenic
1136666731 16:31819391-31819413 GCAGCGCGCTGGGGGCCCCGAGG + Intergenic
1136858591 16:33680980-33681002 GAGCCGCGCTGGGGGCGCCTCGG + Intergenic
1136996094 16:35188883-35188905 GCGCCGGGCTGGGGGCAGGGTGG + Intergenic
1137236554 16:46623186-46623208 GCGTCGCACTGGCCCCACCGAGG + Intergenic
1137596562 16:49727818-49727840 GGGCCGCGCTGGGCGCAGGCTGG - Intronic
1138105673 16:54286088-54286110 GCGCTGAGCTGGGCGGCCCGGGG - Exonic
1138392735 16:56682314-56682336 GCCCAGCGCCGGGCGCACCGCGG - Intronic
1139505115 16:67394724-67394746 GCGCCGCTCTGGCCGCCCCGCGG - Exonic
1140478769 16:75251549-75251571 GCGGCGCGCTCGGAGCCCCGAGG - Intronic
1142206423 16:88785172-88785194 GCGCAGCGCTCGGCTCACTGGGG + Exonic
1142219876 16:88848837-88848859 GGGCCGCTCTGGGCGCACGTGGG + Intronic
1142227654 16:88885415-88885437 GCGCCGGGCTGGGCTTCCCGGGG - Intronic
1142350106 16:89575860-89575882 GGGCCCGGCTGGGCGCACTGAGG - Exonic
1142395351 16:89828576-89828598 GCGCCGCGGCGGGCGCAGGGCGG + Exonic
1203120162 16_KI270728v1_random:1529474-1529496 GAGCCGCGCTGGGGGCGCCTCGG + Intergenic
1145755401 17:27386405-27386427 GTGCTGTGGTGGGCGCACCGTGG + Intergenic
1147325715 17:39668446-39668468 GCGGGGCACTGGGCGGACCGCGG + Exonic
1149806128 17:59619801-59619823 CCGCCGCGCGCGGCGCTCCGTGG + Intronic
1150643531 17:66964821-66964843 GCGCCGCTCCGGGGGCGCCGGGG - Intergenic
1151224872 17:72640581-72640603 GCGCCACGCCCGGCGCCCCGGGG + Intergenic
1151875912 17:76868311-76868333 GCCCCGGGCAGGGCGCACAGCGG + Intergenic
1152337976 17:79708632-79708654 GGGCCCCGCAGGGCGCACAGAGG - Intergenic
1152697467 17:81804240-81804262 GCGCCGCGCGGTGAGCACCTGGG + Exonic
1153515390 18:5896135-5896157 CCGCCGGGACGGGCGCACCGCGG + Intergenic
1159928667 18:74291329-74291351 CCGCCGCGCAGGGCGCTCCCAGG + Intronic
1160053147 18:75455599-75455621 GGGCCCCGCAGGGCGCAGCGGGG - Intergenic
1160826164 19:1081498-1081520 GCGCTGAGCTGGGCGCCCCGGGG + Intronic
1160904402 19:1445703-1445725 GCGCCGAGCTGGGCGCGCGGGGG - Intergenic
1160982746 19:1823741-1823763 GGGCCGGGCCGGGGGCACCGCGG + Exonic
1161104084 19:2434660-2434682 GGGCATCGCTGGGCGCCCCGAGG + Intronic
1161312041 19:3600175-3600197 GCGCCGCGCCTGGGCCACCGTGG - Exonic
1161628450 19:5339846-5339868 CCTCCGCGCTGGGGGCCCCGTGG - Intronic
1163334264 19:16660948-16660970 CCGCCTCGCTGGGCGGAACGGGG + Intergenic
1165013500 19:32864849-32864871 GGGCCGCCCTGGCCGTACCGAGG - Intronic
1165058605 19:33194378-33194400 GCGCAGCGCGGGGCGGCCCGGGG + Intronic
1165305487 19:35000452-35000474 GCGGCGCGGTGGGCGCGCCCCGG - Exonic
1166750521 19:45162173-45162195 GCCCCGGGCTGGGAGCACAGTGG + Intronic
1168164461 19:54537226-54537248 GCGTCCCGCTGGGCACACAGGGG + Intronic
926090010 2:10043548-10043570 GCGCCGCGAGGGCCGCGCCGGGG + Exonic
930358233 2:50346902-50346924 GCGCCGAGCTGGGCTCGCCCGGG - Intronic
932496252 2:72147308-72147330 GCGCCTCGCTAGGCGCCCCCGGG + Intronic
934538943 2:95159169-95159191 GCGCCGCGCTGGGCGCACCGGGG - Intronic
934655876 2:96116636-96116658 GCGGGGCGGTGGGCGGACCGAGG + Intergenic
936104455 2:109613569-109613591 GCGCCGCGCCCCGCGAACCGGGG + Intronic
936165287 2:110115416-110115438 GCGCCCCGCTGTGCGCCCGGTGG + Intronic
938795951 2:134718642-134718664 GGGCCGCGCTGGGCGAGGCGCGG - Intronic
940650570 2:156436394-156436416 GCGCCTCGCTGGGAGCACCCGGG + Intronic
947641124 2:231708355-231708377 GCGCAGCGCGGGACGCGCCGGGG + Intronic
1171977616 20:31605516-31605538 GCGCTGCGCCGGGGGCGCCGGGG + Exonic
1175715588 20:61252689-61252711 GCGCCGGGCTGGATGCAGCGGGG - Intronic
1176005743 20:62861563-62861585 ACGCGGCGCTGGGCGAGCCGGGG - Exonic
1176100222 20:63361334-63361356 GCGCCGGGCTGTGGGCTCCGTGG + Exonic
1178351088 21:31873495-31873517 GCGCCTCGCTGGGCGGCGCGGGG + Exonic
1180960607 22:19760750-19760772 GCGCCGCGCTGCGTGCGCCCCGG - Intronic
1181478067 22:23180757-23180779 GCGCGGGGCGGGGCGCGCCGGGG - Exonic
1182260953 22:29072981-29073003 GCGCTGAGCTGGGCGGGCCGGGG + Intergenic
1182351195 22:29700920-29700942 GCGCCGTGATGGGAGCACCTGGG + Intergenic
1183411779 22:37659138-37659160 GCGCCGAGCTGCGCGCCGCGGGG + Exonic
1183731100 22:39619034-39619056 GCACAGCGCTGGGCACACAGTGG + Intronic
1184412162 22:44331689-44331711 GCGCCGCGCCCGGCGCGCCTAGG - Intergenic
1184568720 22:45309287-45309309 GCACGGCGCTGGGCACACCATGG - Exonic
1185029120 22:48432385-48432407 GCACCAGGCTGGGCGCATCGAGG - Intergenic
953246686 3:41199756-41199778 GCGGCGGGCTGGGCGCAGCCGGG + Intronic
953925376 3:46979947-46979969 GCGCGAAGCTGGGGGCACCGCGG - Intronic
954615649 3:51967620-51967642 CCGCCGCTCGGGGCGCACCGCGG - Intronic
956786230 3:72644566-72644588 GCTCAGCCCTGGGCGCACTGGGG + Intergenic
958779445 3:98523077-98523099 GCGCCGCGCGCGGCGCATTGTGG + Intronic
961749674 3:129087884-129087906 GCGTCGCACTGGCCCCACCGAGG + Exonic
963234949 3:142947351-142947373 GCGCCGGGCTGGGCACGCCAAGG - Intergenic
971195805 4:24471179-24471201 GCCCCGCGGAGCGCGCACCGCGG - Intergenic
971473237 4:27049603-27049625 GCGCTGAGCTGGGCTCACCATGG - Intergenic
985580483 5:693226-693248 GCGCGGCGCGGGGGGCACCCGGG - Intronic
985595142 5:784616-784638 GCGCGGCGCGGGGGGCACCCGGG - Intergenic
985620587 5:952781-952803 GCCCCGGGCTGGGAGCACAGGGG + Intergenic
987132432 5:14871902-14871924 GGGCCGGGCCGGGCGCGCCGCGG + Intergenic
1002176062 5:177402184-177402206 GCGCGGAGCTGGCCGCACTGGGG + Exonic
1004924085 6:20402487-20402509 GCTCCGCGCCGGGGGCACTGGGG - Exonic
1007370974 6:41427038-41427060 GCGCCGCCCTGGACTCGCCGTGG - Intergenic
1007423955 6:41735162-41735184 GCCACGCGCTGGGCGCCCGGGGG + Intronic
1013793329 6:113859070-113859092 GCGCCGCGTTGGGCGCAGGCAGG - Intronic
1015625911 6:135181108-135181130 GCGGCGCGCTAGGCGCACCGCGG + Intergenic
1015654112 6:135497742-135497764 GCGGCGCGCTGTCCGCACTGCGG - Exonic
1015999666 6:139029548-139029570 GCGCGGGGCTGGGCCCCCCGTGG - Intronic
1019562640 7:1666088-1666110 CCGCCGCGCTCGGGGAACCGGGG + Intergenic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1031899429 7:127392835-127392857 GCGACGCGCTGTGCCCGCCGCGG + Intronic
1034147204 7:148884034-148884056 TCGCCGAGCGGGGCTCACCGGGG - Intronic
1034439624 7:151080108-151080130 GTGCTGCGCTGAGCGCACTGAGG - Intronic
1035168282 7:157004124-157004146 GCGCCGGGCTGGGTGGGCCGCGG + Intronic
1035169518 7:157009902-157009924 GCGCCGCCCTGCGCGCCCCCAGG + Exonic
1037273838 8:17156870-17156892 GCGCTGCGCTGGGGGCGCCGCGG - Intronic
1038176487 8:25185289-25185311 AACCCACGCTGGGCGCACCGGGG - Intronic
1038447620 8:27614853-27614875 GCACCGGGCTGGGGGCGCCGGGG + Exonic
1038450039 8:27633965-27633987 GCGCGGCGCTAGGCGCCCGGCGG + Intronic
1043147759 8:76678199-76678221 GCGCCGCGCTCCGCGCCCCGGGG + Intergenic
1044988701 8:97776406-97776428 GCCTCGCGTAGGGCGCACCGGGG + Intronic
1049108086 8:140625994-140626016 GGGCCTTGCTGGGCGCACCTTGG - Intronic
1049194542 8:141308166-141308188 GCGGAGCCCCGGGCGCACCGGGG + Intronic
1049614336 8:143569522-143569544 GTGCAGCGCTGGGCGCCCTGAGG - Exonic
1049708355 8:144052893-144052915 GCGCTGCCCTGCGCGCCCCGAGG + Exonic
1052807411 9:33025321-33025343 GCGCCGAGCTGTGCGCAGCCGGG - Exonic
1058687140 9:107489134-107489156 GCGCGGCGCTGGGAGCAGGGAGG - Intronic
1060480692 9:124015391-124015413 GCGCGGGGCTGGGCGCAGCAGGG + Exonic
1061061059 9:128250763-128250785 GGGCCGGGCTGGGGGCACGGCGG - Exonic
1062558696 9:137129487-137129509 GGACCGCGCCGGGCGGACCGAGG - Intergenic
1062571744 9:137188946-137188968 GCCCCGCGCCGGGCGCTCGGGGG + Intronic
1185621336 X:1452887-1452909 CAGCCGCGCTGCGCGCACCGCGG - Intronic
1187388953 X:18873380-18873402 GCGCCGCGCTGGGGGTAGTGAGG - Intergenic
1195625110 X:106999572-106999594 GAGCCGCGCGGGGCGGGCCGGGG - Intronic
1198750393 X:139932441-139932463 GCGCCGGGCTCGGCACCCCGCGG + Intronic