ID: 934553944

View in Genome Browser
Species Human (GRCh38)
Location 2:95277708-95277730
Sequence CAGTGGGTGGAGTGCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 195}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934553931_934553944 17 Left 934553931 2:95277668-95277690 CCTTGCTCCACCCACCCAGGGTT 0: 1
1: 0
2: 3
3: 42
4: 331
Right 934553944 2:95277708-95277730 CAGTGGGTGGAGTGCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 195
934553932_934553944 10 Left 934553932 2:95277675-95277697 CCACCCACCCAGGGTTAATGCGG 0: 1
1: 0
2: 0
3: 4
4: 84
Right 934553944 2:95277708-95277730 CAGTGGGTGGAGTGCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 195
934553935_934553944 7 Left 934553935 2:95277678-95277700 CCCACCCAGGGTTAATGCGGGTC 0: 1
1: 0
2: 0
3: 0
4: 47
Right 934553944 2:95277708-95277730 CAGTGGGTGGAGTGCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 195
934553926_934553944 29 Left 934553926 2:95277656-95277678 CCAATGTTCCTCCCTTGCTCCAC 0: 1
1: 0
2: 3
3: 21
4: 337
Right 934553944 2:95277708-95277730 CAGTGGGTGGAGTGCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 195
934553938_934553944 2 Left 934553938 2:95277683-95277705 CCAGGGTTAATGCGGGTCATCCT 0: 1
1: 0
2: 0
3: 1
4: 47
Right 934553944 2:95277708-95277730 CAGTGGGTGGAGTGCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 195
934553936_934553944 6 Left 934553936 2:95277679-95277701 CCACCCAGGGTTAATGCGGGTCA 0: 1
1: 0
2: 0
3: 3
4: 60
Right 934553944 2:95277708-95277730 CAGTGGGTGGAGTGCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 195
934553930_934553944 18 Left 934553930 2:95277667-95277689 CCCTTGCTCCACCCACCCAGGGT 0: 1
1: 0
2: 1
3: 46
4: 317
Right 934553944 2:95277708-95277730 CAGTGGGTGGAGTGCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 195
934553927_934553944 21 Left 934553927 2:95277664-95277686 CCTCCCTTGCTCCACCCACCCAG 0: 1
1: 0
2: 26
3: 86
4: 671
Right 934553944 2:95277708-95277730 CAGTGGGTGGAGTGCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 195
934553937_934553944 3 Left 934553937 2:95277682-95277704 CCCAGGGTTAATGCGGGTCATCC 0: 1
1: 0
2: 1
3: 1
4: 26
Right 934553944 2:95277708-95277730 CAGTGGGTGGAGTGCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 195
934553925_934553944 30 Left 934553925 2:95277655-95277677 CCCAATGTTCCTCCCTTGCTCCA 0: 1
1: 0
2: 1
3: 29
4: 301
Right 934553944 2:95277708-95277730 CAGTGGGTGGAGTGCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934553944 Original CRISPR CAGTGGGTGGAGTGCTCCCC AGG Intronic
900610989 1:3544586-3544608 CGGTGTGTGGAGCACTCCCCAGG - Intronic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
900711862 1:4119531-4119553 CGGTGGATGGAGAGCTGCCCAGG - Intergenic
901123336 1:6912450-6912472 CAGAGGATAGAGTGGTCCCCAGG - Intronic
901609905 1:10489760-10489782 AAGTGGGTGGCGTGCTCTGCTGG + Intronic
903140391 1:21335570-21335592 CAGTGGGTGGGGGGCTCTCACGG + Intronic
910118714 1:83760927-83760949 CAGTGGTAGCAGAGCTCCCCAGG - Intergenic
911053789 1:93694194-93694216 CACAGGGTGGGGAGCTCCCCTGG + Intronic
912362931 1:109109964-109109986 GAGTGGGAGGAGTGCTGCTCAGG - Intronic
913039603 1:115009587-115009609 CAGTGGGTGCAGTGCATCCCTGG - Intergenic
914195945 1:145448269-145448291 CCGTGGTTGGAAAGCTCCCCCGG + Intergenic
914918883 1:151834330-151834352 CAGTGGGTTGAGGCGTCCCCAGG - Intergenic
916127977 1:161588439-161588461 CTGTGGGTGGAGTACTTACCAGG - Intronic
916137895 1:161670269-161670291 CTGTGGGTGGAGTACTTACCAGG - Exonic
916440190 1:164817286-164817308 CAGTGGATCGTGTGCTTCCCAGG + Intronic
922494017 1:226041908-226041930 GGGTGGCTGGACTGCTCCCCGGG + Intergenic
923834084 1:237590782-237590804 CGGTGGCTGGAGGGCTCCCTGGG + Exonic
1065124132 10:22556726-22556748 CAGTGGGTTCACTGCTCCCTAGG - Intronic
1065426880 10:25615380-25615402 CAGTGGGTAGAGTGCTAAACAGG - Intergenic
1068607851 10:59025922-59025944 CTGGGGGTGGAGCCCTCCCCAGG - Intergenic
1076891871 10:133288656-133288678 CAGTGGGTGGTGTAGGCCCCCGG - Intronic
1077058743 11:608563-608585 CAGTGGGTGAGGAGCGCCCCAGG + Exonic
1077150652 11:1071671-1071693 GGGCGGGTGGAGTGCTCTCCAGG + Intergenic
1080574331 11:33584416-33584438 CAGTGGGTGGATGGGGCCCCAGG - Intronic
1082710304 11:56546969-56546991 CTGTGGGTGGAGCCCTCACCAGG - Intergenic
1082825662 11:57576279-57576301 CAGTGGGTGAAATGGTCCCTGGG - Intergenic
1083506578 11:63163495-63163517 CACTGGGCTGAGGGCTCCCCAGG + Intronic
1085435018 11:76492748-76492770 CAGTGGGTGCAGTGGACTCCAGG + Intronic
1086974485 11:93116702-93116724 CACTGGGAGGAGTGCACACCTGG + Intergenic
1087370237 11:97274345-97274367 CACTGGGTGGATTTCTCCCTAGG - Intergenic
1088882602 11:113983346-113983368 CTGAGCGAGGAGTGCTCCCCAGG + Intronic
1090269515 11:125376276-125376298 CAGTGGGCGGTGTGTTCGCCTGG - Intronic
1090458025 11:126866528-126866550 CAGAGGGTGGAGCCCCCCCCAGG - Intronic
1091329497 11:134720004-134720026 CAGTGGCTGGAAGGCCCCCCAGG - Intergenic
1091577983 12:1757218-1757240 CAGTGGGTGAAATGGTCCCTGGG - Intronic
1092191861 12:6526987-6527009 CAGTGAGTGGAGAGCTCTGCCGG + Exonic
1096493833 12:52027670-52027692 ATGTGGGTGGAGTGCAGCCCTGG - Intronic
1097843519 12:64343967-64343989 CAGTGGGTCCAGTGGGCCCCTGG - Intronic
1098180376 12:67840519-67840541 CAGTGGGTGGGATACACCCCAGG + Intergenic
1100965494 12:100009036-100009058 CAGTGGGTGAAATGGTCCCTGGG - Intergenic
1101440964 12:104704106-104704128 CAGTGTGTGCATTGCTTCCCAGG - Intronic
1102414570 12:112749337-112749359 CAGGGTGTGGGGTGCTTCCCTGG + Intronic
1105383156 13:19905908-19905930 CAGTGGGAGGATTGCCTCCCAGG + Intergenic
1105405490 13:20128873-20128895 GAGGGGGTGGAGTGGTCCCGTGG - Intergenic
1108137871 13:47385316-47385338 CTGTGGGTGGTATGCTCTCCAGG - Intergenic
1108542951 13:51461304-51461326 CAGTGGGTGAAATGGTCCCAGGG + Intergenic
1112605785 13:100904495-100904517 CACTGGGAGGAGTGCACACCAGG - Intergenic
1113560856 13:111279510-111279532 CAGCTGATGGAGTGCTCCCCAGG + Intronic
1113641250 13:111958788-111958810 CAGTGGGTGGTGGGCACCCACGG + Intergenic
1119032380 14:71202881-71202903 GAGTCTGTTGAGTGCTCCCCGGG + Intergenic
1119924082 14:78474959-78474981 CAGTGGGTCTAGTGTACCCCAGG + Intronic
1121331775 14:93054110-93054132 CAGTGGGTCAAGTGCTAGCCTGG + Intronic
1122027732 14:98889710-98889732 CAGTGGGTGCTGTGCTGGCCGGG + Intergenic
1122299057 14:100721743-100721765 CTGTGCGTGGGGTGCTCCCAGGG - Intergenic
1122775007 14:104113224-104113246 CAGGGGCTGGAATGGTCCCCAGG - Exonic
1123008721 14:105336915-105336937 CACAGGGTGGAGATCTCCCCTGG - Intronic
1123998157 15:25733397-25733419 CTGGGGCTGGAGTGCTCCCTCGG - Intronic
1124371739 15:29108044-29108066 CAGAGGGCGCAGTGCTGCCCTGG + Intronic
1128510887 15:68313491-68313513 CAGTGGGAGGCGTCCACCCCTGG - Intronic
1129519709 15:76178022-76178044 GAGTGGGTGCAGTGCCCCCGGGG + Intronic
1133317529 16:4893665-4893687 CAGGGGGTGGTGGGCTGCCCAGG - Intronic
1135729497 16:24882445-24882467 CCGTGGGTGAGGTGCTCTCCAGG - Intronic
1137569311 16:49554511-49554533 CAGTGGGTGGTGAGCACCCAGGG + Intronic
1139758697 16:69166611-69166633 AAGTGACTGGAGTTCTCCCCAGG - Intronic
1146278968 17:31532813-31532835 CAGTGCAGCGAGTGCTCCCCTGG - Exonic
1146375130 17:32288728-32288750 AAGTGGGTGGGGAGCTCCGCTGG + Intronic
1147303590 17:39548637-39548659 CAGTGGCTGGAATACACCCCAGG + Intronic
1148496403 17:48055629-48055651 CAGGGGGTGGGGTGCACCCCTGG + Intronic
1151164379 17:72191521-72191543 CAGTTGGTGGTGTGTTCCCCGGG + Intergenic
1151340935 17:73470522-73470544 CAGCGGCTGGAGGGCTCCCCGGG - Intronic
1151930676 17:77229794-77229816 CAGAGGATGGGGTGCTCCTCAGG + Intergenic
1152552265 17:81035572-81035594 CGGAGCGGGGAGTGCTCCCCGGG - Intronic
1152557938 17:81063893-81063915 CAGTGGGTGGAGCCCCTCCCAGG + Intronic
1153980494 18:10304821-10304843 CACTGGGTGGAGAGCTCCCTGGG - Intergenic
1154014496 18:10604401-10604423 CCGTGGGTGCAGCTCTCCCCAGG - Intergenic
1157871136 18:51231129-51231151 CAGTGGGTCCAGTGCGTCCCTGG - Intergenic
1161444508 19:4310786-4310808 CAGTGGGTGGGGTCTTCCCATGG - Intronic
1161949253 19:7458701-7458723 CAGTGGGTGGGGAGACCCCCAGG - Intronic
1161949523 19:7460065-7460087 CAGAGGGTGAACTGCCCCCCAGG + Intronic
1164621428 19:29697945-29697967 CTGTGGGTGGAGGGGTCTCCAGG - Intergenic
1165741424 19:38207284-38207306 CGCGGGGTGCAGTGCTCCCCGGG - Exonic
1166738674 19:45101239-45101261 CAGTGGGAGGAGTGCACCAGGGG + Intronic
926181004 2:10642871-10642893 CAGTGTGAGGAGTGCTACCAGGG - Intronic
926802235 2:16668615-16668637 CAGTGGGTGGAGAGGAGCCCTGG - Intergenic
926953478 2:18269489-18269511 CAGTGGCTGGAGTCCTCCTGTGG + Intronic
927567191 2:24123493-24123515 CAGGGGGCGGAGTGCTCGCGCGG + Exonic
928884057 2:36128584-36128606 CTGTAGGTGGATTGTTCCCCTGG - Intergenic
931056098 2:58473323-58473345 CAGCGGGTGGAGTGTTTGCCAGG + Intergenic
932439070 2:71720364-71720386 TGGTGAGTGGATTGCTCCCCTGG + Intergenic
932927547 2:75994323-75994345 GTGTGGGTGGAGTGATCCTCAGG + Intergenic
933140951 2:78792537-78792559 CTGAGGGTGGAGCCCTCCCCAGG + Intergenic
934553944 2:95277708-95277730 CAGTGGGTGGAGTGCTCCCCAGG + Intronic
936791610 2:116159368-116159390 TAGAGGTTGGAGTCCTCCCCTGG + Intergenic
943049129 2:182894340-182894362 GAGTGGGTAGAGTGAGCCCCAGG + Intergenic
943731254 2:191305780-191305802 CAGTAAGTGGTGTGGTCCCCTGG + Intronic
948046412 2:234949097-234949119 AAGTGGGTACAGTGCTCCCCAGG - Intergenic
948142703 2:235685494-235685516 CAGAGGCTGTAATGCTCCCCTGG + Intronic
948266820 2:236641075-236641097 CACTGGGAGCAGTGCTGCCCTGG + Intergenic
1170553005 20:17493342-17493364 CAGTGGGAGGTGTGCTCTCTGGG - Intergenic
1171311699 20:24150158-24150180 CAGTGGAGGGAGTGCTCTCTGGG - Intergenic
1172470890 20:35194455-35194477 CAGTGGCTGGAGTGATGTCCTGG + Intergenic
1175426688 20:58871903-58871925 CAGGGGGTGGAGCGCTGCCAAGG + Intronic
1175897525 20:62345997-62346019 CAGGGGGTGGAGGGGTTCCCCGG - Intronic
1176032736 20:63021540-63021562 CAGCGGGCAGAGTGCTCTCCAGG - Intergenic
1177933853 21:27318141-27318163 CAGTGGGTGCAGTGGGTCCCTGG - Intergenic
1180722448 22:17919670-17919692 CAGCGGGGGAGGTGCTCCCCTGG + Intronic
1180725974 22:17946865-17946887 CAGAGGGAGGGGTGTTCCCCAGG - Intronic
1181031487 22:20150449-20150471 CGGTGGGTGGGGTGCTCACCAGG + Exonic
1181291309 22:21795678-21795700 CGGTGGGTGGATTACTCGCCAGG - Intronic
1183369232 22:37423135-37423157 CAGCGCTTGGAGGGCTCCCCCGG - Intronic
1183465004 22:37975321-37975343 CAGCGGGTGGACTCCTCCTCTGG - Intronic
1183774978 22:39958125-39958147 CAGTGGGAGGGGGGATCCCCAGG - Intronic
1184512548 22:44942033-44942055 CAGTGGGGGGAATGCGGCCCTGG + Intronic
1184778122 22:46633371-46633393 CATTAGGTGGGGGGCTCCCCAGG - Intronic
949880113 3:8654886-8654908 CAGTGGGTGGCCTCTTCCCCCGG + Intronic
949880180 3:8655137-8655159 CAGTGGGTGGCCTCTTCCCCCGG + Intronic
949880247 3:8655388-8655410 CAGTGGGTGGCCTCATCCCCCGG + Intronic
949880260 3:8655439-8655461 CAGTGGGTGGCCTCTTCCCCCGG + Intronic
949880272 3:8655490-8655512 CAGTGGGTGGCCTCTTCCCCCGG + Intronic
952709528 3:36415598-36415620 CAGTGGGTGCAGTGCACCAACGG - Intronic
952834439 3:37591419-37591441 CAGTGGACTGAGTGCCCCCCTGG + Intronic
953932181 3:47010932-47010954 AACTGGGTGGAATGCTACCCTGG - Intergenic
954360478 3:50120006-50120028 CAGTGAGTGGAGTGCTGCCAGGG - Intergenic
954391101 3:50268298-50268320 CAGAGGGAGAAGTGCTACCCAGG - Intronic
961041267 3:123680076-123680098 CAGTGGTTTAAATGCTCCCCAGG + Intronic
961511355 3:127405774-127405796 CAGTGGGTGGAATAATCACCAGG - Intergenic
962428903 3:135301472-135301494 CAGTGGGTGGAGAGCAAGCCAGG - Intergenic
963239931 3:142992721-142992743 CCGGGGGTGGAGTCCTCACCAGG + Intronic
966152323 3:176877985-176878007 CAGGGGGTCGAGGGCTCACCAGG - Intergenic
967112924 3:186311099-186311121 CAGTGTGTATAGAGCTCCCCAGG - Intronic
967657118 3:192063752-192063774 CACTGGGAGGAGTGCGCCCTGGG + Intergenic
968706550 4:2080933-2080955 CAGTGGGTGGTGGTCTCCCAGGG - Intronic
968842972 4:3021581-3021603 CAAGGGGTGGATTGCTGCCCTGG + Intronic
969581506 4:8068163-8068185 CAGTGGGCGCACGGCTCCCCAGG + Intronic
970696759 4:18686854-18686876 CTGGGTGTGCAGTGCTCCCCAGG - Intergenic
982436219 4:155384942-155384964 CAGCTGGTGGGGTGCTACCCTGG - Intergenic
986679360 5:10219631-10219653 CAGGGGATGGAGTGAGCCCCTGG + Intergenic
988188625 5:27900017-27900039 CAGTGGGTCCAGTGGTTCCCTGG + Intergenic
988772999 5:34450525-34450547 AAGTGTTTGGAGTTCTCCCCTGG - Intergenic
989027655 5:37085843-37085865 CAGTGGGTGAAATGGTCCCTGGG + Intergenic
989045379 5:37268809-37268831 CAGTGGGTCCAGTGGGCCCCTGG - Intergenic
989476003 5:41873416-41873438 CAGTTGATGGTGTACTCCCCAGG + Intergenic
993018656 5:82564485-82564507 CAGGGGGTTGAGGGCTCACCAGG - Intergenic
993340218 5:86716338-86716360 CAGTGCCTGGAGTGCTTCACAGG - Intergenic
993903292 5:93598465-93598487 CTGGGGTTGGAATGCTCCCCAGG + Intergenic
994316414 5:98338940-98338962 CAGTTGGTGCCGTGCTCCACAGG - Intergenic
996825405 5:127676617-127676639 CAGTGGGTGAAGTGGGTCCCCGG + Intergenic
998505632 5:142669843-142669865 CAGAGTGTGGAGTGACCCCCAGG - Intronic
1000532764 5:162444427-162444449 CAGGGGGTGGAGCCCTCACCAGG - Intergenic
1001211882 5:169817544-169817566 CAGTGGGAGGAGTGTTAACCAGG - Intronic
1001333257 5:170777274-170777296 GAGTGGGTGGAGACCTCCCCTGG + Intronic
1001967873 5:175925309-175925331 CATTGGGTGGAGTACTCACAAGG + Intronic
1002342147 5:178524254-178524276 CAGTGTGAAGAGGGCTCCCCTGG - Intronic
1002603997 5:180371295-180371317 CAGTGGGTGGATTGGTCCAAAGG - Intergenic
1002919339 6:1555203-1555225 CAGGGGGCGGTGTGCGCCCCCGG - Intergenic
1003476432 6:6488119-6488141 CCGGGGGTGGGGTGCTGCCCTGG - Intergenic
1004373409 6:15072206-15072228 CAGTGAGTGGAGTGCACCCAGGG - Intergenic
1004982913 6:21046411-21046433 CAGTGGGTAGTGGGCTCCCTTGG + Intronic
1007102816 6:39261704-39261726 AAGGGGGAGGAGTCCTCCCCAGG - Intergenic
1007358205 6:41335881-41335903 CAGTGGGTGTAGGGCTCGCCAGG - Exonic
1007821557 6:44564092-44564114 CAGTGAGAGGAGTCGTCCCCAGG - Intergenic
1017453548 6:154577070-154577092 CAGTGGGTGAAGTGGTCCCTGGG + Intergenic
1018455394 6:163947245-163947267 CAGTGGCTGGACTTTTCCCCTGG + Intergenic
1018681587 6:166270090-166270112 CTGAGGGAAGAGTGCTCCCCAGG + Intergenic
1018825264 6:167404090-167404112 GGGTGGATGGAGTGCTCTCCTGG + Intergenic
1019330487 7:458369-458391 CAGTGGGGGCAGGGGTCCCCTGG + Intergenic
1019492224 7:1320966-1320988 CAGGGGGTGGGGAGCTCCTCAGG - Intergenic
1019651834 7:2163748-2163770 CAGGGCGTCCAGTGCTCCCCAGG - Intronic
1020710178 7:11596402-11596424 CAGTGGGTCCAGTGGTTCCCGGG + Intronic
1022808974 7:33850412-33850434 CAGTGGGATGAGGGCTCCCCAGG - Intergenic
1024461643 7:49665893-49665915 CAGTGGGTGCAGTGCACCGTGGG + Intergenic
1028141582 7:87280765-87280787 CAGTGGGTTGAGTGAGTCCCTGG + Intergenic
1028869680 7:95755713-95755735 CAGTGGGTGGAGTGAAACCACGG + Intergenic
1031826314 7:126570497-126570519 CAGTGGGTGGATTGCTGTCTAGG - Intronic
1032402020 7:131630205-131630227 GAGTGGGTGGGGTTCCCCCCTGG + Intergenic
1033464367 7:141577698-141577720 CACTGGGTGGAGTGCACACTGGG - Intronic
1035973540 8:4281139-4281161 CAGTGGGTCAGGTGCTCCCGAGG - Intronic
1037573489 8:20179092-20179114 CACTGGGTGCAGTGCCCCGCAGG - Intronic
1037689153 8:21168341-21168363 CAGGGGTTGGAGAGCTCCCGGGG - Intergenic
1040368744 8:46747134-46747156 TAGTGGGTGGGGTGGTCTCCAGG + Intergenic
1041952329 8:63517576-63517598 CATTGGGTGCAGTGCACCCGTGG + Intergenic
1042517972 8:69679559-69679581 CGGTGGGTGGAGTGATCACTTGG + Exonic
1043937331 8:86156554-86156576 GAGGGGGTGGAGGGCTCTCCAGG - Intergenic
1046407740 8:113796655-113796677 GTGTGTGTGGTGTGCTCCCCGGG + Intergenic
1047151172 8:122264794-122264816 AAGTGTTTGGAGTTCTCCCCTGG + Intergenic
1048448720 8:134512564-134512586 TACTGGGTGGAGGGCTCCTCAGG + Exonic
1048970979 8:139644866-139644888 CAGGGGGTGGACAGCTCCGCGGG - Intronic
1049208705 8:141375471-141375493 CAGTGGGGGCTGAGCTCCCCTGG - Intergenic
1049466877 8:142755410-142755432 CAGTGGGTGGGATGGTACCCAGG + Intergenic
1050243011 9:3658351-3658373 GAATGGGTGTAGTGATCCCCAGG + Intergenic
1056381848 9:86063102-86063124 CAGTGTGTGGGGTGCTCCTCTGG - Intronic
1056836867 9:89962561-89962583 GAGTTGATGGAGTGCTCCCAGGG + Intergenic
1056927732 9:90848997-90849019 CTGTGGGTGCCCTGCTCCCCAGG - Intronic
1057035986 9:91811889-91811911 GAGTGTGTGGGGAGCTCCCCTGG - Intronic
1059241702 9:112811480-112811502 CAGTAGGTGGAGTGCCCTGCTGG + Intronic
1059651266 9:116318514-116318536 CAGTGGTTTGGGTGCTCCCAGGG - Intronic
1060967583 9:127720512-127720534 CAGTGGGTGCTGTCCTCCCTGGG + Intronic
1062172083 9:135140449-135140471 GAGTTGGTGGAGAGGTCCCCAGG - Intergenic
1062443652 9:136584418-136584440 CAGTGGGTGCTGTGGTCCCATGG - Intergenic
1062698786 9:137888553-137888575 CCGTGGTTGGAAAGCTCCCCCGG - Intronic
1203787699 EBV:136922-136944 TAGAGGGTGGCGTCCTCCCCCGG - Intergenic
1186100736 X:6153677-6153699 CAGTGGGTGGACTTCTTCCAAGG + Intronic
1187885615 X:23886149-23886171 CAGTGGGAGAGTTGCTCCCCAGG - Intronic
1190266796 X:48831678-48831700 CAGTGGGGGAAGTGGACCCCAGG - Intronic
1190434274 X:50408152-50408174 CAGAGGGTGGAGTTGTCTCCTGG + Intronic
1194833794 X:98657582-98657604 CAGTGGGTCCAGTGGTTCCCAGG + Intergenic
1199997059 X:153032114-153032136 CAATGTGTGGCTTGCTCCCCAGG + Intergenic
1201498819 Y:14619227-14619249 CAGTGGGTAGATTTCTTCCCAGG - Intronic
1201799934 Y:17944324-17944346 CAGTGGGTGCAGTGCACCGAGGG + Intergenic
1201801619 Y:17961632-17961654 CAGTGGGTGCAGTGCACCGAGGG - Intergenic
1202143174 Y:21750540-21750562 CAGTGGATGGAATACTCCCATGG - Intergenic