ID: 934551678

View in Genome Browser
Species Human (GRCh38)
Location 2:95266806-95266828
Sequence AGACGCTCCCTGCCAAGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934551678_934551681 3 Left 934551678 2:95266806-95266828 CCAGACCTTGGCAGGGAGCGTCT No data
Right 934551681 2:95266832-95266854 TCTCTACACATGCCGACAGTGGG No data
934551678_934551680 2 Left 934551678 2:95266806-95266828 CCAGACCTTGGCAGGGAGCGTCT No data
Right 934551680 2:95266831-95266853 ATCTCTACACATGCCGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934551678 Original CRISPR AGACGCTCCCTGCCAAGGTC TGG (reversed) Intergenic
No off target data available for this crispr