ID: 934551072

View in Genome Browser
Species Human (GRCh38)
Location 2:95261922-95261944
Sequence ACACCTCCATGTAGCTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934551072 Original CRISPR ACACCTCCATGTAGCTCTGA AGG (reversed) Intergenic
900511021 1:3061238-3061260 ACACCCTCCTGTAGATCTGATGG + Intergenic
900878974 1:5366924-5366946 AGACCACCATGGAGCTTTGATGG + Intergenic
902330134 1:15727271-15727293 ACACCTCCATGGAGCGCTTGGGG + Exonic
904044263 1:27600792-27600814 ACACCTCCACTTAGCTCAGCAGG + Intronic
905719831 1:40188174-40188196 ACAACTCCATGGAACTCAGAAGG + Intronic
908434575 1:64092482-64092504 ACACCTCCATGAATCTTTGAGGG - Intronic
909107729 1:71433518-71433540 ACAGTTCCATGTGGCTGTGAAGG + Intronic
910458182 1:87420807-87420829 ACACCTTCATCTAGCCCTGAAGG - Intergenic
910750750 1:90627583-90627605 CCATCTCCATGTTTCTCTGAGGG - Intergenic
913120951 1:115740308-115740330 ACTTCTCTATGTTGCTCTGAGGG + Intronic
914315481 1:146507591-146507613 ACACCTTCATCTAGCCCTGAAGG - Intergenic
914498874 1:148225770-148225792 ACACCTTCATCTAGCCCTGAAGG + Intergenic
916711503 1:167414500-167414522 ACTCCTACATGTAGATTTGAGGG - Intronic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
923792795 1:237126592-237126614 AGACCTCCATCTGGGTCTGAAGG + Intronic
924787474 1:247211545-247211567 ACACTGCCGTGCAGCTCTGAGGG + Intergenic
1063556042 10:7080810-7080832 TCACCTCCATGTACCTTTGCAGG - Intergenic
1066649150 10:37639149-37639171 ACACCTCCACGCAGCTCGCACGG - Intergenic
1067849357 10:49745009-49745031 CCACCTTCATGGAGCTCTGAGGG - Intronic
1068111404 10:52684896-52684918 ACAGGACCATGTAGCCCTGAAGG + Intergenic
1068983793 10:63088547-63088569 GCACCTCCATGGAGCACTGAGGG + Intergenic
1069671016 10:70203873-70203895 GCACCTCCATGGAACTCAGAGGG + Intronic
1073347492 10:102794827-102794849 ACACCAGCATGTCTCTCTGAAGG + Intronic
1076346951 10:129785697-129785719 GCACCTCCCTGTGGCTCCGACGG - Intergenic
1078051826 11:7972049-7972071 ACATCACAATGTGGCTCTGATGG - Intronic
1082815186 11:57503196-57503218 ACACCTCCAGGAAGCACTTAGGG + Intronic
1086774262 11:90810543-90810565 ACACCTCTATGTACCAGTGAAGG + Intergenic
1087225502 11:95594221-95594243 ACACTTCCATGTTGCTCTTCAGG - Intergenic
1088688541 11:112305257-112305279 ACACCTCTCTGTAGCTCCCAAGG + Intergenic
1090234381 11:125136479-125136501 ACACCTTCATGGAGCACGGATGG + Intergenic
1090551263 11:127822398-127822420 ACACAGACAGGTAGCTCTGATGG + Intergenic
1090943467 11:131409337-131409359 ACACCTCTTTGTAGCCCAGATGG - Intronic
1091025910 11:132141052-132141074 ACACCTGCCTGAAGATCTGAGGG - Intronic
1091206647 11:133825876-133825898 ACACCTTCAAGGAGTTCTGAGGG - Intergenic
1095133391 12:38569079-38569101 ATACCTGCATTGAGCTCTGAAGG + Intergenic
1098873856 12:75846449-75846471 ACTCCTTCATGAAGCTCTAAGGG + Intergenic
1104022082 12:124999245-124999267 ACAATTTCATGTAGTTCTGAAGG + Intronic
1113134948 13:107079092-107079114 ACACATCCATATAAGTCTGAAGG + Intergenic
1113783664 13:112990524-112990546 ACCCCTCCATGTGATTCTGAAGG - Intronic
1115765461 14:36618423-36618445 ACCCCTCCAGGTAGCCCTGTTGG + Intergenic
1117538996 14:56728608-56728630 ACTCCTTCCTATAGCTCTGAAGG + Intronic
1118125302 14:62895838-62895860 ACACCTCTATGTAGCACACATGG + Intronic
1127840579 15:62828059-62828081 ACCCCTTTATGTTGCTCTGATGG - Intronic
1128715228 15:69903113-69903135 CCACCTCCTTGTAGCTGGGAGGG + Intergenic
1138848581 16:60598180-60598202 ACATTTCCATCAAGCTCTGATGG + Intergenic
1140630714 16:76848798-76848820 ACAGCTCCTTGTAATTCTGATGG + Intergenic
1143165637 17:4896037-4896059 ACACCTCCACGGAGCTCTTGAGG - Exonic
1144037616 17:11381681-11381703 TCACCTTCATGTGGCTCTGATGG - Intronic
1144645787 17:16972485-16972507 ACACCTCAATGGAGCCTTGAAGG - Intergenic
1145003010 17:19318699-19318721 ACACCTCCAGTTAGCTCTTATGG - Intronic
1147312162 17:39601820-39601842 ACCCCTCCATGTGGCTCTCCTGG - Intergenic
1147399198 17:40169327-40169349 ACTCCTCCATATACCTGTGATGG - Exonic
1160334518 18:78026868-78026890 ACATGACCATGTATCTCTGATGG + Intergenic
1165106696 19:33474237-33474259 ACTGCTCCTTGCAGCTCTGAGGG - Intronic
1165173644 19:33911112-33911134 TCACTTCCATGTAACTCTGCTGG + Intergenic
1165734226 19:38165588-38165610 AGACCTCCTTGTAGCTGGGATGG - Intronic
925182289 2:1825095-1825117 CCAGCTCCATGTTGCTCTCAGGG - Intronic
925448186 2:3945972-3945994 ACACCCCTCTGTAGGTCTGAAGG + Intergenic
925458495 2:4040145-4040167 ACACATTCCTGTAGCTCTCAGGG + Intergenic
925804796 2:7637483-7637505 ACATATCTATGTATCTCTGAAGG - Intergenic
926422770 2:12716109-12716131 ACACCTCCAGGGAGCGCTGTTGG - Intergenic
927407441 2:22787325-22787347 ACACCTGCATCTAGCACTGTAGG + Intergenic
927496701 2:23555964-23555986 ACGCCAGCATGTGGCTCTGAAGG + Intronic
931995801 2:67838077-67838099 ACACCTCTAATCAGCTCTGAGGG + Intergenic
934551072 2:95261922-95261944 ACACCTCCATGTAGCTCTGAAGG - Intergenic
935391681 2:102559587-102559609 AAATCTCCAGGGAGCTCTGATGG + Intergenic
935594451 2:104868151-104868173 ACACCCCCATGGGGTTCTGAAGG + Intergenic
936805294 2:116324300-116324322 ACAGTTCCATGTAGCTCAGGAGG - Intergenic
938263918 2:129912971-129912993 ACACGTCCATGTGGCTGTGTGGG + Intergenic
1168872960 20:1146589-1146611 CCTCCTCCATATCGCTCTGAAGG + Intronic
1174975487 20:55328495-55328517 TCACCTCCATGCAGTTCTCAAGG + Intergenic
1175879161 20:62246725-62246747 GCACCTCCGTGTGGCACTGAGGG - Intronic
1177483433 21:21723526-21723548 ACATCTCCATTTTGCTCAGATGG + Intergenic
1178404885 21:32315921-32315943 CCACCTCCCTGGAGCTCTAACGG + Intronic
1178852228 21:36222215-36222237 ACACATCTATGTAGCTGTGCAGG + Intronic
1179949814 21:44703317-44703339 GCACCTCCAGGCAGCTCTCAGGG + Intronic
1181722404 22:24785991-24786013 AGACCTCTAAGGAGCTCTGAGGG + Intergenic
1185058000 22:48591338-48591360 ACTCCTGCCTGTGGCTCTGAGGG - Intronic
949111471 3:266266-266288 AGACCTACAAGTGGCTCTGATGG + Intronic
949328671 3:2896354-2896376 TCAATTCCATGAAGCTCTGAGGG - Intronic
950092688 3:10307485-10307507 ACAGCTCCATGTAGCTGGGGAGG + Intronic
952352587 3:32554630-32554652 ACAACTCCCTTTAGCTCTTAGGG + Intronic
954423040 3:50428667-50428689 ACACCCCCATGAGGCTCAGATGG - Intronic
954717248 3:52533021-52533043 ACACCTCGATGTCGCCCTGGAGG - Intronic
955909437 3:63845121-63845143 TCTCCTTCATGTAGCCCTGAGGG + Intronic
959674871 3:109023209-109023231 TCACTTCCATGTGGCTCTGCAGG - Intronic
969085535 4:4653357-4653379 ACTCCTCCAGGGGGCTCTGAGGG - Intergenic
969463778 4:7342960-7342982 TCAGTTCCATGTACCTCTGAAGG - Intronic
969491333 4:7500804-7500826 CGACCTCCATGTACCCCTGAGGG + Intronic
972894555 4:43603219-43603241 ACAGCTCCATGTAGCTGGGGAGG - Intergenic
975106375 4:70572639-70572661 AAAACTCCACGTAGCTCTGAAGG + Intergenic
979047044 4:115880697-115880719 TCACCTCCATACAGCTTTGATGG - Intergenic
981222438 4:142253182-142253204 GCACCTTCTTCTAGCTCTGAAGG - Intronic
983890485 4:173024989-173025011 ATATCTCCATGTAGCTGGGAGGG - Intronic
985931223 5:3059230-3059252 ACACCTCCACGCAGGGCTGAGGG + Intergenic
990514150 5:56516687-56516709 TCACCTCCACTCAGCTCTGAGGG + Intronic
991979618 5:72217693-72217715 ACATCTGCTTGTAGTTCTGAGGG + Intergenic
993068241 5:83127510-83127532 ACAGCTCCACGTAGCTGTGAAGG - Intronic
994512233 5:100719214-100719236 ACCTCTCCACGTTGCTCTGATGG + Intergenic
996053629 5:118960769-118960791 CCAGCTCCATGTTGCTCTAAAGG - Intronic
996921462 5:128772435-128772457 ACAGCTCCATGTAGGTCAGTGGG - Intronic
999848972 5:155516907-155516929 AGACCTGCATGGAACTCTGATGG + Intergenic
1002878839 6:1234579-1234601 CCACCTCCTTGAAGGTCTGATGG + Intergenic
1004188291 6:13441189-13441211 AGACCTCCCTCCAGCTCTGAAGG + Intronic
1004190877 6:13462393-13462415 ACAATTCCTTGTGGCTCTGATGG - Intronic
1005836447 6:29713110-29713132 ACACCTCTAGGTGGGTCTGAGGG - Intergenic
1009811044 6:68667323-68667345 AAACCACCAGGTAGCTTTGATGG - Intronic
1013652123 6:112206042-112206064 TCACTTCCATGTAGCTCTTTTGG + Intronic
1017060806 6:150483108-150483130 ACACCTCAGTTTTGCTCTGAAGG - Intergenic
1021094766 7:16523467-16523489 ACACCTACTTTTTGCTCTGAAGG + Intronic
1022513376 7:30958366-30958388 ACATCTCCATGTTGATGTGAGGG + Intronic
1026570008 7:71521174-71521196 ACACTTCTTTGTAGCTCAGAAGG + Intronic
1026819223 7:73535656-73535678 ACAGGTCCATGTAGTTCGGAGGG - Intergenic
1028143868 7:87299892-87299914 ACAGTTCCATGTAGCTGGGAAGG + Intergenic
1028572424 7:92305720-92305742 ACAGCTCCATGTAGCCTTTATGG - Intronic
1032573990 7:133033290-133033312 TCAGCTCCATGAATCTCTGATGG + Intronic
1034203847 7:149299015-149299037 AGAGCTACATGTTGCTCTGATGG + Intergenic
1036754408 8:11462982-11463004 ACACCTCCCTGGAGCTCTCATGG - Intronic
1037564041 8:20102091-20102113 ACAGTTCCATGTAGCTGGGAAGG - Intergenic
1038195088 8:25359964-25359986 ACACCTTCATGGACGTCTGAAGG - Intronic
1038422409 8:27441838-27441860 ACAGCTCCCTGTGGCTCTCAAGG - Intronic
1040066801 8:43151951-43151973 ACCCCTCCCTGTAGCTTTGGAGG + Intronic
1042852475 8:73229919-73229941 AAACATCCATATAGGTCTGAAGG + Intergenic
1044106311 8:88211454-88211476 ACACCTGCTTGTGTCTCTGATGG - Intronic
1044517084 8:93152071-93152093 ACACCTCCATTTAACTTTTAAGG - Intronic
1049053011 8:140214010-140214032 ACATCTCTATGCAGCTCTGAAGG + Intronic
1049934886 9:491970-491992 ACAGTTCCATGTAGCTGTGGAGG - Intronic
1051740268 9:20244596-20244618 AAACTTCCATTTAGCTTTGAAGG - Intergenic
1052940422 9:34127791-34127813 ATACCTCCAAGGAGCTCTGTTGG + Intergenic
1053292223 9:36888764-36888786 AGACCTCCAGGCAGCTCTGCAGG + Intronic
1057110334 9:92463790-92463812 ACACCTCAGTGTAGCTTTAAAGG - Intronic
1057297883 9:93860005-93860027 ACAGGGCCATGCAGCTCTGAGGG - Intergenic
1058201788 9:102052091-102052113 TCATCTTCATGGAGCTCTGATGG - Intergenic
1058819560 9:108717013-108717035 TCTCCTCCGTGTACCTCTGATGG - Intergenic
1062175335 9:135158987-135159009 ACATCTCCCTGAAGCTGTGATGG - Intergenic
1062309820 9:135929683-135929705 ACACAGCCATGTGGCTCTGGGGG - Intergenic
1189195540 X:39149121-39149143 TCACCTCCATGGTGATCTGAAGG - Intergenic
1190317325 X:49159363-49159385 ACACCTCAATGTACCTCTCTGGG + Intergenic
1190829651 X:54048355-54048377 AAACCTCTATGTAGCACTTAGGG - Intronic
1194012016 X:88573542-88573564 CTACATCCATGTTGCTCTGATGG + Intergenic
1195682054 X:107554600-107554622 CAACCTCCAGGTAGCCCTGAAGG + Intronic
1199481416 X:148302330-148302352 ACTCCTCCTTGTACCTCTGGGGG + Intergenic
1199747761 X:150784765-150784787 ACACCTCCATGCAGGTTTGCTGG - Intronic
1200768964 Y:7106080-7106102 ACACCTCCACGGAGCTCCAATGG + Intergenic
1201958535 Y:19651847-19651869 AAGACTCCATGTAGCTCTGAAGG + Intergenic