ID: 934553944

View in Genome Browser
Species Human (GRCh38)
Location 2:95277708-95277730
Sequence CAGTGGGTGGAGTGCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 195}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934553936_934553944 6 Left 934553936 2:95277679-95277701 CCACCCAGGGTTAATGCGGGTCA 0: 1
1: 0
2: 0
3: 3
4: 60
Right 934553944 2:95277708-95277730 CAGTGGGTGGAGTGCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 195
934553931_934553944 17 Left 934553931 2:95277668-95277690 CCTTGCTCCACCCACCCAGGGTT 0: 1
1: 0
2: 3
3: 42
4: 331
Right 934553944 2:95277708-95277730 CAGTGGGTGGAGTGCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 195
934553932_934553944 10 Left 934553932 2:95277675-95277697 CCACCCACCCAGGGTTAATGCGG 0: 1
1: 0
2: 0
3: 4
4: 84
Right 934553944 2:95277708-95277730 CAGTGGGTGGAGTGCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 195
934553926_934553944 29 Left 934553926 2:95277656-95277678 CCAATGTTCCTCCCTTGCTCCAC 0: 1
1: 0
2: 3
3: 21
4: 337
Right 934553944 2:95277708-95277730 CAGTGGGTGGAGTGCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 195
934553927_934553944 21 Left 934553927 2:95277664-95277686 CCTCCCTTGCTCCACCCACCCAG 0: 1
1: 0
2: 26
3: 86
4: 671
Right 934553944 2:95277708-95277730 CAGTGGGTGGAGTGCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 195
934553938_934553944 2 Left 934553938 2:95277683-95277705 CCAGGGTTAATGCGGGTCATCCT 0: 1
1: 0
2: 0
3: 1
4: 47
Right 934553944 2:95277708-95277730 CAGTGGGTGGAGTGCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 195
934553930_934553944 18 Left 934553930 2:95277667-95277689 CCCTTGCTCCACCCACCCAGGGT 0: 1
1: 0
2: 1
3: 46
4: 317
Right 934553944 2:95277708-95277730 CAGTGGGTGGAGTGCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 195
934553935_934553944 7 Left 934553935 2:95277678-95277700 CCCACCCAGGGTTAATGCGGGTC 0: 1
1: 0
2: 0
3: 0
4: 47
Right 934553944 2:95277708-95277730 CAGTGGGTGGAGTGCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 195
934553925_934553944 30 Left 934553925 2:95277655-95277677 CCCAATGTTCCTCCCTTGCTCCA 0: 1
1: 0
2: 1
3: 29
4: 301
Right 934553944 2:95277708-95277730 CAGTGGGTGGAGTGCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 195
934553937_934553944 3 Left 934553937 2:95277682-95277704 CCCAGGGTTAATGCGGGTCATCC 0: 1
1: 0
2: 1
3: 1
4: 26
Right 934553944 2:95277708-95277730 CAGTGGGTGGAGTGCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934553944 Original CRISPR CAGTGGGTGGAGTGCTCCCC AGG Intronic