ID: 934550735

View in Genome Browser
Species Human (GRCh38)
Location 2:95260010-95260032
Sequence AGGTGAAACCTGGATCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 193}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934550729_934550735 6 Left 934550729 2:95259981-95260003 CCCTGGGGCTTCTTGTCAGAGCT 0: 1
1: 0
2: 1
3: 15
4: 168
Right 934550735 2:95260010-95260032 AGGTGAAACCTGGATCCTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 193
934550724_934550735 27 Left 934550724 2:95259960-95259982 CCAGGGAGGAGCCGCACTTAACC 0: 1
1: 0
2: 0
3: 9
4: 69
Right 934550735 2:95260010-95260032 AGGTGAAACCTGGATCCTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 193
934550723_934550735 30 Left 934550723 2:95259957-95259979 CCACCAGGGAGGAGCCGCACTTA 0: 1
1: 0
2: 1
3: 6
4: 74
Right 934550735 2:95260010-95260032 AGGTGAAACCTGGATCCTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 193
934550730_934550735 5 Left 934550730 2:95259982-95260004 CCTGGGGCTTCTTGTCAGAGCTT 0: 1
1: 0
2: 2
3: 12
4: 163
Right 934550735 2:95260010-95260032 AGGTGAAACCTGGATCCTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 193
934550728_934550735 16 Left 934550728 2:95259971-95259993 CCGCACTTAACCCTGGGGCTTCT 0: 1
1: 0
2: 2
3: 24
4: 161
Right 934550735 2:95260010-95260032 AGGTGAAACCTGGATCCTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934550735 Original CRISPR AGGTGAAACCTGGATCCTGG AGG Intergenic
901263135 1:7888398-7888420 AGGTTGAACCTGGACTCTGGGGG - Intergenic
901533159 1:9866236-9866258 GGGTGAAGGCTGGTTCCTGGCGG + Intronic
901846273 1:11984690-11984712 GGGTGGACCCTGTATCCTGGGGG + Intronic
902977862 1:20101848-20101870 AGGAGAAAGCTGGGACCTGGTGG + Intergenic
903722263 1:25414368-25414390 AGGTCAACCCTAGAGCCTGGGGG - Intronic
905217648 1:36420856-36420878 AGGAGAAACGTGGATCCCTGGGG - Intronic
906525876 1:46493048-46493070 AGGTGAAGACTGGCTCCTTGAGG - Intergenic
906701766 1:47864869-47864891 AGGAGAAACCTGGGTGCTGTTGG - Intronic
907519846 1:55015955-55015977 AGGTCAATCCTGGAACGTGGTGG - Intergenic
907608842 1:55847338-55847360 AAGAGAAACCTGCCTCCTGGAGG - Intergenic
913374559 1:118136395-118136417 AGATAAAAGCTGGATCCTGAGGG - Intronic
917258259 1:173139807-173139829 GGGTGAAGCCTGAATCCTGCTGG + Intergenic
917299885 1:173561975-173561997 AGCTGTGAGCTGGATCCTGGTGG - Intronic
920029450 1:203027595-203027617 CCCTGAAACCTGGCTCCTGGAGG - Intronic
920933163 1:210407739-210407761 CGGTGAGACAGGGATCCTGGGGG + Intronic
920933811 1:210412640-210412662 AGGTGAAACCTCCACCCTAGTGG - Intronic
1063310770 10:4949766-4949788 AGCTGCAATCTGGATTCTGGGGG - Intronic
1067067705 10:43113008-43113030 AGGGGAAACCTGGATCCCACAGG + Intronic
1070664406 10:78333132-78333154 GGGTGAAGCCTGGACCCTGATGG + Intergenic
1071237344 10:83664429-83664451 ACCTGAAAACTGAATCCTGGAGG + Intergenic
1072410042 10:95193505-95193527 AGGTGTAACTTGGTTACTGGTGG - Intergenic
1072936507 10:99718423-99718445 GGGAGAATCCTGGATCCCGGAGG - Exonic
1073779087 10:106817286-106817308 CGGTGAAATCTGGATGCTGATGG + Intronic
1074125785 10:110527948-110527970 AGGCGAAACCTGGGTCAGGGAGG - Intergenic
1075302623 10:121338884-121338906 AGGAGAGGACTGGATCCTGGGGG - Intergenic
1076282911 10:129264864-129264886 AGGTGAAAACAGGATGATGGAGG + Intergenic
1080333929 11:31174570-31174592 AGGGAAAACCTGAAGCCTGGGGG + Intronic
1080638293 11:34142582-34142604 AGGTGTGACCTGGAGCCTTGGGG - Intronic
1083281325 11:61628970-61628992 AGGTCAGCCCTGGGTCCTGGTGG - Intergenic
1085033076 11:73284317-73284339 ATGGGAATCCTGGGTCCTGGTGG + Intronic
1086037178 11:82430864-82430886 TGGGGAAATCTGGATCCTGGAGG - Intergenic
1086536465 11:87852914-87852936 AGCTGAAACCCAGATCCTGGTGG + Intergenic
1090886184 11:130878943-130878965 AGGTAAAGCCAGGATCCTTGAGG + Intronic
1091413246 12:257997-258019 GGGTGAAAGCTGGAGGCTGGGGG - Intronic
1092920269 12:13224859-13224881 AGTTCCAACCTGGATCCTGTAGG + Intergenic
1096547050 12:52347256-52347278 AGGTGTAGCCTACATCCTGGTGG - Intergenic
1098905715 12:76160207-76160229 AGGGGAAAGCAGAATCCTGGAGG - Intergenic
1101050025 12:100852417-100852439 AGAAGAAGCCTGTATCCTGGAGG - Intronic
1101080633 12:101180008-101180030 AGGTGAGAGCTGGCCCCTGGAGG - Exonic
1101718088 12:107328784-107328806 TGGTGAAATCTGGATCATAGGGG + Intronic
1101881944 12:108631667-108631689 AGGTGTAACTTGGTTCTTGGTGG - Intronic
1102763575 12:115411284-115411306 AAGGGAAACCGGGTTCCTGGAGG - Intergenic
1104641344 12:130469328-130469350 AGGTGACAGCGGGATCATGGTGG + Intronic
1105038044 12:132940701-132940723 AGGTAAAACAAGGTTCCTGGTGG + Intronic
1105273005 13:18895170-18895192 AGGTGACAGCTGGATCCAGCTGG + Intergenic
1105966350 13:25388236-25388258 AGAAGAAAGCTGGCTCCTGGGGG + Intronic
1107890575 13:44910707-44910729 AGGGGAAACCTGGAACATGCTGG - Intergenic
1110378782 13:74825357-74825379 AGGTGAGAGCAGCATCCTGGTGG - Intergenic
1112028039 13:95430394-95430416 TAGTGAAAGCTGGATCCAGGGGG + Intergenic
1112456578 13:99568613-99568635 TAGTGAAAGCTGGGTCCTGGGGG + Intergenic
1113043489 13:106128916-106128938 ATGTGATAGCTGGATCCTGAAGG - Intergenic
1113654355 13:112058550-112058572 TGGTTAAACCGGGATCCAGGAGG + Intergenic
1114694505 14:24613861-24613883 AGGTGAGAGCTGGAGCCAGGAGG - Intergenic
1118948469 14:70411363-70411385 AGGTAAAGCCTGCTTCCTGGAGG + Intronic
1119757566 14:77129694-77129716 AGATGTAACCGGGATCCGGGTGG - Intronic
1121444829 14:93972292-93972314 AGGACCACCCTGGATCCTGGGGG - Intronic
1121526719 14:94624334-94624356 AGGTGGAGCCTGGGCCCTGGGGG - Intronic
1122518744 14:102327515-102327537 AGGTGACTGCTGGATCATGGGGG - Intronic
1122819050 14:104332117-104332139 CTGTGAAAGCTGGACCCTGGAGG + Intergenic
1125725957 15:41868268-41868290 AGGTGAGGACTGGATCCTGAGGG + Intronic
1126297014 15:47150939-47150961 AGGTGGAGCCTGGAGCCTGGTGG - Intergenic
1128075172 15:64821322-64821344 AGGTGAGAACTGGGACCTGGTGG - Intronic
1129825556 15:78632796-78632818 AGGTGAGACATGGATTATGGTGG - Intronic
1133278911 16:4654147-4654169 AGGTGACTCTTGGCTCCTGGAGG - Intronic
1133486224 16:6221838-6221860 TGGAGAAAACTGGATCATGGGGG - Intronic
1139958381 16:70704155-70704177 AGGTGAAACCTGGGCCAGGGTGG + Intronic
1141917292 16:87108044-87108066 AGGTGAAAACTGGATCCAAAGGG + Intronic
1142123527 16:88398951-88398973 AGGTTAAAAATAGATCCTGGGGG - Intergenic
1142946961 17:3437792-3437814 CGGAGAAGCCTAGATCCTGGAGG + Intergenic
1143967465 17:10767061-10767083 AAGTGCAACCTGGATTCTCGTGG + Intergenic
1146691289 17:34877952-34877974 TGGTGGGCCCTGGATCCTGGAGG - Intergenic
1148905960 17:50912237-50912259 AGGGCAAGCTTGGATCCTGGAGG + Intergenic
1152665866 17:81569075-81569097 AAGTGTAAACTGGATCCTTGGGG + Exonic
1154464775 18:14632748-14632770 AGGTGACAGCTGGATCCAGCTGG + Intergenic
1155144910 18:23075444-23075466 AGGTGATACCTACAGCCTGGAGG + Intergenic
1156338571 18:36190154-36190176 AGGTGAGACCTGGAAGCTGCTGG - Intronic
1160376789 18:78419927-78419949 AGGAGAAACTTGGAGCTTGGAGG - Intergenic
1161326527 19:3667005-3667027 ACGTGGAGCCTGGATTCTGGGGG - Intronic
1162185846 19:8904238-8904260 AGGTGAAACCTGCATTCTCATGG + Intronic
1162186220 19:8907052-8907074 AGGTGAAACCTGCATTCTCATGG + Intronic
1162667901 19:12230594-12230616 AGTTAATTCCTGGATCCTGGAGG - Intronic
1162789839 19:13057160-13057182 AGGTGGAACCTGCAGCCTGCTGG + Intronic
1165078876 19:33296552-33296574 CAGTGCACCCTGGATCCTGGTGG - Intergenic
1165283124 19:34814935-34814957 AGGCTAACCCTGGGTCCTGGGGG - Intergenic
1166040867 19:40201976-40201998 ACATAAAACCTGGAGCCTGGGGG - Intronic
1166166543 19:40993560-40993582 AGGAGGTAACTGGATCCTGGGGG - Intronic
1166225567 19:41392960-41392982 AGGTGACACCTCTGTCCTGGCGG - Exonic
1166328496 19:42065597-42065619 AGCTGAGACCTGGACCCTGACGG + Intronic
1166685614 19:44794327-44794349 AGGTGAACCAGGGACCCTGGAGG - Intronic
1166972959 19:46582662-46582684 AGGTGAAGCCTGAGACCTGGTGG + Intronic
926231118 2:11005073-11005095 AGGGGAAACCTGGCTCTGGGAGG - Intergenic
927598975 2:24423536-24423558 AGGGAAACCCTGGATCATGGAGG + Intergenic
929573641 2:43039074-43039096 AAGAGAACCCTGGATCCTTGAGG - Intergenic
932013237 2:67999195-67999217 ATTTGAAACCTGGATCATTGAGG + Intergenic
932886725 2:75555438-75555460 AGGTAAAACCTAGACTCTGGAGG + Intronic
934550735 2:95260010-95260032 AGGTGAAACCTGGATCCTGGAGG + Intergenic
934977815 2:98817582-98817604 AGGTGGTAGCTGGATGCTGGAGG - Intronic
935167307 2:100580706-100580728 GGGAGAATCCTGGATACTGGTGG - Intergenic
935192017 2:100785724-100785746 TGCTGCGACCTGGATCCTGGTGG - Intergenic
935600553 2:104917764-104917786 AGAAGAATCCTGGATTCTGGTGG - Intergenic
939171695 2:138703493-138703515 AAGTGAAATATGCATCCTGGGGG + Intronic
945113927 2:206392444-206392466 AGGTTAAATATGGTTCCTGGTGG + Intergenic
945534066 2:210989969-210989991 AGTTGAACCCTGGATGCTGGAGG - Intergenic
946462984 2:219886572-219886594 GGGTGACACCAGGACCCTGGGGG - Intergenic
946492659 2:220165195-220165217 AGGTGATAATTGAATCCTGGGGG - Intergenic
946592891 2:221271186-221271208 AGGTGGAAGCTGCATGCTGGAGG - Intergenic
948103132 2:235391239-235391261 AGGTGAGAGCTGGAACCTAGAGG + Intergenic
1169855182 20:10094246-10094268 AGATGGATCCTGGATCCTGGTGG + Intergenic
1170159267 20:13295861-13295883 AGGTGCAACCTGGAGGCTGCTGG + Intronic
1172035109 20:32005027-32005049 AGGAGGAACATGGATACTGGTGG - Intergenic
1172888419 20:38246978-38247000 CGGTGAAGCCTGGATCAGGGCGG - Intronic
1175762698 20:61572105-61572127 AAGTGAAGCCTGCATTCTGGAGG - Intronic
1176809762 21:13525635-13525657 AGGTGACAGCTGGATCCAGCTGG - Intergenic
1176860549 21:14009492-14009514 AGGTGCATCCTGGGTCCAGGAGG - Intergenic
1178901989 21:36605753-36605775 AGAGGAAACAGGGATCCTGGGGG + Intergenic
1180892331 22:19298313-19298335 GGGTGAAACCTGGAACCAAGGGG - Intergenic
1180938727 22:19642971-19642993 AGGAGAATCCTGGATCAAGGAGG + Intergenic
1181984871 22:26793167-26793189 GGGTGAGACCTGGGTCCTGTAGG - Intergenic
1183085888 22:35486791-35486813 AAGTGAAACCAGTATCCTGTGGG + Intergenic
1183355370 22:37356046-37356068 AGGTGACACCAGAATCCAGGAGG + Intergenic
1184220891 22:43099167-43099189 AGTGGGAACCTGGAACCTGGAGG - Intergenic
1184266536 22:43349898-43349920 TGTTGAAACCTGGAACCTGTCGG + Intergenic
1185089177 22:48756337-48756359 AGGGGGAACCTGGTTCCTGCAGG + Intronic
1185365815 22:50436270-50436292 AGGTGCATCCTGGGTCCGGGAGG - Intronic
949461539 3:4300066-4300088 AGGAGAAGACTGGATCATGGGGG + Intronic
950307553 3:11928128-11928150 AGGGAAAAACTGGATCCTGAAGG + Intergenic
950340132 3:12236220-12236242 AGGTTAAACCTGGATATTAGGGG + Intergenic
950392550 3:12707994-12708016 GGGTGAATACTGCATCCTGGGGG + Intergenic
954456897 3:50604578-50604600 AGATGGAACCTGGAACCTGTTGG + Intergenic
958795801 3:98704948-98704970 AGGTGAAACCTGGGAGGTGGAGG + Intergenic
960611549 3:119559320-119559342 AGGGCAAGCCTGGATCCAGGAGG + Intronic
961269676 3:125679834-125679856 AGTTGACACCAGGATCCAGGTGG + Intergenic
961794668 3:129401156-129401178 TGGGGAAACCTTGAGCCTGGGGG - Intergenic
963853979 3:150235433-150235455 AGGTGTAAGCTGGACCTTGGAGG + Intergenic
964293043 3:155203056-155203078 TGGTTGAACCTGGTTCCTGGGGG + Intergenic
965287886 3:166841600-166841622 TGGTGAAACCTATATCCTGAGGG - Intergenic
966148168 3:176835367-176835389 AGGTCAAAACTGGATCCTGAAGG + Intergenic
967727632 3:192876702-192876724 AGGGAAAACATGGCTCCTGGGGG - Intronic
968802927 4:2755471-2755493 AAGCGAATGCTGGATCCTGGGGG - Intronic
969917204 4:10502397-10502419 GGGAGAGACCTGGATCTTGGGGG - Intronic
970568274 4:17353578-17353600 AGGAGAATCCTGAACCCTGGAGG + Intergenic
972312961 4:37898603-37898625 AGGTGACATCTGTATCATGGTGG - Intronic
975724150 4:77275880-77275902 AAGTGGAATCTGGATCTTGGAGG - Intronic
975937535 4:79600017-79600039 AGGTGAAACCAAGAGTCTGGTGG - Intergenic
977324225 4:95554524-95554546 AAGTGAAACATGACTCCTGGAGG - Intergenic
978535771 4:109760805-109760827 AGGTCAAACCTGGCTTATGGAGG + Intronic
978544772 4:109859166-109859188 TAGTGAAAGCTGGATCCAGGGGG + Intronic
980241060 4:130176346-130176368 AGGTTAGACCTGGATCCTTAAGG + Intergenic
981110080 4:140925265-140925287 AGGTGAAGCCTGCAAACTGGTGG - Intronic
985041474 4:185895559-185895581 CGGTGCACCCGGGATCCTGGCGG - Intronic
986075547 5:4333911-4333933 AGGTTAAACCTGAATGCTGCTGG + Intergenic
986404233 5:7409326-7409348 AGAAGAAACTTGAATCCTGGGGG - Intronic
986911915 5:12567739-12567761 AGGTGAGACCTGCATCCTTGAGG - Intergenic
986929532 5:12801134-12801156 AGTTGAAACATAGAGCCTGGCGG + Intergenic
989657439 5:43760025-43760047 AGATGAGACCTAGTTCCTGGAGG - Intergenic
989820023 5:45785773-45785795 TGCTTAAACCTGGATGCTGGAGG + Intergenic
996508376 5:124292338-124292360 AGGTGAGCCCTGGGTGCTGGTGG - Intergenic
999279174 5:150353696-150353718 AAATGAAAACTGGTTCCTGGAGG + Intergenic
1000369410 5:160520314-160520336 AGGAAAAGCCTGGATCCTGATGG + Intergenic
1002649375 5:180680389-180680411 AGGTGAAGCCTGGGGCCTGCTGG - Intergenic
1003292779 6:4794142-4794164 ATGTGAAGACTGAATCCTGGGGG + Intronic
1006449442 6:34097685-34097707 AGGTGGAACGGGGATGCTGGAGG + Intronic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1007384048 6:41508681-41508703 AGGTGATCCCTGGAGGCTGGAGG - Intergenic
1010324704 6:74550858-74550880 AGGGGAATCCTGGATCCCCGTGG - Intergenic
1010734592 6:79429428-79429450 AGGGGAAACCTAGACACTGGAGG - Intergenic
1013002733 6:106040577-106040599 AGTTCAAACCTGTATCCTGTGGG + Intergenic
1019520805 7:1459757-1459779 AGGCAAAACCTGGAGGCTGGGGG - Intergenic
1019748590 7:2714574-2714596 AGGTGAAAGCCGGAGCCTGGTGG + Exonic
1020079821 7:5281471-5281493 AGGTGAAATCAGGAACCAGGTGG - Intronic
1020197711 7:6054880-6054902 AGCTGAATCCTGGAAGCTGGAGG + Intronic
1024707148 7:51972888-51972910 AGGTTTAACCTGGAAGCTGGGGG - Intergenic
1025199089 7:56950743-56950765 AGGTGAAATCAGGAACCAGGTGG + Intergenic
1025672858 7:63626190-63626212 AGGTGAAATCAGGAACCAGGTGG - Intergenic
1026275323 7:68871362-68871384 AAGTGAAGCCTGAATCATGGAGG + Intergenic
1026611647 7:71865191-71865213 AGGAGATACTTGGATCGTGGGGG + Intronic
1031005513 7:116466566-116466588 AGATGACAGATGGATCCTGGAGG - Intronic
1032537851 7:132679169-132679191 AGGTGAAATCTGCATCGGGGTGG + Intronic
1034640008 7:152594998-152595020 TGGTGACACCTGGCTGCTGGGGG + Intergenic
1034828393 7:154287801-154287823 AGGTGAGGCCTGCATCCTGGAGG + Intronic
1035108845 7:156463809-156463831 AGGTGACACCTGAATCCCGAGGG - Intergenic
1035344186 7:158187909-158187931 AGGTGGACCCTGGCTGCTGGTGG + Intronic
1036824911 8:11968458-11968480 AGGTGCAACCTGTATCTTGATGG - Intergenic
1037450632 8:19013451-19013473 AGGTGGCCCCGGGATCCTGGGGG + Intronic
1040056051 8:43057525-43057547 ACGTGACACCTAGAGCCTGGGGG - Intronic
1040892089 8:52327759-52327781 ATGAGAAACCTGGATACTGATGG - Intronic
1043540565 8:81257728-81257750 AGATGAAACTTAGATCCTAGTGG + Intergenic
1044558560 8:93590569-93590591 AGGTCAAGCCTGCATGCTGGAGG - Intergenic
1045245199 8:100436481-100436503 AGGTACAACCTGGAACCTGGAGG - Intergenic
1046243145 8:111525923-111525945 AGGTAGAACCTGGATCCTCAGGG + Intergenic
1046614143 8:116457368-116457390 AGGATAAACCTGGCTCCTTGTGG + Intergenic
1046685805 8:117225584-117225606 AGGTCCAACATGCATCCTGGAGG + Intergenic
1048281981 8:133112428-133112450 AGGAGGAAACTGGGTCCTGGGGG + Intronic
1049253185 8:141600185-141600207 AGGTGACACCTAGAGGCTGGAGG + Intergenic
1050892894 9:10847149-10847171 AGAAGAAAACTGGATGCTGGAGG - Intergenic
1057789889 9:98117999-98118021 AGGTGAAAAGGGGATCATGGGGG - Intronic
1059083085 9:111270756-111270778 AGGTGAAACCTGACACATGGAGG + Intergenic
1060543473 9:124447196-124447218 AGGTGTAACCTGGGTGCTGGGGG + Intergenic
1186301368 X:8203358-8203380 ATGTGAAACCTGGCACATGGAGG + Intergenic
1189724272 X:43952840-43952862 ATGTGAAACCTGGGTCATGAAGG - Intronic
1190081771 X:47362288-47362310 AGGTGGGATCTGGTTCCTGGTGG - Intergenic
1194744164 X:97610185-97610207 AGGTGGTTCCTGGATGCTGGAGG - Intergenic
1198077711 X:133210526-133210548 AGCTAAAAGCTGGCTCCTGGTGG - Intergenic
1198096710 X:133387104-133387126 ATGTGAAAACAGGATCCTGTCGG - Intronic
1199294755 X:146144469-146144491 AGGGGAAACCCTGATCTTGGAGG + Intergenic