ID: 934547311

View in Genome Browser
Species Human (GRCh38)
Location 2:95228802-95228824
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 3, 1: 32, 2: 58, 3: 52, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934547307_934547311 21 Left 934547307 2:95228758-95228780 CCTGGTGGTTTTCTTTTTTTAAT 0: 1
1: 1
2: 14
3: 242
4: 2211
Right 934547311 2:95228802-95228824 TTGGGCCCCCAAAATCATTAAGG 0: 3
1: 32
2: 58
3: 52
4: 140
934547306_934547311 24 Left 934547306 2:95228755-95228777 CCACCTGGTGGTTTTCTTTTTTT 0: 1
1: 1
2: 14
3: 212
4: 2042
Right 934547311 2:95228802-95228824 TTGGGCCCCCAAAATCATTAAGG 0: 3
1: 32
2: 58
3: 52
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902661970 1:17910785-17910807 TTGGGCACCTGAAATCACTAAGG + Intergenic
904797487 1:33068111-33068133 ATGGGCCCTCAAAATTTTTAGGG - Intronic
906577708 1:46905610-46905632 ATGGGCCCTCAAAATTTTTAGGG - Intergenic
908258712 1:62322586-62322608 TTGGGTCCCCAAAATCACTAAGG - Intergenic
909057439 1:70838302-70838324 TTGGACCTCCAAAATCACTAAGG + Intergenic
910267776 1:85357777-85357799 CTGGGTCCCCAAATTCATTCTGG - Intronic
911908197 1:103595807-103595829 CTGGGCCCCTGAAATCACTAGGG - Intergenic
911914721 1:103683659-103683681 CTGGGCCCCTGAAATCACTAGGG + Intronic
911921146 1:103762465-103762487 TTGGGACCCCAAAATCACTAAGG - Intergenic
911991625 1:104705580-104705602 TTTGGCCTCCAAAATCACTTAGG + Intergenic
914381640 1:147121579-147121601 TTGGGCCTCCAAAATCACTAAGG + Intergenic
915745826 1:158156928-158156950 CTTGGACCCCAAAATCACTAAGG + Intergenic
916009154 1:160688989-160689011 ATGGGCCCTCAAAATTTTTAGGG + Intronic
916260083 1:162833252-162833274 TTGGGACCCCAAAATCACTAAGG + Intronic
916762582 1:167830739-167830761 TTGGGCCCCCAAAATCACTAAGG + Intronic
917835346 1:178937459-178937481 TTGGGCCCCCAAAACCAAAATGG - Intergenic
917913242 1:179673789-179673811 TTGCACCCCCAAAATCACTAAGG - Intronic
918256805 1:182756008-182756030 ATGGGCCCCTAAAAGCATCATGG - Intergenic
920920572 1:210294377-210294399 ATGGGCCCCCAAAAGCACTGTGG + Intergenic
923493480 1:234505020-234505042 TTGGACCCCCAAAATCACTAAGG - Intergenic
924269662 1:242319456-242319478 TTGGGACCCCAAACTCTCTAAGG + Intronic
1063020131 10:2118767-2118789 TTGGGACCCTAAAATCACTAAGG + Intergenic
1064637089 10:17379444-17379466 TTGGGCCCCCAAAATCACTAAGG + Intronic
1064637536 10:17385095-17385117 TTGGGCCTCCAAAATCACTAAGG + Intronic
1066715246 10:38279322-38279344 TTGGGACCCCAAACTCTCTAAGG - Intergenic
1066782848 10:38971392-38971414 TTGGGACCCCAAACTCTCTAAGG + Intergenic
1067941716 10:50662007-50662029 TTTGGCCCCCAAAGTCAGGAAGG - Intergenic
1068668395 10:59699753-59699775 TAGCTCCCCCAAAATCTTTAAGG + Intronic
1069600969 10:69707726-69707748 TTGGGCCCCCAAAATCACTAAGG - Intergenic
1073520657 10:104126015-104126037 TAGGCCTCCCAAAACCATTAGGG + Exonic
1074599181 10:114896442-114896464 TTAGGCCCCCAAAATCACTAAGG + Intronic
1075991172 10:126840122-126840144 TCAGGCCCCCAAAATCACTCAGG + Intergenic
1077559503 11:3249900-3249922 TTGGGCCCCTAAAATCACTAAGG - Intergenic
1077565397 11:3295703-3295725 TTGGGCCCCCAAAATCACTAAGG - Intergenic
1078839515 11:15065404-15065426 ATGGGCCCTCAAAATTTTTAGGG + Intronic
1079071030 11:17347377-17347399 TTGGGTCCCCAAAATCACTAAGG - Intronic
1080186747 11:29496984-29497006 TTGGACCCCCAAATTCCTTTTGG - Intergenic
1080647849 11:34199767-34199789 TTGAGCCCTCAAAATCAGTAGGG - Intronic
1082037292 11:47655536-47655558 TTAGGGCACCAAAATGATTAAGG - Intergenic
1082299605 11:50490261-50490283 GTGGGCCCTCAAAATGTTTATGG + Intergenic
1082309720 11:50631943-50631965 ATGGGCCCTCAAAATTTTTAGGG + Intergenic
1082572852 11:54763743-54763765 ATGGGCCCTCAAAATTTTTAGGG - Intergenic
1082834838 11:57644218-57644240 TTGGGCACCCAACAACAGTAGGG + Intergenic
1084874751 11:72123084-72123106 TTAGGGCCCCAAAATTACTAAGG - Intronic
1085360569 11:75881565-75881587 TTGGGCCCCCAAAATCATTAAGG - Intronic
1087119709 11:94560551-94560573 ATGGGCCCCCAAAAGCACTGTGG - Intronic
1087458371 11:98416233-98416255 TTGGCCTCCCAAAATTAATAAGG - Intergenic
1087740210 11:101879005-101879027 TTGGGCCCCTAGAATCACTCAGG + Intergenic
1088102756 11:106173314-106173336 TTGGGCTCCCAAAATTACTAAGG + Intergenic
1088727505 11:112652657-112652679 TTGGGCCCCCAAAATCACTAAGG - Intergenic
1093072151 12:14716735-14716757 TTGGGCCCCCAAAATCACTAAGG - Intergenic
1093971334 12:25378572-25378594 TTAGGCCTCCAAAATCACTATGG + Intergenic
1094860707 12:34462912-34462934 ATGGGCCCTCAAAATTTTTAGGG + Intergenic
1094865760 12:34528499-34528521 ATGGGCCCTCAAAATTTTTAGGG - Intergenic
1095270295 12:40210845-40210867 TTGTGCCCCCAAAATCACTAAGG + Intronic
1098310981 12:69148732-69148754 TTGGGCCCCCAACATCGCTATGG + Intergenic
1098571907 12:71997379-71997401 TTAGGCCATCAAAATCTTTATGG + Intronic
1098864563 12:75747119-75747141 TTGGGCCCCCAAAATGACTAAGG - Intergenic
1101501910 12:105311976-105311998 ATGGGCCCTCAAAATTTTTAGGG - Intronic
1103666792 12:122573894-122573916 TTGGGCCCCCAAGATCACTAAGG - Intronic
1103907684 12:124335760-124335782 TTGGGCTCCCAAAGACAGTAAGG + Intronic
1104687725 12:130799570-130799592 CGGGGCCCCCAAAATCAAAAAGG + Intronic
1105714970 13:23054081-23054103 TTGGGCCCCCAAAATCACTGAGG - Intergenic
1105748678 13:23401185-23401207 TTGGGCCCCCAAAATCGCTCAGG + Intronic
1105751705 13:23426883-23426905 TTAGGCCCCCAAAATCACTAAGG - Intronic
1105929259 13:25036922-25036944 TTGGGACTCCAAAATCACTAAGG + Intergenic
1108509243 13:51140009-51140031 TTGGGCCCCCAAAATCACGAAGG + Intergenic
1109017411 13:57035747-57035769 TTGGGCCTCCAATATCGCTAAGG + Intergenic
1110425631 13:75363349-75363371 TTAGGCCCCCAAAATCACTAAGG + Intronic
1111065198 13:83081852-83081874 TTGAGACCCGAAAATCACTAAGG - Intergenic
1111210579 13:85073411-85073433 TTGGGCCCCCAAGATCACTAAGG - Intergenic
1112413193 13:99181139-99181161 TTGGGCCCCTAAAATCACTAAGG - Intergenic
1112592224 13:100774277-100774299 TTGGGCCCCCAAAATCACTAAGG - Intergenic
1114052723 14:18935176-18935198 TTGGTCCCCCAAAATCACTAAGG + Intergenic
1114053203 14:18941291-18941313 TTGGGCCCCTAAAATCACTAAGG + Intergenic
1114109355 14:19460635-19460657 TTGGGCCCCTAAAATCACTAAGG - Intergenic
1114109835 14:19466750-19466772 TTGGTCCCCCAAAATCACTAAGG - Intergenic
1114912467 14:27218257-27218279 TTGGCCCCTGAAAATCACTAAGG - Intergenic
1118025662 14:61765697-61765719 TTGGGCACCCAAGATCACTAAGG - Intronic
1118117502 14:62797034-62797056 TTGGGCCCCCAAGATCACTAAGG - Intronic
1118631654 14:67709852-67709874 TTGGGCCCCCAAAATCACTAAGG + Intronic
1118795207 14:69137253-69137275 TTAGGCCCTCAAAACCAGTAAGG + Intronic
1120205747 14:81585647-81585669 TTTGGCCCCCAAAATCACTAAGG + Intergenic
1120618491 14:86735193-86735215 TGGGGCCTCTAAAATTATTAAGG - Intergenic
1120969208 14:90193230-90193252 CTGGGCCCACAAAACCAGTAGGG + Intergenic
1121147759 14:91599947-91599969 TTGGGCCCCCAATATCACTAAGG - Intronic
1122346424 14:101063838-101063860 TCGGGCCCCTAAAATCACTAAGG - Intergenic
1123872353 15:24589681-24589703 TTGGCACCCCAAAATGACTAAGG - Intergenic
1124111958 15:26798747-26798769 TTGGGAGCCCAAAATCAAGAGGG - Intronic
1124876477 15:33599683-33599705 TTGGGCCCCCAAAATCACTAAGG - Intronic
1125567639 15:40689283-40689305 ATGGGCCCTCAAAATTTTTAGGG - Intergenic
1128120048 15:65139083-65139105 TTGGGCCCCTAAGATCACTAAGG - Intergenic
1128603902 15:69020323-69020345 TAGGGATCCCAAAAACATTAAGG - Intronic
1128732835 15:70032847-70032869 TAGGGCCCCCGAACTCATAAGGG + Intergenic
1129886908 15:79044572-79044594 TTGGGCCCCAGCAATGATTAGGG - Intronic
1133462127 16:5996146-5996168 ATGTGCCCCCAAAATTAATATGG - Intergenic
1133652270 16:7823527-7823549 TTGGGCCCCCAAAATCACTAAGG - Intergenic
1134280548 16:12813277-12813299 TTGGGACCCCAAAATCACTAAGG + Intergenic
1134382318 16:13739469-13739491 TTGGGCCCCCAAAATCCCTAAGG + Intergenic
1137063850 16:35815884-35815906 TTGGGCACCCAAAATTACTAAGG - Intergenic
1137636033 16:49987120-49987142 TTGGGCCCCCCAATCCATTGTGG - Intergenic
1138767746 16:59624379-59624401 ATGGGCCCTCAAAATTTTTAGGG + Intergenic
1141212866 16:81997205-81997227 TTGGGCCCCTAAAATCCTTCTGG + Exonic
1143211082 17:5188070-5188092 ATGGGCACCCAAAAGCAGTAAGG - Intronic
1145801469 17:27688676-27688698 ATGGGCCCTCAAAATTTTTAGGG + Intergenic
1147513587 17:41095333-41095355 TTGGGGCCCTGAAATCACTAAGG + Intronic
1147515691 17:41115623-41115645 TTGGGGCCCTGAAATCACTAAGG + Intergenic
1150554792 17:66244700-66244722 TTCAGCCCCCAAAATCACTAAGG + Intronic
1151533618 17:74724455-74724477 TTAGGCCCCCAAAATCACTAAGG - Intronic
1151914164 17:77105198-77105220 TTGGGCCCCCAAAATCACTAAGG - Intronic
1152751986 17:82066495-82066517 TTGGGCCCCCGGAATCACTAAGG + Intergenic
1153148106 18:2056611-2056633 TTGGGCCCCCAAAATCACTAAGG - Intergenic
1153328794 18:3850561-3850583 TAGGGCCCCCAAAATCAACCTGG + Intronic
1157007206 18:43597303-43597325 TTGGGCCCCCAAGATCACTAAGG - Intergenic
1159711470 18:71765404-71765426 TTGGGCCCCCAATACCACTAAGG + Intronic
1159924139 18:74251570-74251592 TTGGGCCCCCAGAATCACTAAGG - Exonic
1164042370 19:21505079-21505101 TTGGGCCCCCAAAATTACTAAGG - Intronic
1164377943 19:27705888-27705910 ATGGGCCCTCAAAATTTTTAGGG + Intergenic
1164861927 19:31568378-31568400 CTGGGCCCCCAAAATCGCTAAGG - Intergenic
1166598252 19:44070878-44070900 TTGGGCCCCCAAAATCACTAAGG - Intergenic
926508275 2:13742221-13742243 TTGGGCCCCCAACACCACTAAGG + Intergenic
926509254 2:13753039-13753061 TTGGGCCCTCAAAATCCCTAAGG + Intergenic
927490853 2:23520027-23520049 TGGGGCCTCCAAAATCTCTAAGG - Intronic
929435958 2:41928551-41928573 TTGGGCCCCCAGAATCACTGAGG - Intergenic
931451873 2:62374569-62374591 TTGGGCCCCCAAAATCACTAAGG - Intergenic
931600141 2:63994757-63994779 ATGGGCCCTCAAAATTTTTAGGG - Intronic
931715704 2:65027017-65027039 GTGGGCCCCTAAAAGCATTGTGG - Intergenic
933445034 2:82368838-82368860 TTGGGCCCCCAAAATCACTCAGG - Intergenic
933904915 2:86882434-86882456 TTGTACCCCCAAAAGAATTAGGG + Intergenic
934547311 2:95228802-95228824 TTGGGCCCCCAAAATCATTAAGG + Intronic
935142321 2:100364314-100364336 ATGGGCCCTCAAAATTTTTAGGG + Intergenic
935420787 2:102866785-102866807 CTGGGCCCCCAAGAGCATTGTGG - Intergenic
935646580 2:105341294-105341316 TTAGTCCCCCAAAATCATTTTGG + Intronic
936367313 2:111869728-111869750 TTGTACCCCCAAAAGAATTAGGG - Intronic
937714548 2:125016545-125016567 TTGGGAGACAAAAATCATTAAGG + Intergenic
938276349 2:130028238-130028260 TTGAGGCCCCAAAGTCTTTAGGG - Intergenic
938327307 2:130419000-130419022 TTGAGGCCCCAAAGTCTTTAGGG - Intergenic
938362632 2:130702477-130702499 TTGAGGCCCCAAAGTCTTTAGGG + Intergenic
938439027 2:131309117-131309139 TTGAGGCCCCAAAGTCTTTAGGG + Intronic
938471180 2:131563824-131563846 TGGGGCCCCTAAAATCACTAAGG + Intergenic
938952571 2:136268730-136268752 TCTAGCCCCCAAAATCATAAAGG + Intergenic
940011109 2:149056433-149056455 TTGAGACCCCAAAATCCTGATGG - Intronic
941462065 2:165783387-165783409 TTGAGGCCCCAAAAATATTAAGG + Intronic
942172911 2:173304904-173304926 TTGGGGCCCCAGAACCACTAAGG - Intergenic
943463440 2:188198342-188198364 TGGGCCCCCAAAAATCACTAAGG - Intergenic
943606418 2:189982751-189982773 TTGGCCCCCTAAAAGCAATAAGG - Intronic
943676175 2:190718193-190718215 TTGGGCTTCCAAAATCACTAAGG + Intergenic
944280579 2:197891887-197891909 TAGGGCCCTCAACATCATTTAGG - Intronic
944303730 2:198155975-198155997 TTGGGCCCCCCAAATCACTAAGG + Intronic
945488523 2:210426905-210426927 ATGGGCCCTCAAAATTTTTAGGG + Intergenic
946822724 2:223647066-223647088 TTGGGCCCCCAAAATCACTAAGG - Intergenic
1174808744 20:53627898-53627920 GTGGGCCCCTAAAATTATCATGG - Intergenic
1176274292 20:64255255-64255277 CTGGGCCCCCAAGATCACTAAGG - Intergenic
1176685870 21:9848067-9848089 TAGGGCCTCTAAAAGCATTAGGG - Intergenic
1176979703 21:15367075-15367097 TTGGGCCCCCAAAATCACTAAGG + Intergenic
1177336572 21:19735970-19735992 TTGGGCCCTCAAAATCACTAAGG - Intergenic
1177350749 21:19938271-19938293 TTGGACCCCCAAAATTATACTGG - Intergenic
1177534397 21:22405422-22405444 TTGGGCCCCCAAAATCACTAAGG + Intergenic
1177722973 21:24931072-24931094 TTGGGTGCCCAGAATCACTAAGG + Intergenic
1178674141 21:34616375-34616397 TTGGGCCCCCAAAATCACTAAGG + Intergenic
1179304146 21:40139600-40139622 TTTGGCCCCCAAAATCACTAAGG - Intronic
1179666496 21:42916394-42916416 TTTGGGCCCCAAAATCACTAAGG + Intergenic
1180471197 22:15657550-15657572 TTGGTCCCCCAAAATCACTAAGG + Intergenic
1180471677 22:15663666-15663688 TTGGGCCCCTAAAATCACTAAGG + Intergenic
1183112672 22:35662343-35662365 TTGGGGCCCCAGAATCACTAAGG + Exonic
1183557724 22:38544225-38544247 TTGGGCCTCCAAAATCACTAAGG + Intronic
1184654534 22:45934466-45934488 CTGGGCCCGCACAATCATTTGGG - Intronic
1184890766 22:47377678-47377700 TTGGGACCCTAAAATCACTAAGG + Intergenic
953067255 3:39484978-39485000 ATGGGCCTTCAAAATAATTAAGG + Intronic
953352894 3:42229526-42229548 TTGGAGCCCCAAACTCATCAGGG - Intergenic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
955424617 3:58775390-58775412 TTGAGCCCCCAAAATCGCTAAGG - Intronic
956290720 3:67656616-67656638 TTGGGACTCCCAAATCACTAAGG - Intergenic
958005201 3:87801763-87801785 TTAGGCCTCCAAAATCACTAAGG - Intergenic
959631371 3:108510819-108510841 ATGGGCCCCTAAAAGCATTGTGG - Intronic
960687729 3:120311195-120311217 TTAGGCCCCCAGAATCACTAAGG - Intergenic
961922824 3:130445924-130445946 ATGGGCCCTCAAAATTTTTAGGG + Intronic
964478449 3:157118592-157118614 TTCGGGCCCCCAAATCACTAAGG - Intergenic
966797274 3:183727575-183727597 TTGGCCCCCCCATATCACTAAGG + Intronic
969008881 4:4044553-4044575 ATGGGCCCTCAAAATGTTTAGGG + Intergenic
969431601 4:7158166-7158188 TTGGGCCCCTCAAATCACTAAGG + Intergenic
969727031 4:8926093-8926115 TTGGGGCCCCCAAATCACTAAGG + Intergenic
971830827 4:31692511-31692533 TTGGCACCCCAAAACAATTATGG - Intergenic
972035157 4:34510377-34510399 TTGGGCCCCCAAAATCACTAAGG - Intergenic
972195174 4:36645655-36645677 TTGGGCCCCTAAAATCACTAAGG + Intergenic
972853384 4:43076219-43076241 TTGGGCCCCCGAAATCACTAAGG - Intergenic
975826777 4:78328673-78328695 ATGGGCCCTCAAAATTTTTAGGG - Intronic
975892314 4:79044419-79044441 TTGGGGCCCATAAATCCTTAAGG + Intergenic
975955034 4:79826823-79826845 ATGGGCCCTCAAAATTTTTAGGG + Intergenic
978032579 4:103953339-103953361 TTGGGCCCCCAAAATCACTAAGG + Intergenic
978914908 4:114112521-114112543 TTGGGCTCCCCAAATCACTAAGG - Intergenic
981292285 4:143090167-143090189 TTGGACCCCCAAAATCACTAAGG + Intergenic
981695904 4:147558470-147558492 TTTGGCCCCCAAACTCATCTTGG - Intergenic
981847901 4:149190747-149190769 TTTTGCCCCCAAAATCAACAAGG + Intergenic
981884163 4:149652495-149652517 TTTTGCCCCCAAAATCTTTTTGG - Intergenic
982803637 4:159735580-159735602 TTGGGCCCCCAAATTCACTAAGG - Intergenic
984407558 4:179352598-179352620 TTGGGCCCCCAAAATCACTAAGG - Intergenic
984905087 4:184619016-184619038 TTGAGCCTCCAAAATCACTAAGG - Intergenic
985226881 4:187770783-187770805 TTGGGCCCCCAAAATCAATAAGG - Intergenic
985227306 4:187775559-187775581 TTGGGCCCCCAAAATCACTAAGG - Intergenic
986399293 5:7364548-7364570 TTGGGACTCCCAAATCACTAAGG + Intergenic
986502184 5:8412587-8412609 TTGGACCCCCAAAATCACTAAGG + Intergenic
986947593 5:13043652-13043674 TTGGGGCCCCAAAATCACTCAGG + Intergenic
987766414 5:22237194-22237216 GTGGTCCCACAAAATCATAATGG - Intronic
989318687 5:40110321-40110343 ATGGGCCCTCAAAATTTTTAGGG - Intergenic
989513511 5:42315959-42315981 TTGGGCCCCCTAAATCACTAAGG + Intergenic
995090652 5:108171997-108172019 TGGGGCCCTCAAAATCATGGCGG - Intronic
997408676 5:133673214-133673236 TTGGGCCCCCAAAATCATTAAGG - Intergenic
998966604 5:147547858-147547880 CTGGGACACCAAAATCAGTATGG + Intergenic
999340833 5:150770243-150770265 TTGGGCCCCCAAAATCACTAAGG + Intergenic
999726355 5:154441497-154441519 TCGGGACACCAAAATCACTAAGG + Intergenic
1000320484 5:160130579-160130601 TTGGCCTCCCAAAATACTTAGGG - Intergenic
1000730280 5:164826543-164826565 TGGGCCCCCAAAAATCACTAAGG - Intergenic
1001521883 5:172400220-172400242 ATGGGCCCTCAAAATTTTTAGGG - Intronic
1005058167 6:21750088-21750110 TTGGGACTCCAAAATCATTAAGG - Intergenic
1005595737 6:27377373-27377395 TTGTGCCCCCAATATCACTAAGG + Intronic
1005786973 6:29253809-29253831 TTGAGCCCCCCAAATCACTAAGG + Intergenic
1010492134 6:76489267-76489289 ATGGGCCCTCAAAATTTTTAGGG + Intergenic
1011460465 6:87597918-87597940 TTGTTCCCCCATTATCATTAGGG + Intronic
1012667253 6:101988265-101988287 GTAGTCCCCCAAAATCATAATGG - Intronic
1013410184 6:109876904-109876926 CTGGGCTCCCAAAATCACTAAGG - Intergenic
1014132419 6:117849402-117849424 TTGAACCCCCAAAATCACTGAGG - Intergenic
1017310451 6:152969962-152969984 TTGGGCCCCAAAGATGTTTAAGG - Intergenic
1018362226 6:163083163-163083185 TTGGGCCCCCAAAATCACTCAGG + Intronic
1018626259 6:165781629-165781651 TTGGGCCCCCAAGATCATCCAGG - Intronic
1021093782 7:16512119-16512141 TTGGGCCCCCAAAATCACTAAGG + Intronic
1023712150 7:43006381-43006403 TGGAGCCCCCAAAATCATCCTGG - Intergenic
1024821560 7:53336900-53336922 CTGGGGCCCCAAAATTACTAAGG + Intergenic
1024946862 7:54817166-54817188 TCGGACCCCCAAAATCACTAAGG + Intergenic
1025003288 7:55336180-55336202 TTGGTCCCCCAAAATCACTAAGG - Intergenic
1026528767 7:71179091-71179113 CTGGGTCCCCAAAATCCCTAAGG + Intronic
1026620112 7:71942772-71942794 TTGGGCCACTAATATCACTAAGG + Intronic
1030459628 7:109816597-109816619 TTGGGACCCCAAAATCACTAAGG + Intergenic
1031558411 7:123207230-123207252 TTGGGTCCCCAAAATCACTAAGG - Intergenic
1032479720 7:132236587-132236609 CTGGTTCCCCAAAATCTTTAGGG + Intronic
1037952727 8:23029340-23029362 ATGGGCCCCTAAAATTATCATGG + Intronic
1038538257 8:28369904-28369926 TTTAGGCCCCAAATTCATTAAGG - Intronic
1040139822 8:43896928-43896950 ATGGGCCCTCAAAATTTTTAGGG - Intergenic
1040353022 8:46587467-46587489 ATGGGCCCTCAAAATTTTTAGGG - Intergenic
1040620598 8:49088102-49088124 TTGGGCCCACTAAGTCATCAGGG - Intergenic
1040922106 8:52632698-52632720 TTGGGAACCAAAAATCACTAAGG + Intronic
1041364482 8:57086875-57086897 TTGGGCCCCCAAAATTATTAAGG - Intergenic
1041403685 8:57472710-57472732 TTGGTCCTCCAAAATTTTTATGG + Intergenic
1041937574 8:63350968-63350990 CTGGGCCCCCAAAATCACTAAGG - Intergenic
1043065856 8:75569060-75569082 TTGGGCCCCCAAAATCTCTAAGG + Intergenic
1044142510 8:88672825-88672847 ATGGGCCCTCAAAATTCTTAGGG + Intergenic
1045826014 8:106399054-106399076 TTTGGGCACCAAAATCATTATGG - Intronic
1046440572 8:114247701-114247723 TTGGGCCCCCAAAATCACTAAGG + Intergenic
1046753641 8:117950978-117951000 TTGGGGTCCAAAAATCAATAAGG - Intronic
1046956075 8:120064178-120064200 TTGGGCCCTCCAAATCACTAAGG + Intronic
1047219406 8:122907539-122907561 TTGGGCCCCCCAAATCACTAAGG - Intronic
1047252240 8:123189494-123189516 TTTGGCCCCCAAAATCACTAAGG + Intronic
1048271533 8:133032108-133032130 TTGCTGCCCCAAAATAATTATGG - Intronic
1048352059 8:133624238-133624260 TTGGGCCCCTAAAATCACTAAGG + Intergenic
1049456229 8:142691189-142691211 TTGGGCCCCCAGAATCACTAAGG - Intergenic
1054171397 9:61843672-61843694 TAGGGCCTCTAAAAGCATTAGGG + Intergenic
1054666137 9:67737140-67737162 TAGGGCCTCTAAAAGCATTAGGG - Intergenic
1055246527 9:74251446-74251468 TAGGTCCCCCAAAATCTATATGG - Intergenic
1056061783 9:82890729-82890751 TGGGCCCCCCAAAATCACTAAGG - Intergenic
1057467103 9:95324113-95324135 TGGGGGCCCCAAAATCACTAAGG - Intergenic
1058369974 9:104255221-104255243 TTGGGCCCTCAAAATCACTAAGG + Intergenic
1058370249 9:104258354-104258376 TGGGGCCCCAAAAATCACTAAGG + Intergenic
1060434223 9:123579889-123579911 TTGGGCCTCTATACTCATTAAGG - Intronic
1185811487 X:3114510-3114532 CTGGGCCCCCAAAATGACTCAGG - Intergenic
1187616111 X:20995211-20995233 TTGGGCCCCCAAAATCACTAAGG + Intergenic
1187616520 X:21000607-21000629 TTGGGCCCCCGAAATCACCAAGG + Intergenic
1189509336 X:41646241-41646263 ATGGGCCCTCAAAATTTTTAGGG - Intronic
1190808561 X:53862325-53862347 TTGGGGCCGCAAAATCACTAGGG - Intergenic
1191012685 X:55777114-55777136 TTGCACCCCCCAAATCACTAAGG - Intergenic
1191202707 X:57802101-57802123 TTGGGCCCCCAAAATCACTAAGG + Intergenic
1193144040 X:78059142-78059164 TTGGGCCCCCAGGATCACTAAGG - Intergenic
1193911733 X:87314841-87314863 TCGGGATCCCAAAATCATTAAGG + Intergenic
1194296674 X:92134380-92134402 TTGGGACCCCAAAATCCCTAAGG - Intronic
1194550182 X:95288363-95288385 TTTGGCCCCCAAATTAAGTAGGG - Intergenic
1196998069 X:121406153-121406175 TTGGGCCCCCAAAATCACTAAGG - Intergenic
1197042543 X:121957122-121957144 TTGGGGCCCCAAAATCACTAAGG + Intergenic
1198325332 X:135565638-135565660 TTGGGCAACCAAAATAATTTAGG - Intronic
1198880139 X:141272115-141272137 TTGGGCCCCCAAAATCACTAAGG - Intergenic
1198952398 X:142086602-142086624 TTGGGACCCCAAAATCACTAAGG + Intergenic
1200751376 Y:6947052-6947074 TTGGGCCCCAAAAATCATTAAGG - Intronic
1201667147 Y:16471067-16471089 TTGGGTCCCCCATATCACTAGGG - Intergenic
1201678084 Y:16610538-16610560 TCTGGCCCCCAAAAACTTTATGG + Intergenic
1202246970 Y:22830002-22830024 ATGGGCCCTCAAAATTTTTAGGG + Intergenic
1202399959 Y:24463750-24463772 ATGGGCCCTCAAAATTTTTAGGG + Intergenic
1202470822 Y:25206336-25206358 ATGGGCCCTCAAAATTTTTAGGG - Intergenic