ID: 934541135

View in Genome Browser
Species Human (GRCh38)
Location 2:95176042-95176064
Sequence GGTCTAAGTAAAGCAAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 157}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934541135_934541136 -10 Left 934541135 2:95176042-95176064 CCTGGCTTTGCTTTACTTAGACC 0: 1
1: 0
2: 0
3: 7
4: 157
Right 934541136 2:95176055-95176077 TACTTAGACCCCCTTTTGTAAGG 0: 1
1: 0
2: 0
3: 4
4: 56
934541135_934541138 -2 Left 934541135 2:95176042-95176064 CCTGGCTTTGCTTTACTTAGACC 0: 1
1: 0
2: 0
3: 7
4: 157
Right 934541138 2:95176063-95176085 CCCCCTTTTGTAAGGTATTGAGG 0: 1
1: 0
2: 0
3: 7
4: 73
934541135_934541142 15 Left 934541135 2:95176042-95176064 CCTGGCTTTGCTTTACTTAGACC 0: 1
1: 0
2: 0
3: 7
4: 157
Right 934541142 2:95176080-95176102 TTGAGGATGACATATCCCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 70
934541135_934541143 29 Left 934541135 2:95176042-95176064 CCTGGCTTTGCTTTACTTAGACC 0: 1
1: 0
2: 0
3: 7
4: 157
Right 934541143 2:95176094-95176116 TCCCCCTGGTATGTGCTTCATGG 0: 1
1: 0
2: 1
3: 9
4: 101
934541135_934541145 30 Left 934541135 2:95176042-95176064 CCTGGCTTTGCTTTACTTAGACC 0: 1
1: 0
2: 0
3: 7
4: 157
Right 934541145 2:95176095-95176117 CCCCCTGGTATGTGCTTCATGGG 0: 1
1: 0
2: 0
3: 10
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934541135 Original CRISPR GGTCTAAGTAAAGCAAAGCC AGG (reversed) Intronic
901037216 1:6343543-6343565 GGTCACAGTAAAGCGATGCCTGG + Intronic
904348522 1:29889928-29889950 GGACTAGCTAAAGCAGAGCCAGG + Intergenic
905956006 1:41996646-41996668 GGGCTAAGTCAGGAAAAGCCTGG - Intronic
906808986 1:48807358-48807380 GTTATAAGAAAAGCAAAGCATGG - Intronic
908271324 1:62425303-62425325 GGTCTAGCTAAAACAAGGCCAGG - Intergenic
908922190 1:69208920-69208942 TATCTTAGTATAGCAAAGCCTGG + Intergenic
911839657 1:102664500-102664522 GGTCAAAATAAAGCCCAGCCAGG - Intergenic
912018121 1:105068066-105068088 TCTCCAAGTAAAGAAAAGCCTGG - Intergenic
915904418 1:159867399-159867421 GGACTGAGAAGAGCAAAGCCAGG + Intronic
915996494 1:160569202-160569224 GGGCTAATTCAAGTAAAGCCTGG + Intronic
916823886 1:168426220-168426242 GTTCTCTGTAAAGCCAAGCCTGG - Intergenic
919430163 1:197482667-197482689 GAACCATGTAAAGCAAAGCCTGG - Intergenic
920018502 1:202934142-202934164 TCTCTCAGTAAAGAAAAGCCTGG - Intergenic
920533845 1:206724310-206724332 GGGCTAAGTAAAGAACAGCAGGG - Intronic
921649259 1:217657407-217657429 GGTTTTAGAAAAACAAAGCCAGG + Intronic
922539942 1:226410984-226411006 GGCCTAAGTAATGCAAAGAATGG - Intergenic
923909993 1:238430926-238430948 GGTGGAAGGAAGGCAAAGCCGGG - Intergenic
923976460 1:239270122-239270144 AGTCTAAGGAAAGCCCAGCCTGG + Intergenic
1063079527 10:2752390-2752412 GCTCTAACTAAAGCAATGGCTGG + Intergenic
1063350710 10:5352245-5352267 GGTCTTTGGAAACCAAAGCCAGG - Intergenic
1066171171 10:32848344-32848366 GGTCAAAGTAAAATAAAGCTGGG + Intronic
1070046443 10:72842049-72842071 GCTCTGAGTAAGGTAAAGCCAGG + Intronic
1070635645 10:78125140-78125162 GGTGTCAGTAAAGCAAATGCAGG + Intergenic
1071888830 10:89980401-89980423 GCTCTAAGGAAAGGAAAGTCAGG + Intergenic
1072536193 10:96365394-96365416 GGTCTAGCAAAAGCTAAGCCTGG - Exonic
1075203428 10:120425749-120425771 GGGCTAAGTCAACCAAAGGCAGG - Intergenic
1076050942 10:127332670-127332692 GGGCAAAGTAATGCAAAGCTGGG - Intronic
1076892285 10:133291171-133291193 GGTCTCAGGAAAGCACACCCCGG - Intronic
1077846074 11:6026314-6026336 GGTCAAAGGAAAGCAAAGGCTGG + Intergenic
1081358717 11:42145309-42145331 TGCATAAGTAAAGAAAAGCCAGG - Intergenic
1081958020 11:47110649-47110671 GCCCTAAGGAAAGCAAAGCCAGG - Intronic
1082026053 11:47573110-47573132 GGCCTCAGGAAGGCAAAGCCGGG + Exonic
1082773501 11:57227889-57227911 GGTCCACGTAGAGTAAAGCCTGG + Intergenic
1082785039 11:57312076-57312098 GGGCAAAGGAAAGCAGAGCCAGG + Intronic
1083768176 11:64852286-64852308 GGTTTAAGTACAGGGAAGCCGGG - Exonic
1085639044 11:78179750-78179772 GGTCTAGGGACAGCAAAGGCAGG - Intronic
1088402883 11:109440638-109440660 GGCGTAAGTAGATCAAAGCCAGG + Intergenic
1089653917 11:119933356-119933378 GAGCAAAGCAAAGCAAAGCCAGG + Intergenic
1091306254 11:134538141-134538163 GGAGTAAGTCAAGCCAAGCCTGG - Intergenic
1093393719 12:18654630-18654652 GGTAAAAGTAAAGCAAAGAGAGG + Intergenic
1094258876 12:28468454-28468476 TCTCTCAGTAAAGAAAAGCCTGG + Intronic
1095807617 12:46337676-46337698 TGTCCCAGCAAAGCAAAGCCCGG - Intergenic
1096512864 12:52141380-52141402 GGTCTCAGCAAAGGAAAGCCAGG + Intergenic
1105559975 13:21481077-21481099 GATCGAAGTAGAGAAAAGCCTGG + Intergenic
1107807530 13:44168245-44168267 TCTCTCAGTAAAGAAAAGCCGGG - Intergenic
1113379857 13:109794153-109794175 GGCTTGAGTAAAGCAAAGCCAGG - Intergenic
1116752984 14:48910185-48910207 GTTCTAAGTAAAGGGAAGTCAGG + Intergenic
1117158970 14:52969272-52969294 TATCTCAGTAAAGAAAAGCCTGG - Intergenic
1119104828 14:71914104-71914126 AGTCTCAGAGAAGCAAAGCCAGG - Intergenic
1119210671 14:72829332-72829354 GTTGTAAGTAAGGCAATGCCTGG - Intronic
1120436819 14:84493148-84493170 GGGTTGAATAAAGCAAAGCCAGG + Intergenic
1122879185 14:104682401-104682423 GGGCTAAGCAAAGCCAAGACTGG + Intergenic
1124091194 15:26603270-26603292 TCTCTCAGTAAAGAAAAGCCTGG + Intronic
1124248739 15:28094296-28094318 GGGCCCAATAAAGCAAAGCCAGG - Intronic
1124952940 15:34340255-34340277 GATCCAAGAAAAGCAAAGTCTGG + Intergenic
1125782795 15:42285460-42285482 GGTCTAAGGAAAGTAGAGCCTGG + Intronic
1129456779 15:75680238-75680260 GGTCTAAGGGGAGCAGAGCCTGG + Intronic
1137494998 16:48962725-48962747 GGTATAAGTGAAGCATGGCCTGG + Intergenic
1139017230 16:62705130-62705152 GTTCTAATTAGAGAAAAGCCAGG - Intergenic
1142413114 16:89926137-89926159 GGCCCCAGGAAAGCAAAGCCCGG - Intronic
1147502693 17:40980784-40980806 GCTCCAAGCACAGCAAAGCCTGG - Exonic
1147808828 17:43152185-43152207 TGGCTCAGTAGAGCAAAGCCAGG - Intergenic
1147857957 17:43497131-43497153 GGTAAAACTAAAGAAAAGCCAGG - Intronic
1149114817 17:53080457-53080479 GAACTAAGTAAAGTAAAGGCAGG + Intergenic
1150375550 17:64678588-64678610 GGTCAATGTAAGGCAAAACCAGG - Intergenic
1150745299 17:67811887-67811909 TGGCTCAGTAGAGCAAAGCCAGG + Intergenic
1156480367 18:37432511-37432533 GGACCAAGCAAAGCAAATCCTGG + Intronic
1166247274 19:41538121-41538143 GGTCTGAGGAATTCAAAGCCAGG + Intergenic
1167998184 19:53423665-53423687 TATCTAAGCAAAGCAAAGCTTGG - Intronic
1168007665 19:53504259-53504281 TATCTAAGCAAAGCAAAGCTTGG - Intergenic
1168636115 19:57998871-57998893 GGTATAAGGAAATCAAAGCAGGG - Intronic
927599974 2:24432148-24432170 GGTGGCAGTAGAGCAAAGCCAGG - Intergenic
928273457 2:29877869-29877891 GTTCCCAGTAAAGCAAAGGCAGG + Intronic
932021922 2:68096036-68096058 GGTCTAAGAAAAGAAAAGGAAGG + Intronic
934541135 2:95176042-95176064 GGTCTAAGTAAAGCAAAGCCAGG - Intronic
939513155 2:143132306-143132328 AGTCTAAGGATAGCAAAGTCAGG + Intronic
940304355 2:152209766-152209788 AGTCTAAATAAAGCAAAATCTGG - Intergenic
941186650 2:162327157-162327179 GGCCTAAGGAATCCAAAGCCAGG - Intronic
945230136 2:207579579-207579601 GATCTCAGGCAAGCAAAGCCTGG - Intronic
948681551 2:239638547-239638569 GGTCTGAGTAAGTCAATGCCTGG + Intergenic
1169617628 20:7467403-7467425 TCTCCAAGTAAAGAAAAGCCTGG - Intergenic
1170236378 20:14109760-14109782 TCTCTCAGTAAAGAAAAGCCTGG + Intronic
1170801373 20:19593279-19593301 GGGCTAATTGAACCAAAGCCAGG + Intronic
1172511381 20:35503512-35503534 GGCCCAAGTAAAGCACAGCGCGG + Exonic
1174143371 20:48432755-48432777 GGTGAAAATAAAGCCAAGCCTGG - Intergenic
1176947992 21:15007282-15007304 GGTCAAAATAAGGCAAAGGCAGG + Intronic
1177168070 21:17625070-17625092 GGTCTAGGTAGGGCAAATCCAGG - Intergenic
1180098163 21:45570797-45570819 GCTCTCAATAAAGCGAAGCCAGG + Intergenic
1180193924 21:46182476-46182498 GGTCTGAGTAAAGCAAGACCAGG - Intronic
1182427400 22:30282038-30282060 GGTATAAAAAAAGCATAGCCAGG - Intergenic
949523084 3:4874570-4874592 GGTTTAAGAAAAACAATGCCAGG - Intronic
949809680 3:7992838-7992860 TCTCTCAGTAAAGAAAAGCCCGG + Intergenic
949935313 3:9111460-9111482 GAACTAAGTAAAGAACAGCCTGG + Intronic
951923182 3:27878094-27878116 GCTTGAAGTAAAGCAAAGACAGG - Intergenic
953638787 3:44686111-44686133 GGACTAACTAAAACAGAGCCAGG + Intergenic
955501881 3:59593403-59593425 GGTATAGGTAAAGCTAAGCAGGG + Intergenic
956345285 3:68271331-68271353 AGTGTGAGTAAGGCAAAGCCAGG - Intronic
957907227 3:86573114-86573136 TGTTTCAGTAAAGAAAAGCCTGG - Intergenic
958822970 3:98997443-98997465 GTTCTCAGTAATGCAAAGTCAGG - Intergenic
959084482 3:101836401-101836423 GTGCTAAGAAAAGCAAAGCAAGG - Intronic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
962977704 3:140459938-140459960 GCTCTACGTCAAGCCAAGCCTGG - Intronic
963297312 3:143559995-143560017 GCTGTAAATTAAGCAAAGCCTGG - Intronic
964074008 3:152671262-152671284 GGGCTAAGCAAAACAAAGCCAGG - Intergenic
965419421 3:168438512-168438534 GGTCTAAGTAAATCTAAGAATGG + Intergenic
966274706 3:178151506-178151528 TGTCCAAGAACAGCAAAGCCAGG - Intergenic
970722531 4:19004840-19004862 GGTCACAGAAAAGCAAAGCTGGG + Intergenic
973118716 4:46491507-46491529 AGTCTTAGTAAGGAAAAGCCTGG - Intergenic
974882343 4:67775048-67775070 GGGATAAGTAAAGCAGATCCCGG + Intergenic
977522044 4:98096984-98097006 TATCTCAGTAAAGAAAAGCCTGG + Intronic
979569285 4:122198657-122198679 GGTCTAAGGAAAGCCCAGTCAGG + Intronic
980044513 4:127973015-127973037 GGTCTAAGAAAAGAAAAGAAAGG - Intronic
980716685 4:136637759-136637781 GGTCTCAGGAATCCAAAGCCAGG + Intergenic
984529379 4:180897578-180897600 TGTCCCAGTAAAGAAAAGCCTGG - Intergenic
992870084 5:80996894-80996916 AGGCTTAGTAAAGCAAAGTCAGG + Intronic
993943975 5:94096606-94096628 CTTCTAAGCAAAGCAAAGCTTGG + Intronic
993948699 5:94146985-94147007 TCTCTCAGTAAAGAAAAGCCTGG + Intergenic
995391480 5:111645106-111645128 GGACTCAGTGAAGAAAAGCCTGG + Intergenic
998533709 5:142909508-142909530 GGCTTAAGTAAAAGAAAGCCAGG - Intronic
999647744 5:153735815-153735837 GGTCTCAGTAATGCAAAGAATGG + Intronic
1001177931 5:169489922-169489944 TCTCTCAGTAAAGAAAAGCCTGG + Intergenic
1008277386 6:49557502-49557524 GCTCTAAGAAAAGGAAAGTCAGG - Intronic
1008707141 6:54176366-54176388 TCTCCCAGTAAAGCAAAGCCCGG - Intronic
1009371561 6:62909883-62909905 CCTCCAAGTAAAGAAAAGCCTGG + Intergenic
1009720079 6:67457203-67457225 ATTCTAGGTAAAGCAAAGCAAGG - Intergenic
1011546358 6:88486010-88486032 GGTTTTAGCAAACCAAAGCCAGG - Intergenic
1012513122 6:100027297-100027319 GGTGGAAGTAAGGCAAAGTCTGG + Intergenic
1012827807 6:104167565-104167587 TCTCCAAGTAAAGAAAAGCCTGG + Intergenic
1014699797 6:124670774-124670796 GGTGTCAGTGAAACAAAGCCAGG - Intronic
1015445355 6:133297567-133297589 GGTGTTAGTAAGGCAAAACCAGG - Intronic
1016849231 6:148600293-148600315 GCTCTAAGAAAAGGAAAGTCAGG + Intergenic
1018536141 6:164822011-164822033 GTTCCCAGTAAAGAAAAGCCTGG + Intergenic
1018603052 6:165566634-165566656 GGTGTAGATAGAGCAAAGCCAGG + Intronic
1018749887 6:166795159-166795181 GGTATTAATAAAGCAAAACCTGG + Intronic
1020975173 7:14997327-14997349 GATTTATGCAAAGCAAAGCCTGG - Intergenic
1021999295 7:26209681-26209703 GACATAAGTAAAGCAAAGACTGG - Intronic
1022891267 7:34702316-34702338 CGTCTAAGTGAAAAAAAGCCTGG + Intronic
1024652500 7:51417530-51417552 TGTATTGGTAAAGCAAAGCCAGG - Intergenic
1024956817 7:54930507-54930529 TCTCTCAGTAAAGCAAAGTCTGG + Intergenic
1030278478 7:107744466-107744488 GGGCTAAATAAAACAGAGCCGGG - Intronic
1031751963 7:125586261-125586283 GCTCTAAGTAAAGAGAAGCATGG + Intergenic
1036585619 8:10120692-10120714 CGTATAATTAAAGCGAAGCCTGG + Intronic
1039691854 8:39872659-39872681 GTTCTCTGGAAAGCAAAGCCAGG + Intergenic
1046455406 8:114453435-114453457 GCTCTAAGAAAAGGAAAGTCAGG - Intergenic
1046806739 8:118487062-118487084 GGTCCAAGTAGGGCAAAGACGGG + Intronic
1051837530 9:21358109-21358131 GTTCTAAGAAAAGCAATTCCTGG + Intergenic
1055692867 9:78852360-78852382 GGACAAAGAAAAGCAAACCCAGG + Intergenic
1057247028 9:93465269-93465291 GATTTAAGTCAAGGAAAGCCTGG - Intronic
1057513913 9:95704824-95704846 TGTCTAAGCAAAGCATTGCCTGG - Intergenic
1060701154 9:125749005-125749027 TGTCTAAGTAAAACAAAGTTCGG - Intronic
1186691945 X:11986916-11986938 TCTCCAAGTAAAGAAAAGCCTGG + Intergenic
1188524589 X:31075332-31075354 GGTCTGAGTAAAGTTAACCCTGG + Intergenic
1189976576 X:46466415-46466437 GGGATAAATATAGCAAAGCCTGG - Intronic
1193889627 X:87028756-87028778 GTTATAAGTAAATCAAAGGCAGG + Intergenic
1194274520 X:91862227-91862249 CCTCTCAGTAAAGAAAAGCCTGG - Intronic
1194568775 X:95526732-95526754 TGTTCAAGTAAAGAAAAGCCTGG + Intergenic
1194749200 X:97665737-97665759 GCTCTCAGCAAGGCAAAGCCTGG + Intergenic
1194964809 X:100275542-100275564 GAAGTAATTAAAGCAAAGCCTGG + Intergenic
1195136697 X:101914711-101914733 ATTCTCAGTAAAGAAAAGCCCGG + Intronic
1195807336 X:108789781-108789803 TTTCTCAGTAAAGAAAAGCCTGG - Intergenic
1195848857 X:109260562-109260584 TGTCACAGTAAAGAAAAGCCTGG - Intergenic
1197076045 X:122353990-122354012 TGTCCCAGTAAAGAAAAGCCTGG + Intergenic
1199143038 X:144334272-144334294 GGTCAAAGGAATCCAAAGCCAGG - Intergenic
1199211202 X:145213393-145213415 AGTCTAAGTAAACCATAGCAGGG + Intergenic
1200591759 Y:5083633-5083655 CCTCTCAGTAAAGAAAAGCCTGG - Intronic