ID: 934546207

View in Genome Browser
Species Human (GRCh38)
Location 2:95218820-95218842
Sequence GCATAGGTGTGGAGAGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 282}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934546202_934546207 13 Left 934546202 2:95218784-95218806 CCCTCTCACTGTGTTCTCACATG 0: 29
1: 305
2: 831
3: 1774
4: 2776
Right 934546207 2:95218820-95218842 GCATAGGTGTGGAGAGAAATTGG 0: 1
1: 0
2: 4
3: 28
4: 282
934546203_934546207 12 Left 934546203 2:95218785-95218807 CCTCTCACTGTGTTCTCACATGA 0: 1
1: 2
2: 25
3: 108
4: 418
Right 934546207 2:95218820-95218842 GCATAGGTGTGGAGAGAAATTGG 0: 1
1: 0
2: 4
3: 28
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934546207 Original CRISPR GCATAGGTGTGGAGAGAAAT TGG Intronic
900157859 1:1210769-1210791 GCGTAGGTGTGGAGGGGAAGAGG + Intergenic
900880768 1:5379828-5379850 GCATAGTTGTGGACAGGAGTGGG - Intergenic
901478375 1:9506446-9506468 CCATGGGTGTGGAAGGAAATGGG - Intergenic
903246470 1:22019458-22019480 GCCCATGTGTGGAGAGAACTGGG - Intergenic
903529793 1:24021451-24021473 GCATATTTGTGGGGGGAAATAGG - Intergenic
905066787 1:35191896-35191918 GCGTAGGTTTGGAGAGAACCGGG - Intronic
905854871 1:41303219-41303241 GCATTGTTGTGGAGAAGAATTGG + Intergenic
906259851 1:44378566-44378588 GTATAGGGCTGGACAGAAATAGG - Intergenic
906615279 1:47229381-47229403 AGATAGGGGTGGAGAGAAAGAGG + Exonic
907419173 1:54335390-54335412 GCATAAGTGTGCAAAGAAAAAGG + Intronic
907770465 1:57457315-57457337 GCATGGCAGTGGACAGAAATTGG + Intronic
908004032 1:59709973-59709995 GCATAGGTGTGGAAAGAGTCAGG - Intronic
908709873 1:67003002-67003024 GCATTGGTTTTGAGAGAAGTTGG + Exonic
910448647 1:87325289-87325311 TAAAAGGTGTGGAGAGAAAAGGG - Intergenic
910677688 1:89831405-89831427 GAATAGGTTTAGGGAGAAATAGG + Intronic
912121099 1:106473139-106473161 GCAAAGGAGTGGAGAGTAACAGG - Intergenic
913206981 1:116547932-116547954 GCATGGGTGTGGTGGGAAAAGGG - Intronic
914696596 1:150088205-150088227 GGATAGGGGTGGTTAGAAATTGG - Intronic
915072624 1:153283624-153283646 GCATGGCTGTGGAGAGCAAAAGG - Intergenic
915264671 1:154708269-154708291 GCATCTGTGTGGAGAGAGAGAGG + Exonic
916226797 1:162497062-162497084 GAATTGGTGGGGGGAGAAATGGG + Intergenic
921051271 1:211513627-211513649 TTCTAGGTGGGGAGAGAAATAGG + Intergenic
921388030 1:214590372-214590394 GAAGAGGTGTGGAGACAATTGGG + Intergenic
921750512 1:218787470-218787492 GCATTGTCGTGGAGAGGAATTGG + Intergenic
923078378 1:230630577-230630599 GAATTGGTGTGGAGAGAGAAGGG + Intergenic
924259927 1:242219324-242219346 GTGTAGGTGTGGAGAGGAAGAGG + Intronic
924768814 1:247060830-247060852 TCATAATTCTGGAGAGAAATGGG + Intronic
1064133541 10:12730981-12731003 GCAAAGGAGAAGAGAGAAATAGG + Intronic
1067959312 10:50830169-50830191 GCAGAGGTATGGAGAGATATTGG - Intronic
1068225337 10:54101173-54101195 GCAGAGAAGTGGAGAGAACTGGG - Intronic
1068583973 10:58775672-58775694 GCACAGTTGGGGAGAGGAATAGG + Intronic
1068848407 10:61707146-61707168 GAGTAGGTGTAGGGAGAAATTGG + Intronic
1069587120 10:69614604-69614626 TCATAGGAAGGGAGAGAAATAGG - Intergenic
1069715040 10:70515215-70515237 GCAGAGGGTTGGAGAGAACTGGG + Intronic
1070487821 10:76947443-76947465 GTATGTGTGTGGAGAGAGATGGG - Intronic
1071292447 10:84197404-84197426 GGAGAGGTGTGGAGAGAAAAGGG + Intronic
1072515872 10:96182369-96182391 GAATAGGAGTGGTGAGAAAGAGG + Intronic
1072770014 10:98130046-98130068 GCAGAGGGATGGAGAGAAGTGGG - Intergenic
1074071657 10:110076559-110076581 GCACTGGTGAGGAGAGAAAGAGG + Intronic
1074291313 10:112139870-112139892 GCAGAGGTGGGCAGAGAAACTGG + Intergenic
1074444606 10:113509737-113509759 GCATTGTTGTGGAGAATAATTGG - Intergenic
1074829245 10:117237108-117237130 GCATAGTTATAGAGAGAAAGTGG - Intergenic
1074955728 10:118387077-118387099 GGATAGGTGTGGAGACAGAGTGG - Intergenic
1075915417 10:126162282-126162304 GAAAAGGTGAGGAGAGGAATGGG + Intronic
1076429772 10:130393623-130393645 CCATGGGAGTGGAGAGGAATGGG - Intergenic
1078143017 11:8705254-8705276 GCATGGCTGTGGAGAGAAATAGG - Intronic
1078166255 11:8888340-8888362 TCATAGATGTGCAGAGAAAGAGG + Intronic
1078259210 11:9688896-9688918 GCATAGCTGTGGTAGGAAATTGG + Intronic
1078721073 11:13883604-13883626 GTATAGGAGTGCAGAGAAAGTGG + Intergenic
1079929667 11:26542314-26542336 CCTTAAGGGTGGAGAGAAATTGG + Intronic
1080408046 11:31997377-31997399 GCCTTGGTGGGGAAAGAAATAGG - Intronic
1080602458 11:33833109-33833131 GCATTGTCGTGGAGAGGAATTGG - Intergenic
1082729083 11:56773108-56773130 GCATGGGTGTGGAAAGAGCTTGG - Intergenic
1082732595 11:56818358-56818380 GCATTGTTGTGGAGAAGAATTGG - Intergenic
1082997973 11:59267878-59267900 GCAAAGGTGTGGACAGCTATGGG + Intergenic
1083375313 11:62215588-62215610 CCTTAGGTGTGGAGGGAAATGGG - Intergenic
1084285760 11:68129426-68129448 GCAGAAGCCTGGAGAGAAATGGG - Intergenic
1088038048 11:105342117-105342139 GAATAGGAGTGGTGAGAAAGGGG + Intergenic
1088359509 11:108976056-108976078 GCATGGCTGCGGAGAGAACTGGG - Intergenic
1088613270 11:111599567-111599589 GCAAAAGTGAGGGGAGAAATGGG - Intergenic
1088702263 11:112423842-112423864 GGAAAGGAGTGGAGAAAAATGGG + Intergenic
1090324163 11:125870481-125870503 CCTTAGGTGTGGAGGGAAATGGG + Intergenic
1091382608 12:72118-72140 GCATTGGTCTGGGGAGAGATTGG - Intronic
1091613750 12:2033404-2033426 GCCTGGGTTTGGAGAGAAAATGG - Intronic
1092291630 12:7162850-7162872 AGACAGGTGTGGAGAGAGATGGG + Intergenic
1092445416 12:8551492-8551514 GAATTGATGTGGAGAGAAAGGGG + Intergenic
1092709664 12:11322443-11322465 ACACAGGTGTGGAGACAGATGGG - Intergenic
1092937561 12:13378238-13378260 TCCTATGTGTGGACAGAAATAGG - Intronic
1094072267 12:26430872-26430894 GCAGAGGGATGGAGAGAAACAGG - Intronic
1094072549 12:26433806-26433828 GCAGAGGGATGGAGAGAAACAGG + Intronic
1095479055 12:42614716-42614738 ACAAAGGAGTGGAGACAAATTGG + Intergenic
1096742376 12:53703209-53703231 GAACAGGTGTGGAGAGAACTGGG - Intergenic
1097444590 12:59653418-59653440 GTATAGGTATGGTGACAAATTGG - Intronic
1098647843 12:72927320-72927342 GCAAAGTTTTGCAGAGAAATGGG + Intergenic
1098754017 12:74334886-74334908 CCATAGTTGTGGTTAGAAATAGG - Intergenic
1099665051 12:85617850-85617872 GAATAGGTGAGGAAAGAACTTGG - Intergenic
1100087349 12:90927902-90927924 GAATAGGAGTGGTGAGAAAGGGG - Intronic
1100225011 12:92547688-92547710 GCATAGGTGTAGGGAACAATTGG + Intergenic
1100610164 12:96185382-96185404 GTATTGCTGTGGAGAGAAAGGGG + Intergenic
1101275921 12:103201140-103201162 GCATTGTTATGGAGAAAAATTGG + Intergenic
1103098277 12:118149462-118149484 GCATTGCTGAAGAGAGAAATTGG - Intergenic
1103565028 12:121811254-121811276 GCAGAGGGGAGGAGAGAGATTGG + Intronic
1103751609 12:123167849-123167871 GCATAGGTGTGGAGAAAACAAGG - Intronic
1104659739 12:130602298-130602320 GGTTAGGTGTTGAGAGAGATGGG - Intronic
1105619848 13:22056172-22056194 CCATGGGGGTGGAGAGAAATGGG + Intergenic
1106397798 13:29397791-29397813 GAATACTTGTGGAGAGAAACTGG - Intronic
1108724979 13:53170797-53170819 GCAAAGGAGAGGAGAGAAAATGG - Intergenic
1110130293 13:72000866-72000888 TCAGAGGTGTGGAGAGGCATGGG + Intergenic
1110635557 13:77763692-77763714 ACATAGGTGTAAAAAGAAATAGG - Intronic
1113647351 13:112008124-112008146 GGGTAGATGTGGAGAGAAAGAGG - Intergenic
1113768265 13:112894139-112894161 GGATGGGTGAGGAGAGCAATGGG + Intergenic
1113816582 13:113175885-113175907 CCCTACGTGTGGAGAGAAACAGG + Intergenic
1114009216 14:18349126-18349148 CCTTAGGTGTGGAGAGAAAAGGG - Intergenic
1116429034 14:44824563-44824585 GAATAGGAGTGGTGAGAAAGGGG - Intergenic
1116450659 14:45060963-45060985 GCATATGTATGGTGAGAAATAGG - Intronic
1118101058 14:62602818-62602840 GGACAGGTGGGGAGAGAATTAGG + Intergenic
1119701534 14:76759005-76759027 GCATAGGTGTGGGGAGTCATGGG + Intergenic
1119989846 14:79184012-79184034 GCAGAGGTGGGGAGAGATGTAGG + Intronic
1121985272 14:98499249-98499271 ACATAGGTGTGTTAAGAAATAGG - Intergenic
1123392409 15:19889729-19889751 CCTTAGGTGTGGAGAGAAAAGGG - Intergenic
1126906818 15:53376540-53376562 GCATATATGTGGAGGGAAGTTGG - Intergenic
1127691977 15:61405554-61405576 GGATATGTGTGGAGAAAAAGTGG + Intergenic
1129387516 15:75203840-75203862 GCATTGCTGTGGAGTGAGATGGG + Intronic
1129449663 15:75643944-75643966 GCAAAGGTGAGCAGAGGAATGGG + Intronic
1129784679 15:78301388-78301410 GGCTATGTGTGGTGAGAAATTGG + Intergenic
1132328970 15:100997694-100997716 CCATATGTGTGGAAAGTAATTGG + Intronic
1135624991 16:23986871-23986893 GCCAAGGTGGGGAGAGAAAGGGG - Intronic
1135965128 16:27029179-27029201 GCATGGGTGTGGGGATCAATAGG + Intergenic
1137823781 16:51471407-51471429 GCCCAGTTCTGGAGAGAAATGGG + Intergenic
1138342776 16:56301578-56301600 GCATGTGTGTGGAGGGAGATTGG + Intronic
1138367971 16:56498769-56498791 GCATAGGTGAGGTGAGAAAAGGG - Intronic
1138651089 16:58462349-58462371 GCAAAGGTGTGGAGGGAGGTCGG - Intergenic
1140118849 16:72066101-72066123 CCTTAGGTGTGGAAAGAAAAGGG - Intronic
1140263075 16:73397465-73397487 GCATGGGTGTGTAGAGAGAGAGG + Intergenic
1143136564 17:4715750-4715772 GCAGAGGTGTGCAGAGATAAAGG + Intronic
1143173383 17:4943070-4943092 CCATAGGTGGGGACAGGAATGGG - Intronic
1143404916 17:6671062-6671084 GCAGAGGTGTGGGGAGACACAGG - Intergenic
1146548843 17:33762801-33762823 GAATATGTGAGGAGAGAAAAAGG + Intronic
1147278956 17:39342010-39342032 GGATAGGAGTGGGGAGCAATAGG - Intronic
1147395048 17:40135944-40135966 GCAAGGATGTAGAGAGAAATAGG + Intronic
1148689196 17:49517019-49517041 GCATAGGGGTGGTGAGAAAAGGG + Intergenic
1150014142 17:61536403-61536425 GCAAAGATGTGGAGAAAAATTGG + Intergenic
1150146119 17:62771113-62771135 ACATAGGTGTGGCTAGGAATTGG - Intronic
1151040852 17:70859523-70859545 GCATAAGTTTTGAGAGAAATTGG + Intergenic
1151746256 17:76013479-76013501 GCATATTTGGGGAGAGGAATGGG - Intronic
1153232950 18:2957737-2957759 GCAGAGGTGGGGAAAGAAAAAGG + Intronic
1153691220 18:7595911-7595933 TCAGAGGTGTGGATATAAATGGG - Intronic
1154277150 18:12971949-12971971 AAATGAGTGTGGAGAGAAATAGG + Intronic
1155551670 18:26972028-26972050 GCAGGGGTGTGGAGGGGAATGGG + Intronic
1157296737 18:46450458-46450480 GCAGAGGTGGGGAGGGAAAAGGG - Intronic
1157912065 18:51625569-51625591 GGAAAGATGTGGAGAGAACTTGG + Intergenic
1158064641 18:53391710-53391732 GCATGGGGGTGGAGAGATCTGGG - Exonic
1159027095 18:63193382-63193404 GCCTAGGGGAAGAGAGAAATGGG - Intronic
1160124277 18:76155967-76155989 GTAGAGCTGTGGAGCGAAATAGG - Intergenic
1165347503 19:35258034-35258056 GGATGGGTGTGGAGATAAACAGG - Intronic
1166791924 19:45403841-45403863 GCATGGGGGTGGAGAGAACGGGG + Intronic
1167362583 19:49038036-49038058 GCATGGGGGAGGAGAGAAACTGG - Intergenic
1167363548 19:49043148-49043170 GCATGGGGGAGGAGAGAAACTGG + Intergenic
1167364948 19:49049778-49049800 GGATGGGGGTGGAGAGAAACTGG - Intergenic
1167466714 19:49654040-49654062 GCAGAGGTGGGGAGAGAGGTTGG + Intronic
1167647869 19:50715574-50715596 GAAGAGGTGGGGAGAGAAAGTGG + Intronic
926430676 2:12782739-12782761 GCATTGGAGGGGAGAGAACTTGG + Intergenic
928136855 2:28694263-28694285 GTGAAGGTGTGGAGAGAGATGGG + Intergenic
930188701 2:48436133-48436155 GCTTAGGTATGCAGAGAAAATGG + Intergenic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931908782 2:66871453-66871475 GAATTGGGATGGAGAGAAATGGG + Intergenic
931911748 2:66907059-66907081 GGGTAGGTGTGGAGAGAGGTGGG - Intergenic
932890788 2:75595799-75595821 GCACAGGTCTGGAGAGAACCTGG + Intergenic
933218390 2:79657733-79657755 GCATAAGTGTGAAAAAAAATAGG + Intronic
934546207 2:95218820-95218842 GCATAGGTGTGGAGAGAAATTGG + Intronic
935047916 2:99498480-99498502 TCTTAGGTATGGAGGGAAATGGG - Intergenic
936668585 2:114628740-114628762 GCTCAGGTGTGTTGAGAAATGGG + Intronic
937748848 2:125449113-125449135 GCATTGTTGTGGAGAAGAATTGG + Intergenic
938403633 2:131014907-131014929 GGAGAGGTGTGGAGAGCGATGGG + Intronic
938527363 2:132146227-132146249 CCTTAGGTGTGGAGGGAAAAGGG + Intergenic
939683673 2:145170778-145170800 GGAATGGTGTGGAGAGAGATGGG + Intergenic
939960282 2:148560048-148560070 GTAGAGGTGTGGTGATAAATGGG - Intergenic
941102127 2:161308219-161308241 GCAGAGGTAGGGAGAGAAAAAGG + Exonic
942912841 2:181266299-181266321 ACATATGTGAGGAGATAAATAGG + Intergenic
943655469 2:190503783-190503805 GCCTAGGTGGGGACAGAAAAGGG + Intronic
945266285 2:207894480-207894502 GCAAAGGTGGGGAAAGAAAAGGG - Intronic
947434593 2:230062301-230062323 ACTCAGGTGTGGATAGAAATAGG - Intronic
948611195 2:239168095-239168117 GCAAGGGGGTGGAGAGAAAAAGG - Intronic
948618148 2:239214841-239214863 GCATGGGACTGGAGAGAAATAGG + Intronic
1174552324 20:51370862-51370884 CCATAGATGTGGAGAGACGTGGG + Intergenic
1174944684 20:54971828-54971850 CCATAGGTGTGGCAAGAGATAGG + Intergenic
1175604753 20:60303573-60303595 GTAAAGGGGTGTAGAGAAATTGG - Intergenic
1176282593 20:64322717-64322739 GCATTGGTCTGGGGAGAGATTGG + Intergenic
1178252715 21:31020002-31020024 GCAGAATTGCGGAGAGAAATTGG - Intergenic
1178381991 21:32117869-32117891 GCTCAGGTGTGGAGGGAAATGGG - Intergenic
1179260862 21:39757210-39757232 CAATAGGTGTGGGGAGAAACAGG - Intronic
1179551571 21:42146857-42146879 GCACAGGTGAGCAGAGAACTGGG - Intergenic
1180433717 22:15279936-15279958 CCTTAGGTGTGGAGAGAAAAGGG - Intergenic
1180516273 22:16147845-16147867 TCTTAGGTGTGGAGAGAAAAGGG - Intergenic
1181493103 22:23273064-23273086 GCAGAGCTGTGGAGAGAGAGGGG - Exonic
1182833362 22:33321679-33321701 GCAAATGTGTGTGGAGAAATGGG + Intronic
1184065092 22:42114050-42114072 CCATAGATGTGGAGGGAAATGGG + Intergenic
1185058695 22:48594294-48594316 GGATGGGCGAGGAGAGAAATGGG + Intronic
1203313335 22_KI270736v1_random:158080-158102 GCATAGGAGTGGAATGGAATGGG + Intergenic
949898208 3:8786316-8786338 TGAGAGGTTTGGAGAGAAATGGG - Intronic
951601622 3:24382756-24382778 GCATGTGTTTGGAGAAAAATGGG - Intronic
953391942 3:42539031-42539053 GCATAGGAGTTGAGAGACAGGGG + Intergenic
954317897 3:49811240-49811262 GCATAGGTGTGGGGGGTACTGGG - Intronic
955866813 3:63392972-63392994 CCATAGGTATGTACAGAAATGGG - Intronic
956931043 3:74043350-74043372 GCATTTGTGCTGAGAGAAATGGG + Intergenic
959156766 3:102676014-102676036 GAATCAGTGTGGAGAGTAATTGG + Intergenic
960368390 3:116803416-116803438 GCATATGGGTAGAAAGAAATGGG - Intronic
961053328 3:123766283-123766305 GAATGAGGGTGGAGAGAAATAGG - Intronic
962035874 3:131650928-131650950 GCAAAGGTGGGAAGAGAAAGTGG - Intronic
963210805 3:142687679-142687701 ATATAGGAGAGGAGAGAAATAGG - Intronic
964426468 3:156559465-156559487 GCATATGTGTGTAGGGGAATGGG - Intergenic
964509483 3:157435626-157435648 GCATAGGAGTGAAGTGAGATAGG - Intronic
966076735 3:175945059-175945081 GAATGGGTGTGGTGAAAAATGGG - Intergenic
968533224 4:1106890-1106912 TTATAAGTGTGGAGAGATATTGG + Intronic
969643469 4:8412862-8412884 GCACAGGGGTGGAGGGAGATGGG - Intronic
969643608 4:8413359-8413381 GCACAGGGGTGGAGGGAGATGGG - Intronic
969958448 4:10917169-10917191 GCAGAAGAATGGAGAGAAATGGG + Intergenic
970604856 4:17669714-17669736 GCATATCTGTAGTGAGAAATGGG + Intronic
970761045 4:19487174-19487196 GCATATGTGTGTAGAGCAAATGG + Intergenic
971029436 4:22620894-22620916 GCAGGGGTGTGGAGGGGAATGGG + Intergenic
971110369 4:23578363-23578385 ACAGAGGTGTGCAGATAAATAGG - Intergenic
971675470 4:29621618-29621640 GCATTGTTGTGGAGAAGAATTGG - Intergenic
973216198 4:47671980-47672002 GAATATATGTGGAGAGAAGTTGG + Intronic
973978924 4:56290125-56290147 GCATAGGTGCAGAGAAATATTGG + Intronic
978313882 4:107414875-107414897 TCTTAGGTATGGAGGGAAATGGG - Intergenic
979321316 4:119328364-119328386 GAAAAGGTCTGTAGAGAAATTGG - Intergenic
980273165 4:130614048-130614070 GCAAAGGTTTTGAGAGAGATAGG + Intergenic
980501858 4:133666233-133666255 GAATAGCTGTGGAGAAAAGTAGG - Intergenic
981805892 4:148714780-148714802 GCATATGTGTGTTGAGAAATGGG - Intergenic
982269638 4:153573253-153573275 GCATCGCTGTGGCGAGAATTAGG - Intronic
982288209 4:153756566-153756588 CCATAGGGGTGGAGAGAAGGGGG - Intronic
984395909 4:179199875-179199897 GCAAAGACGGGGAGAGAAATAGG + Intergenic
985607353 5:865149-865171 GCACAGGGGTGGACAGAACTGGG + Intronic
986460395 5:7964460-7964482 GCATTGTTGTGGAGAAGAATTGG + Intergenic
986530243 5:8728958-8728980 ACATATCTGTGGAGAAAAATAGG - Intergenic
986901056 5:12433996-12434018 GCTTGGCTGTGGAGAGCAATGGG + Intergenic
987822896 5:22989013-22989035 GGATAGGCATGAAGAGAAATCGG + Intergenic
988721819 5:33886753-33886775 CCATAGGTGTGGATGGAAATCGG + Intronic
990473868 5:56142855-56142877 GCATAGCTTTGCAGAGAAACTGG + Intronic
995659267 5:114462670-114462692 ACAAAGGTGTGGAGTGAGATTGG + Intronic
995667297 5:114556515-114556537 AGATAGGAGTAGAGAGAAATAGG + Intergenic
997881266 5:137592721-137592743 GGTTAGGTGAGGTGAGAAATTGG + Intronic
998403868 5:141862890-141862912 GCGTAAGTGGGGAGGGAAATGGG - Intronic
999016004 5:148106159-148106181 GAATAGGAGTGGAGAGAAGGAGG - Intronic
999103457 5:149047682-149047704 GCACAGGAGTGGAGAGGAGTGGG - Intronic
999400191 5:151258477-151258499 GCATGGCTTTGGAGAGACATGGG - Intronic
1000263437 5:159612222-159612244 GCATTGTTGTGGAGAAGAATTGG + Intergenic
1003339989 6:5211093-5211115 GCATACAAGTGGAGAGATATGGG + Intronic
1004331630 6:14727207-14727229 GTATGGGGGTGGAGGGAAATAGG + Intergenic
1004851603 6:19705080-19705102 CCATAGTTGGGGAGAGAAACTGG + Intergenic
1005774375 6:29114742-29114764 GGTTAGCAGTGGAGAGAAATAGG - Intergenic
1006030663 6:31174551-31174573 GCACACCTGTGAAGAGAAATGGG + Intronic
1007145997 6:39632690-39632712 GCAGAGGTGTGGAGATAATGAGG - Intronic
1007250948 6:40494539-40494561 GGATAGTTGTGGAGAGAGACAGG - Intronic
1008866633 6:56219405-56219427 GCATTGTTGTGGAGAAGAATTGG - Intronic
1009590268 6:65660194-65660216 GCATAGGGGTAGTGAGAATTAGG + Intronic
1010144611 6:72652632-72652654 GCAACGGTGAGGAGAGAAAAAGG - Intronic
1011542597 6:88448222-88448244 GTGAAGATGTGGAGAGAAATTGG + Intergenic
1012915767 6:105168746-105168768 TCATAGGACTGGAGAGAGATTGG + Intronic
1014531874 6:122568819-122568841 GGATAGGTGTGGCCAGAAAGTGG + Intronic
1016862460 6:148734543-148734565 ATATAGGGGTGCAGAGAAATGGG - Intergenic
1017859148 6:158379104-158379126 GCATAGGTGTGATGTGAAACTGG + Intronic
1018663558 6:166112845-166112867 CCATAGGAGTGCAGAGAAATTGG - Intergenic
1018678188 6:166241249-166241271 GCATAGATGTGGTGAGAAGTGGG + Intergenic
1018798813 6:167207283-167207305 TCATATGTGTGGAAGGAAATGGG - Intergenic
1020661424 7:10988259-10988281 TAATAGATGTGGAGAGAAATTGG + Intronic
1022186840 7:27977708-27977730 GTATGTGTGTGGAGAGAAAGGGG - Intronic
1023096932 7:36670783-36670805 GCATAGGTATGGAGAAAGAATGG - Intronic
1023186351 7:37537199-37537221 GTATAGATGAGGATAGAAATGGG - Intergenic
1023630495 7:42159061-42159083 GGGGAGGTGTGGGGAGAAATAGG - Intronic
1024010389 7:45261341-45261363 GCATAGCTGAGGAGAGAAGAGGG + Intergenic
1024026143 7:45411351-45411373 GCAGAGGTGTGGACACATATAGG - Intergenic
1024203509 7:47131021-47131043 GCTTAGGTGGGGAAAGAGATGGG - Intergenic
1028018650 7:85744517-85744539 CCTTAGGTGTGGAGGGAAGTGGG + Intergenic
1028882437 7:95894936-95894958 GCATTGTTGTGGAGAAGAATTGG + Intronic
1028954697 7:96675542-96675564 GTGTATGTGTGGAGAGAACTGGG - Intronic
1029492772 7:100881468-100881490 GCACAGGTGAGGGGAGAAAGGGG - Intronic
1030161962 7:106518408-106518430 GGAGAGGGGAGGAGAGAAATAGG - Intergenic
1030575298 7:111278540-111278562 GTATATGTGTAGAGAGAAACTGG - Intronic
1031508740 7:122622150-122622172 GCATATCTGTGGTAAGAAATTGG - Intronic
1032538145 7:132681766-132681788 GGAGAGGAGTTGAGAGAAATTGG - Intronic
1034427044 7:151019407-151019429 GCATCACTGTGGAGAGGAATGGG - Intronic
1037169934 8:15878881-15878903 GAATAAATGTGGGGAGAAATAGG + Intergenic
1037833723 8:22204125-22204147 GCCTAGCTGGGGAGAGACATGGG + Intronic
1038038466 8:23705449-23705471 GCTGAGGTTTGGAGAGAAAAAGG + Intronic
1038112181 8:24511903-24511925 GCAGAGTTGTGGATGGAAATAGG + Intronic
1038311587 8:26449584-26449606 GACTGGGTGTGGAGAGAAAACGG + Intronic
1039397263 8:37237120-37237142 GCACAGGTTTGGAGGGAGATGGG - Intergenic
1039689767 8:39851220-39851242 CCTTAGATGTGGAGGGAAATGGG + Intergenic
1040416257 8:47198427-47198449 GCACAGGTGAGGACAGAATTTGG - Intergenic
1040898053 8:52389258-52389280 GAAAAGGTGTGGAGAGGAAAAGG + Intronic
1041415643 8:57605303-57605325 ACATAGGTTGGGAAAGAAATAGG + Intergenic
1041630902 8:60085894-60085916 TCATATGAGTTGAGAGAAATAGG - Intergenic
1042150817 8:65781531-65781553 GCATTGGTGTGGTGAGATTTGGG + Intronic
1042314846 8:67414907-67414929 GCATAGGAGTGTAAAGAAAAGGG - Intergenic
1042756401 8:72218077-72218099 GCATAGGTGTGGTGAGAAGTAGG - Intergenic
1043330459 8:79110896-79110918 GCATTGTTGTGGAGAATAATTGG + Intergenic
1043484177 8:80682666-80682688 GCATAGGTGTGGAGAGAAGGGGG - Intronic
1043661766 8:82752143-82752165 GCATTGTTGTGGAGAAGAATTGG - Intergenic
1044974974 8:97655641-97655663 TCATAGCTTTGGAGAGAAAAGGG + Intronic
1047673164 8:127171119-127171141 GCACTGGAGTGGAGAGAAAAAGG - Intergenic
1049783864 8:144441201-144441223 GCAGAGGTGTGGAGAGAGTGGGG - Intronic
1051142691 9:13994880-13994902 GCATTGTTGTGGAGAAGAATTGG + Intergenic
1052142653 9:25005569-25005591 GAATAGGTGGGAAGATAAATTGG + Intergenic
1052303055 9:26974939-26974961 CCTTAGGTGTGGAGGGAAATGGG + Intronic
1052751327 9:32494675-32494697 GCAGGGGTGAGGAGAGAAAAAGG - Intronic
1053706047 9:40753516-40753538 CCTTATGTGTGGAGAGAAAAGGG + Intergenic
1053840794 9:42187151-42187173 CCATAGGTGTGGGCAGGAATTGG - Exonic
1054416123 9:64877120-64877142 CCTTATGTGTGGAGAGAAAAGGG + Intergenic
1055978821 9:81980605-81980627 ACATAGATATGTAGAGAAATAGG - Intergenic
1056600373 9:88042401-88042423 TCTTAGGTGTGGAGAGAAATGGG + Intergenic
1056767933 9:89456212-89456234 GCAGAGGGGAGGAGAGAGATGGG - Intronic
1057739013 9:97695614-97695636 GCATAGCAGCAGAGAGAAATCGG - Intronic
1059246894 9:112856459-112856481 GCATGGGTGTGGAGGGGAGTGGG + Intronic
1060227682 9:121804591-121804613 GCAAGGATGTGGAGAGAAAAGGG - Intergenic
1061132126 9:128714116-128714138 GCAGAGGTGTGGAGGGAATGGGG + Exonic
1061975553 9:134066717-134066739 GCATTGGTGGGCAGAGTAATTGG - Intronic
1062201197 9:135303708-135303730 GCACAGGTGTGGTTAGAAAGAGG - Intergenic
1203348033 Un_KI270442v1:49140-49162 GGATTGGAGTGGAGTGAAATGGG + Intergenic
1185920158 X:4082699-4082721 GAATAGGTTTGGAGAACAATGGG + Intergenic
1186759069 X:12704000-12704022 ACAAAGGGATGGAGAGAAATTGG + Intronic
1188603304 X:31996122-31996144 ACATAGGCATGGAGAGAAATTGG + Intronic
1189063170 X:37776431-37776453 GCAGAGATGAGGAGAGAAAGTGG + Intronic
1189834311 X:45005071-45005093 TCTTAGGTATGGAGGGAAATGGG + Intronic
1192293198 X:69819320-69819342 GAATAGGAGTGGTGAGAGATGGG - Intronic
1192300364 X:69894946-69894968 GAATAGGAGTGGAGAGAGAGAGG + Intronic
1194658021 X:96597301-96597323 GCATGGCTTTGGAGATAAATTGG - Intergenic
1195769176 X:108330707-108330729 GTATAGCTGTGGAGTGAAAACGG - Intronic
1197702295 X:129608463-129608485 GCATAGGTGTGGGTAGGGATTGG - Intergenic
1197967985 X:132085359-132085381 GGATAGATGGGGACAGAAATAGG - Intronic
1199425083 X:147692106-147692128 GAAAATGTGAGGAGAGAAATTGG + Intergenic
1199671830 X:150154223-150154245 GGATAGGTGAGGAGAGAACTAGG - Intergenic
1200712552 Y:6500940-6500962 GAATAGGAGTGGTGAGAAAGGGG + Intergenic
1201021366 Y:9661098-9661120 GAATAGGAGTGGTGAGAAAGGGG - Intergenic
1201122893 Y:10886754-10886776 GCAGAGGAGTGGAAAGGAATGGG - Intergenic