ID: 934553789

View in Genome Browser
Species Human (GRCh38)
Location 2:95277096-95277118
Sequence CGCCCCAGGAGGACACCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934553789_934553792 0 Left 934553789 2:95277096-95277118 CCAGCGGGTGTCCTCCTGGGGCG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 934553792 2:95277119-95277141 ATCCCACCTGCACCTAGCCCTGG 0: 1
1: 0
2: 2
3: 19
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934553789 Original CRISPR CGCCCCAGGAGGACACCCGC TGG (reversed) Intronic
900952189 1:5864373-5864395 CGAGCCAGGAGGCCACCAGCTGG + Exonic
901199601 1:7459129-7459151 CTCCCCAGCAGGCCACCCCCTGG - Intronic
901669888 1:10849983-10850005 TGCCCCAGCAGGACACCCCAGGG + Intergenic
902507675 1:16948552-16948574 GGCCCCAGGAGGACCCCCCAGGG - Intronic
902671529 1:17977797-17977819 GGCCCCAGGAGGCCACCTTCAGG + Intergenic
903509955 1:23867762-23867784 GGCCGCAGGAGGCCACACGCGGG + Intronic
904893749 1:33798790-33798812 GGACCCTGGAGGACACCCACTGG + Intronic
906528894 1:46512078-46512100 GGGCCCAGGAGGCCACCCCCTGG - Exonic
913186114 1:116372670-116372692 CGCCCGGGGAGGCCATCCGCAGG + Intronic
914833744 1:151190199-151190221 CGCCGCTGGTGGCCACCCGCAGG - Intronic
922741468 1:228016469-228016491 CACCCCAGGAGGCCACCCAGGGG - Intronic
1063114916 10:3066864-3066886 CGCCCCAGGAGGAATCTTGCGGG + Intronic
1063270178 10:4499809-4499831 AGCAGCAGGAGGACACCAGCAGG + Intergenic
1069623600 10:69852988-69853010 CGCCCCAGCTGGACAGCCCCAGG - Intronic
1071486012 10:86103294-86103316 GGCCCCAGGAGGTCAGCCTCAGG - Intronic
1071731603 10:88253814-88253836 CGCCCCAGGGGGACAAACCCAGG - Intergenic
1076794371 10:132791512-132791534 CCTCCCAGGAGGACACCCGGGGG + Intergenic
1077185398 11:1233461-1233483 GGCCCTGGGAGGACACCTGCTGG + Intronic
1078527467 11:12111355-12111377 AGGCCCAGGAGCACCCCCGCAGG + Intronic
1083681092 11:64352215-64352237 AGTCCCAGGAGGAGACCCGCGGG + Exonic
1083890059 11:65591553-65591575 CCCCCCAGAAGGACCCCCGAAGG - Intronic
1087465130 11:98494870-98494892 CCCCACAGGAGGACACTCGGAGG - Intergenic
1088604216 11:111512806-111512828 CGGCCCCCGAGGACACCCCCGGG - Intergenic
1089733902 11:120536612-120536634 GGCCCAAGGACGACACCCTCTGG - Intronic
1092871820 12:12812347-12812369 GGCCACAGGAGGGCACTCGCTGG + Intronic
1114076618 14:19164714-19164736 AGCCCCAGGAGGACACTCAAGGG - Intergenic
1114085547 14:19234854-19234876 GGCCCCAGGAGGACACTCAAGGG + Intergenic
1115235844 14:31207822-31207844 CGCCCCAGGTGGCCGCCGGCGGG - Intergenic
1119178020 14:72583837-72583859 CAGCCATGGAGGACACCCGCCGG + Intergenic
1122399317 14:101457963-101457985 AGCCCCAGGTGCACACACGCAGG + Intergenic
1124654851 15:31499741-31499763 CGCCCCAGGAGGATCCCAGTGGG + Intronic
1128251376 15:66166390-66166412 CACCCCAGGAGCACCCCCACTGG + Intronic
1129300764 15:74624218-74624240 CACCCCAGGAGGCCATCTGCAGG - Intronic
1129661193 15:77554022-77554044 GGCCCCAGGAGGACAGGCCCAGG - Intergenic
1132209347 15:100008518-100008540 GGGCCCAGGAGGACACCTGAGGG + Intronic
1132851606 16:2027257-2027279 CGCCCCAGGGGGACGCGCTCGGG - Intronic
1132854099 16:2037140-2037162 CGACCCAGGATGAGACCCACAGG - Intronic
1132976911 16:2715602-2715624 CCCCCAGGGAGGTCACCCGCAGG + Intronic
1133023394 16:2976783-2976805 CGCCCCGGAATGACACCCGCCGG + Exonic
1133328712 16:4958178-4958200 CGCCCCAGGCGAACTCCCCCTGG - Intronic
1138535331 16:57657010-57657032 AGCCCCAGGTGGATACCCACAGG - Intronic
1138544479 16:57707495-57707517 GGACCCAGGAGTGCACCCGCAGG - Exonic
1138561381 16:57802626-57802648 CGCCCCCGCAGGTCTCCCGCCGG + Intronic
1141979894 16:87543577-87543599 CACCCCTGGAGGAAACGCGCTGG - Intergenic
1143106057 17:4531135-4531157 CTTCCCATGAGGACACCCTCCGG + Intronic
1145963521 17:28901408-28901430 GGCCCCAGCAGGGCCCCCGCTGG + Intronic
1151712186 17:75813221-75813243 GGCCCCAGGAGGCCAGCCACGGG + Intronic
1152244992 17:79180793-79180815 CACCCCAGCAGAACAGCCGCGGG + Intronic
1152337834 17:79708109-79708131 GCCCCCAGGAGAGCACCCGCAGG + Intergenic
1160010928 18:75106743-75106765 CTCCCCAACAGGAGACCCGCAGG - Intergenic
1160228161 18:77027431-77027453 CTGCCCAGGGGGACACCAGCAGG - Intronic
1160529846 18:79556673-79556695 CCCCCCAGGAGAACCCCCCCAGG + Intergenic
1161354373 19:3810764-3810786 CCCCCCAGGTGGGCACACGCCGG + Exonic
1164250430 19:23470666-23470688 CACCCCAGGAGGCCACCTCCTGG - Intergenic
1167465987 19:49651396-49651418 CGCCCCAGGTGGACTCCACCCGG + Exonic
1168145772 19:54419370-54419392 TGTCCCCGGAGGACACCCCCAGG - Intronic
925150165 2:1610216-1610238 CGCCACAGCTGGACACCCGCCGG + Intergenic
925150177 2:1610269-1610291 CACCACAGCTGGACACCCGCTGG + Intergenic
925150190 2:1610322-1610344 CGCCACAGCTGGACACCCGCTGG + Intergenic
929603534 2:43219752-43219774 CTCCCCAGGAGGAGCCCTGCAGG - Intergenic
930034401 2:47076486-47076508 CGCCCAAGGAGGCCATCAGCTGG - Intronic
930476810 2:51892079-51892101 CGTCCCAGAGGGGCACCCGCTGG - Intergenic
934079191 2:88452731-88452753 CGGCCCAGGAGGAGCCGCGCCGG - Intergenic
934553789 2:95277096-95277118 CGCCCCAGGAGGACACCCGCTGG - Intronic
938291804 2:130154587-130154609 GGCCTCAGGAGGACACCCCTGGG - Intronic
938342089 2:130542373-130542395 GGTCCCAGGAGGACTCCTGCAGG - Intronic
938347743 2:130578338-130578360 GGTCCCAGGAGGACTCCTGCAGG + Intronic
938464744 2:131518377-131518399 GGCCTCAGGAGGACACCCCTGGG + Intergenic
938787162 2:134640652-134640674 CGCCCCAGGGGGACAAACCCTGG + Intronic
946396161 2:219444736-219444758 CACCCCAGGAGCTCACCCGTGGG - Exonic
947915948 2:233831568-233831590 CGTCCCAGGTGGCCACACGCTGG + Intronic
948211008 2:236193190-236193212 CTCCCCCGGAGGACACCGGCAGG - Intergenic
948420974 2:237859770-237859792 CTCCCCTAGAGGACACCGGCTGG - Intronic
948461145 2:238130582-238130604 GGCCCCTGCAGGACACCTGCAGG + Exonic
948874080 2:240818201-240818223 TGCCCGGGGAGGACACCTGCAGG + Intronic
1170873656 20:20231518-20231540 CACCCCTGGAGGTCTCCCGCAGG - Intronic
1172887524 20:38241219-38241241 TGCCCCAGAAGTACACCCACTGG + Exonic
1173251599 20:41366675-41366697 CGCTGCAGGCGGACACCCGGCGG - Exonic
1175846740 20:62063802-62063824 CGCGCCGGGAGGACTCTCGCAGG + Intronic
1176200826 20:63859549-63859571 TGCCCCAGGAGGAAACACACAGG - Intergenic
1176296661 21:5076735-5076757 GGCCCCAGCAGGGCACCCGGAGG + Intergenic
1178405828 21:32322617-32322639 GGCCCCAGCAGGACGCCCCCTGG + Intronic
1179860388 21:44185386-44185408 GGCCCCAGCAGGGCACCCGGAGG - Intergenic
1179902603 21:44401822-44401844 CGCACCAGGAGGGCACAGGCTGG - Exonic
1179994512 21:44967780-44967802 CGCCCCATGAGGACAAGCTCTGG - Intronic
1180000123 21:44991737-44991759 CTCCCCCGGAAGACACACGCTGG - Intergenic
1180292426 22:10858339-10858361 GGCCCCAGGAGGACACTCAAGGG - Intergenic
1180495232 22:15887761-15887783 GGCCCCAGGAGGACACTCAAGGG - Intergenic
1182420156 22:30245057-30245079 GGCCCCAGGAAGACAGCTGCAGG - Intronic
1183423071 22:37723527-37723549 CCACCCAAGAGGACACCCCCAGG + Exonic
1184370537 22:44079153-44079175 AGCACCAGGAGCACACCAGCAGG - Intronic
1184821019 22:46909395-46909417 CGCCCCAGGAGCACGCACCCTGG - Intronic
950045740 3:9947666-9947688 CGCCCCAGCAGGGCCCCGGCTGG - Exonic
954583348 3:51715440-51715462 TGCCCCAGGAGTACATCCGCTGG + Exonic
968905755 4:3449851-3449873 GGCCCCACGGGAACACCCGCAGG + Intergenic
969498378 4:7539214-7539236 CCCCCCAGGAGGAAACCTGAGGG + Intronic
970933073 4:21536215-21536237 AGCCTCAGCAGGACACCAGCTGG - Intronic
972418733 4:38867688-38867710 CGCCCCACGAGGAGCGCCGCGGG - Intronic
976719813 4:88158799-88158821 CTCCCCAGGCGGCCACCCGCCGG - Exonic
981128390 4:141132545-141132567 CGCCCAAGCAGGACGCCCGCGGG - Exonic
984706256 4:182849281-182849303 GGCGCCAGAAGGACACCAGCAGG - Intergenic
985481088 5:111328-111350 CTCCCCAGGATGACTCCCACTGG - Intergenic
985908414 5:2860369-2860391 CGACCGAGGAGGACACCAGGAGG - Intergenic
992013731 5:72556081-72556103 GGCCCCAGGGGGAAACCTGCTGG - Intergenic
1001559372 5:172659300-172659322 AGCCCCAGGAGAGCACCTGCGGG - Intronic
1002296099 5:178232278-178232300 CGGCCCCGGAGACCACCCGCCGG + Intronic
1002581781 5:180213032-180213054 CGCACCAGGCAGGCACCCGCAGG - Intergenic
1002636841 5:180612836-180612858 TGCACCAGGAGGACACCAGGAGG - Intronic
1004620331 6:17325672-17325694 CTCCCCAGGAGGAACCCCCCTGG - Intergenic
1007706379 6:43793818-43793840 CGCCTCAGGAGGGCATCTGCTGG - Intergenic
1008030411 6:46688173-46688195 CGTCCACGAAGGACACCCGCAGG - Exonic
1018834243 6:167471186-167471208 TGCCCCAGGAGGACAGGAGCAGG - Intergenic
1019435954 7:1022203-1022225 CGTCCCACGAGGACAGACGCAGG + Intronic
1022728065 7:32998579-32998601 CACACCAGGAAGACACCAGCAGG - Intronic
1025045588 7:55689440-55689462 CACACCAGGAAGACACCAGCAGG + Intergenic
1029535345 7:101154569-101154591 CGGCCCCCGAGGACCCCCGCAGG - Intronic
1029600736 7:101562036-101562058 CGCTCCAGGTGGGCACCCTCAGG + Intergenic
1031483771 7:122305877-122305899 CCCCCCAGCCGAACACCCGCCGG + Intronic
1032947781 7:136871354-136871376 CCCGCCAGGAGCCCACCCGCGGG + Intronic
1033723187 7:144084085-144084107 CCCCACAGGAGGACACCCCGGGG - Intergenic
1034881797 7:154768199-154768221 GGCACCAGGAGGAGACCAGCTGG - Intronic
1034956729 7:155339635-155339657 CAGCCCAGGAGGACTCCGGCCGG - Intergenic
1035593846 8:838843-838865 CTCCCCAGGAAGTCACCAGCAGG - Intergenic
1036645792 8:10611006-10611028 CTCCCCAGGAGGGCTCCCTCTGG + Exonic
1040490723 8:47919540-47919562 CGCCGCGGGAGGGCACCTGCCGG + Intronic
1042546218 8:69953963-69953985 AGGCCCAGCAGGACCCCCGCGGG + Intergenic
1049189359 8:141278422-141278444 CGACCCACGAGGACACTGGCGGG + Intronic
1055769869 9:79705448-79705470 CGGCCCTGTAGGACACCAGCAGG - Intronic
1060744809 9:126124220-126124242 CGCCCCAGGAGGACTGCTGAAGG + Intergenic
1062254637 9:135615158-135615180 AGCCCCAGCAGGCCACCCTCTGG - Intergenic
1062418862 9:136469255-136469277 CGCTCCAGGAGCACACACACGGG - Intronic
1062633991 9:137480426-137480448 GGCAGCAGGAGGACACCCACAGG - Exonic
1197774238 X:130109751-130109773 CGGCCCAGGAGGGAACCCGGAGG + Intronic
1200239627 X:154486777-154486799 CGCCCCGGGAGGAGTCCCCCCGG + Intergenic