ID: 934552415

View in Genome Browser
Species Human (GRCh38)
Location 2:95270542-95270564
Sequence GCCGCTAGGAGGTTTGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934552409_934552415 10 Left 934552409 2:95270509-95270531 CCCTGGAGACAAATTAAGGAGTC No data
Right 934552415 2:95270542-95270564 GCCGCTAGGAGGTTTGAAGCAGG No data
934552410_934552415 9 Left 934552410 2:95270510-95270532 CCTGGAGACAAATTAAGGAGTCC No data
Right 934552415 2:95270542-95270564 GCCGCTAGGAGGTTTGAAGCAGG No data
934552407_934552415 24 Left 934552407 2:95270495-95270517 CCAATGTTGGAGGGCCCTGGAGA No data
Right 934552415 2:95270542-95270564 GCCGCTAGGAGGTTTGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934552415 Original CRISPR GCCGCTAGGAGGTTTGAAGC AGG Intergenic
No off target data available for this crispr