ID: 934540963

View in Genome Browser
Species Human (GRCh38)
Location 2:95174654-95174676
Sequence GCTCACCTAACCCAGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934540963_934540967 -4 Left 934540963 2:95174654-95174676 CCTCCCTGCTGGGTTAGGTGAGC 0: 1
1: 0
2: 0
3: 14
4: 142
Right 934540967 2:95174673-95174695 GAGCCTCTGAGGTGCTCTCATGG 0: 1
1: 0
2: 0
3: 24
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934540963 Original CRISPR GCTCACCTAACCCAGCAGGG AGG (reversed) Intronic
901080426 1:6580801-6580823 TCTCAGCGAAGCCAGCAGGGAGG - Exonic
901331196 1:8410171-8410193 GCCCTCCTTACCCAGCAGGCAGG - Intronic
901489718 1:9590378-9590400 TCTCAGCTAACCCAGGATGGGGG + Intronic
902958728 1:19945927-19945949 ACTCACCTAACCCAGATGGGTGG - Intergenic
903870657 1:26432140-26432162 GCTCACGTGACCGAGCGGGGCGG - Intergenic
904786118 1:32984325-32984347 GCTCAGCTCAGCCAGAAGGGAGG + Intergenic
905266990 1:36761149-36761171 GCTGACCTCACCCTGCATGGTGG + Intergenic
906530935 1:46523633-46523655 TTCCACCCAACCCAGCAGGGTGG - Intergenic
909375579 1:74937662-74937684 GTTCAAATAACCCAGGAGGGAGG + Intergenic
912259434 1:108095581-108095603 GAGCACCTAAGCCAGCAGAGTGG - Intergenic
913163411 1:116165474-116165496 GCTCATCTCACACAGCTGGGTGG - Intergenic
914814335 1:151052488-151052510 TCTCACCTGGGCCAGCAGGGAGG + Exonic
915051821 1:153083681-153083703 GCTGAGCTGAACCAGCAGGGAGG + Intergenic
915635774 1:157185530-157185552 GCTCACCACACACAGCAGTGTGG + Intergenic
915648313 1:157289594-157289616 GCTCACCACACACAGCAGTGTGG - Intergenic
915662359 1:157414906-157414928 GCTCACCACACACAGCAGTGTGG + Intergenic
916005225 1:160653752-160653774 CCTCATCTTACCCAGCAGGGTGG - Intergenic
917679412 1:177350749-177350771 CCTCACCCTGCCCAGCAGGGAGG - Intergenic
918342682 1:183580567-183580589 GCTTAGCCAACTCAGCAGGGAGG - Intronic
919642588 1:200059954-200059976 CGTCACCTAACCCAGCAGTTAGG + Intronic
919892166 1:201983180-201983202 CCTCACCTACCCCACCCGGGAGG + Intronic
920694880 1:208174592-208174614 GCTGACCTAAGCCATCAGAGTGG + Intronic
921821746 1:219624563-219624585 GCTGACCTCACCCAGCAGGTAGG + Intergenic
922701169 1:227761986-227762008 GCCCTCCTAGCCGAGCAGGGAGG - Intronic
923292546 1:232560571-232560593 GGTCACCTTGCCCAGCAGGGAGG + Intronic
1064019803 10:11799868-11799890 GCTCGCCGAAGCCAGCAGCGTGG + Intergenic
1067081798 10:43216414-43216436 CCTCACCTTACCCTGCGGGGAGG + Intronic
1073193356 10:101668143-101668165 GCTCACCTACCCCCGCAGATAGG + Intronic
1074434824 10:113425088-113425110 GCTCTCCTGACACAGCGGGGAGG + Intergenic
1076057127 10:127384811-127384833 GCCCACCTCACCCAGCGGGACGG + Exonic
1076769787 10:132656667-132656689 GCTCACCTGGCCCAGCTGGCTGG - Intronic
1077206256 11:1346283-1346305 CCTCACCCACCCCAGCAGCGCGG - Intergenic
1084117420 11:67050298-67050320 GCTCACCCAGGCCAGCAGGTGGG + Exonic
1090066165 11:123505347-123505369 GTTCACCTAAAACAGCAGGTGGG + Intergenic
1090226182 11:125073464-125073486 GCTCCCCTAACAGAGCAGTGTGG + Intronic
1090261828 11:125326883-125326905 GCTCACCCCCGCCAGCAGGGAGG + Intronic
1090383908 11:126345483-126345505 GATCACCTCAGCCAGCAGGTGGG - Exonic
1101236274 12:102793386-102793408 CCTCTCCTAAGCCAGCAGGCGGG + Intergenic
1101427316 12:104598823-104598845 GCCCACCCCACCCACCAGGGTGG - Intronic
1104674127 12:130701255-130701277 GCCCCCCTAACACAGCGGGGTGG + Intronic
1109504937 13:63287560-63287582 GCACACCTACCCCAACAGGCAGG - Intergenic
1110241043 13:73267208-73267230 GCTTTCCTAACCCACAAGGGAGG + Intergenic
1118978284 14:70695861-70695883 GCTCACCTAACCCATCTGCCTGG - Intergenic
1121743803 14:96272119-96272141 TTTCACCTAACCCATCAGTGGGG - Intergenic
1122112087 14:99510170-99510192 CCTCACCTAAGGCAGCAGCGAGG - Exonic
1122987655 14:105219940-105219962 GCCCACTTCACCCAGCGGGGTGG + Intronic
1123689726 15:22827910-22827932 GCTCAGCTAACCCAGAAGAGGGG + Exonic
1124037681 15:26071032-26071054 GCACACCTAACCCATCCCGGAGG - Intergenic
1124492770 15:30168251-30168273 TCTCATCTAACCCACCTGGGAGG + Intergenic
1124750764 15:32370074-32370096 TCTCATCTAACCCACCTGGGAGG - Intergenic
1125185485 15:36924929-36924951 ACTCACCTACTCCAGAAGGGAGG - Intronic
1125417347 15:39467375-39467397 GGTCACATCCCCCAGCAGGGGGG - Intergenic
1126800845 15:52295492-52295514 GCGCACCTGACACGGCAGGGCGG - Intronic
1128150672 15:65361796-65361818 GCGCCCCTACCCCAGCACGGCGG - Intronic
1129737392 15:77973912-77973934 GCTCACCCATCCCAGCCAGGGGG - Intergenic
1129848681 15:78779713-78779735 GCTCACCCATCCCAGCCAGGGGG + Intronic
1130253238 15:82314233-82314255 GCTCACCCATCCCAGCCAGGGGG - Intergenic
1130763942 15:86851346-86851368 GCCCACCTAACCCTGTAGGAGGG + Intronic
1131035247 15:89217870-89217892 GTTCTCCTGACCCAGCAGAGGGG - Intronic
1132662092 16:1066113-1066135 GCTCCCCAAGCCCAGCAGGTGGG - Intergenic
1132717763 16:1300746-1300768 CCTCACCCCACCCAGCAGGAGGG - Intergenic
1133384914 16:5361762-5361784 GCTCACCTGAGACAGCTGGGTGG - Intergenic
1135654518 16:24236034-24236056 GCTCACCCACCCCAGCAGCCTGG + Intergenic
1136527894 16:30844530-30844552 GCTCATTTAACCCACCAGTGTGG - Intronic
1137611070 16:49817999-49818021 GCTCACCATGCCCAGCAGTGGGG - Intronic
1140212123 16:72978598-72978620 GCTCTCCTAGGCCAGCAGCGTGG - Intronic
1141523058 16:84594266-84594288 ACCCACCTAGCCCATCAGGGTGG + Intronic
1142222850 16:88864042-88864064 GGTCACCTCTCCCAGCAGAGAGG + Intronic
1142508311 17:379954-379976 TCTCCCCAGACCCAGCAGGGTGG + Intronic
1142985355 17:3691827-3691849 GCTCCCCGAAGCCAGCAGAGTGG - Intronic
1142992317 17:3739636-3739658 CCTCAGCTACCCCAGAAGGGAGG - Intronic
1144840917 17:18185008-18185030 GCTCAGGTAACCCACCCGGGTGG + Exonic
1149784548 17:59424039-59424061 TCTCACCAACCCCAGCAGGTGGG + Intergenic
1151942957 17:77304420-77304442 TCTCTCCAAACCCAGCATGGGGG - Intronic
1152230818 17:79113168-79113190 GGACACCTGAGCCAGCAGGGAGG + Intronic
1152251760 17:79216177-79216199 GCTCTCCCCACCCAGCTGGGGGG - Intronic
1155808722 18:30205855-30205877 GCTGACCTACCCCAACAGGGAGG + Intergenic
1160014147 18:75127768-75127790 GAGCACCCAACCCAGCAGGGAGG - Intergenic
926174311 2:10575704-10575726 GCTCACTCAACCCAGCAGAGGGG + Intronic
929045246 2:37782907-37782929 GCTCACCCATCCCAGGAGCGGGG + Intergenic
934540963 2:95174654-95174676 GCTCACCTAACCCAGCAGGGAGG - Intronic
936278676 2:111120598-111120620 GCTCACCTACCCCAACCCGGCGG - Intronic
936427610 2:112434340-112434362 GGTCTCCAATCCCAGCAGGGAGG + Intronic
942073444 2:172335814-172335836 CAGCACCTAACCCAGGAGGGTGG - Intergenic
946364976 2:219243461-219243483 GCTCACCGCACCCGGCAGGCTGG + Intronic
946640876 2:221782410-221782432 GCTCACTTGGCCCAGCAGGTGGG - Intergenic
947590624 2:231383182-231383204 TCTCCCCTAACTCAGCATGGAGG + Intergenic
948387723 2:237591889-237591911 GCTCCCCCAACCCTGCAGGAAGG - Exonic
948929666 2:241123951-241123973 GCTCACCGGACCCAGCCTGGTGG - Exonic
1170098592 20:12674111-12674133 GCTAATCTAACCCAACATGGAGG + Intergenic
1174355913 20:49997903-49997925 ACTCACCAAACCCTGCAGGAGGG + Intergenic
1175326841 20:58135489-58135511 CCTCAGGTAAGCCAGCAGGGAGG + Intergenic
1175569942 20:60010817-60010839 GCTCACGTCACACATCAGGGTGG + Intronic
1175716820 20:61260571-61260593 GCTCACCCAAGCCACCAGTGGGG - Intronic
1175860618 20:62148301-62148323 CCTCACCTAAGACAGCAAGGAGG - Intronic
1175860649 20:62148444-62148466 CCTCACCTAAGACAGCAAGGAGG - Intronic
1175860672 20:62148550-62148572 CCTCACCTAAGACAGCAAGGAGG - Intronic
1175893119 20:62324015-62324037 GCTCCCTTCACCCAGCAGCGGGG - Intronic
1175962523 20:62644299-62644321 GCTGACCTTGCCCAGCAGGAAGG - Intronic
1176374621 21:6080867-6080889 GGTCTCCAATCCCAGCAGGGAGG - Intergenic
1179044394 21:37831725-37831747 GCTCAGCTCACCCTGCAGGAGGG + Intronic
1179151204 21:38809720-38809742 GCCCTGCTAACCCAGCAAGGAGG + Intronic
1179748854 21:43457378-43457400 GGTCTCCAATCCCAGCAGGGAGG + Intergenic
1180935420 22:19622197-19622219 CCTCACCAAACCCTGCAGAGAGG - Intergenic
1182756423 22:32683298-32683320 GATCACCTACCCCAGGAAGGGGG - Intronic
1183298173 22:37044287-37044309 GCTCCCTTCAGCCAGCAGGGTGG - Intergenic
1183324261 22:37183022-37183044 CTTCCCCTCACCCAGCAGGGAGG + Intronic
955324992 3:58003166-58003188 GCTCATTTCACCTAGCAGGGAGG + Intergenic
959090613 3:101898968-101898990 GCTAAACGGACCCAGCAGGGTGG - Intergenic
959469815 3:106736633-106736655 GCTCACCTTCCCCAGAAGAGTGG + Intergenic
962933191 3:140056354-140056376 GGTCACCTAACCCAGAGTGGGGG - Intronic
963810591 3:149772818-149772840 GCCCTCCTAACCGAGCAGGTTGG + Intronic
968516313 4:1017095-1017117 GCTCACCTTGACCAGAAGGGAGG - Intronic
969439512 4:7208894-7208916 GCTCACCTAGCCCTGCTGGGGGG + Intronic
970184161 4:13431405-13431427 TCTCACCAACCCCATCAGGGTGG + Intronic
971066140 4:23035445-23035467 GCTCACCTAAATCAGCAGCCTGG - Intergenic
975762483 4:77632975-77632997 GTTCACCTACCCTTGCAGGGTGG - Intergenic
978016505 4:103752599-103752621 GTTCGCCTACCCCTGCAGGGCGG + Intergenic
981531062 4:145754060-145754082 GCTGAGTTAACCCAGCAGGGTGG + Intronic
982712176 4:158768865-158768887 GCTCACGTAACCCCGGCGGGAGG - Intergenic
985637916 5:1048952-1048974 GCTCACAAATTCCAGCAGGGAGG - Intergenic
988139441 5:27217589-27217611 ACTCACCTAAGTCTGCAGGGTGG - Intergenic
999742413 5:154566295-154566317 GCTCAGCCAAACCAGCAAGGAGG - Intergenic
1003459541 6:6317689-6317711 GCTCACCTATCCCAGCAAATAGG + Intronic
1008507859 6:52248021-52248043 TCTCACTTATCCCAGCAGGCTGG - Intergenic
1010723584 6:79309921-79309943 GTTCACCTACCCTTGCAGGGTGG - Intergenic
1012976724 6:105787780-105787802 GCAAACCAAACCCAGCAGGTTGG + Intergenic
1013593974 6:111644862-111644884 GCTCATCAAACCCAACAGGGTGG + Intergenic
1015910179 6:138161862-138161884 GCGCACCTGACCCAGGCGGGCGG + Intergenic
1016007612 6:139105547-139105569 ATTAACCTAACCCAGCATGGTGG + Intergenic
1017111666 6:150938599-150938621 GCTCCCCAAACCCAACAGAGAGG - Intronic
1019750312 7:2725096-2725118 GCTCGCAGAACCCAGCAGGAGGG - Intronic
1019774189 7:2902534-2902556 TCTCACCCAACCCAGGAAGGGGG - Intergenic
1023932276 7:44713201-44713223 GCTCACCTTCCCCAGCAGTCTGG + Intergenic
1025007241 7:55364198-55364220 GCTCTCCCTACCCAGGAGGGAGG - Intergenic
1032640763 7:133764739-133764761 CATCAGCTAACCCAGCTGGGAGG + Intronic
1033645983 7:143304767-143304789 GCTCACCTTAACCAGCATGTCGG - Exonic
1034548510 7:151805151-151805173 TCTCACCTAACCCAGAAGTCAGG - Intronic
1034948084 7:155277008-155277030 GCCTTCCAAACCCAGCAGGGAGG + Intergenic
1035530341 8:345992-346014 GCTCACCTGACCATGGAGGGTGG - Intergenic
1038452587 8:27649489-27649511 GCTCTCCTCACCCAGAGGGGTGG + Intronic
1038997890 8:32945758-32945780 GCCCACCTTCCCCAGCAGTGGGG - Intergenic
1048831732 8:138484069-138484091 GCTCATCTGAGCAAGCAGGGAGG + Intronic
1049110743 8:140641201-140641223 GATCACCTAAGCCCTCAGGGAGG + Intergenic
1050042504 9:1510904-1510926 ACTCACCTAGCCCAGCAGGTAGG + Intergenic
1052665394 9:31488411-31488433 GCTAACCTAACCCAAAAGGGAGG - Intergenic
1054762078 9:69012892-69012914 GCTCCCCCAACCCTGGAGGGTGG + Exonic
1056773547 9:89496574-89496596 GCTCAGCATACCCACCAGGGAGG - Intronic
1060209165 9:121699645-121699667 ACTCACCTAACCCCGGAGGGAGG - Intronic
1061253451 9:129439793-129439815 GGGCACCTGACTCAGCAGGGAGG + Intergenic
1061284902 9:129616647-129616669 ACTCACCAAACCCAGGAGGATGG - Intronic
1062673840 9:137728144-137728166 GCTGACCTAACCCATCTGAGGGG + Intronic
1193021922 X:76800795-76800817 GTTCACCTACCCTTGCAGGGTGG + Intergenic
1196810786 X:119627551-119627573 GCAGAACTAAGCCAGCAGGGAGG + Intronic
1199274209 X:145922979-145923001 GGTCCCCTGACCCAGCATGGAGG + Intergenic
1199552971 X:149077886-149077908 GTTCACCTACCCTTGCAGGGTGG + Intergenic
1201967643 Y:19755187-19755209 GCTCTCCTAAACCTGCAGGCTGG + Intergenic