ID: 934542572

View in Genome Browser
Species Human (GRCh38)
Location 2:95188263-95188285
Sequence CAAGAACACCAGGTCCACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934542565_934542572 -1 Left 934542565 2:95188241-95188263 CCAAGAACTTTCCCTCAACCCAC No data
Right 934542572 2:95188263-95188285 CAAGAACACCAGGTCCACATGGG No data
934542564_934542572 12 Left 934542564 2:95188228-95188250 CCACTGCTCTAAGCCAAGAACTT No data
Right 934542572 2:95188263-95188285 CAAGAACACCAGGTCCACATGGG No data
934542563_934542572 19 Left 934542563 2:95188221-95188243 CCATATTCCACTGCTCTAAGCCA No data
Right 934542572 2:95188263-95188285 CAAGAACACCAGGTCCACATGGG No data
934542562_934542572 25 Left 934542562 2:95188215-95188237 CCTTCTCCATATTCCACTGCTCT No data
Right 934542572 2:95188263-95188285 CAAGAACACCAGGTCCACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934542572 Original CRISPR CAAGAACACCAGGTCCACAT GGG Intergenic
No off target data available for this crispr