ID: 934554553

View in Genome Browser
Species Human (GRCh38)
Location 2:95280462-95280484
Sequence TCTTAGACCAGGGGGCTCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 65}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934554553_934554559 1 Left 934554553 2:95280462-95280484 CCTTCGAGCCCCCTGGTCTAAGA 0: 1
1: 0
2: 0
3: 5
4: 65
Right 934554559 2:95280486-95280508 CTTTACTCCTCAGACCTGCTGGG 0: 1
1: 0
2: 0
3: 19
4: 166
934554553_934554558 0 Left 934554553 2:95280462-95280484 CCTTCGAGCCCCCTGGTCTAAGA 0: 1
1: 0
2: 0
3: 5
4: 65
Right 934554558 2:95280485-95280507 TCTTTACTCCTCAGACCTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 180
934554553_934554565 30 Left 934554553 2:95280462-95280484 CCTTCGAGCCCCCTGGTCTAAGA 0: 1
1: 0
2: 0
3: 5
4: 65
Right 934554565 2:95280515-95280537 CCCTGTCGGCAGGTCATGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 83
934554553_934554562 16 Left 934554553 2:95280462-95280484 CCTTCGAGCCCCCTGGTCTAAGA 0: 1
1: 0
2: 0
3: 5
4: 65
Right 934554562 2:95280501-95280523 CTGCTGGGATTCTGCCCTGTCGG 0: 1
1: 0
2: 1
3: 30
4: 269
934554553_934554563 20 Left 934554553 2:95280462-95280484 CCTTCGAGCCCCCTGGTCTAAGA 0: 1
1: 0
2: 0
3: 5
4: 65
Right 934554563 2:95280505-95280527 TGGGATTCTGCCCTGTCGGCAGG 0: 1
1: 0
2: 0
3: 25
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934554553 Original CRISPR TCTTAGACCAGGGGGCTCGA AGG (reversed) Intronic