ID: 934544028

View in Genome Browser
Species Human (GRCh38)
Location 2:95199777-95199799
Sequence GTATAGCCCTTCAATAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934544021_934544028 -8 Left 934544021 2:95199762-95199784 CCCCCACAACCCACTGTATAGCC No data
Right 934544028 2:95199777-95199799 GTATAGCCCTTCAATAAGGCTGG No data
934544016_934544028 16 Left 934544016 2:95199738-95199760 CCCAGCCACTCCTAGGGAAGCCA No data
Right 934544028 2:95199777-95199799 GTATAGCCCTTCAATAAGGCTGG No data
934544018_934544028 11 Left 934544018 2:95199743-95199765 CCACTCCTAGGGAAGCCAGCCCC No data
Right 934544028 2:95199777-95199799 GTATAGCCCTTCAATAAGGCTGG No data
934544022_934544028 -9 Left 934544022 2:95199763-95199785 CCCCACAACCCACTGTATAGCCC No data
Right 934544028 2:95199777-95199799 GTATAGCCCTTCAATAAGGCTGG No data
934544023_934544028 -10 Left 934544023 2:95199764-95199786 CCCACAACCCACTGTATAGCCCT No data
Right 934544028 2:95199777-95199799 GTATAGCCCTTCAATAAGGCTGG No data
934544019_934544028 6 Left 934544019 2:95199748-95199770 CCTAGGGAAGCCAGCCCCCACAA No data
Right 934544028 2:95199777-95199799 GTATAGCCCTTCAATAAGGCTGG No data
934544020_934544028 -4 Left 934544020 2:95199758-95199780 CCAGCCCCCACAACCCACTGTAT No data
Right 934544028 2:95199777-95199799 GTATAGCCCTTCAATAAGGCTGG No data
934544017_934544028 15 Left 934544017 2:95199739-95199761 CCAGCCACTCCTAGGGAAGCCAG No data
Right 934544028 2:95199777-95199799 GTATAGCCCTTCAATAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934544028 Original CRISPR GTATAGCCCTTCAATAAGGC TGG Intergenic
No off target data available for this crispr