ID: 934551128

View in Genome Browser
Species Human (GRCh38)
Location 2:95262514-95262536
Sequence TAAAGGAAGTTGAGACCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934551125_934551128 -6 Left 934551125 2:95262497-95262519 CCTCTGGGAAGGCTGTTTAAAGG No data
Right 934551128 2:95262514-95262536 TAAAGGAAGTTGAGACCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934551128 Original CRISPR TAAAGGAAGTTGAGACCAGG AGG Intergenic
No off target data available for this crispr