ID: 934555023

View in Genome Browser
Species Human (GRCh38)
Location 2:95282516-95282538
Sequence GACTGAGGACAGGCATTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934555023 Original CRISPR GACTGAGGACAGGCATTGGC TGG Intronic
900048736 1:529325-529347 GACAGAGGAGAGGCAGGGGCAGG + Intergenic
900070967 1:771149-771171 GACAGAGGAGAGGCAGGGGCAGG + Intergenic
900828775 1:4949098-4949120 GGCTGAGGACAGGCATCTGAGGG + Intergenic
902645214 1:17793049-17793071 CACTCAGGACAGGCTTGGGCAGG - Intronic
903248487 1:22034557-22034579 GCCTGAGGCCAGGGATTGGAGGG - Intergenic
903742386 1:25565766-25565788 GGCTGAGGAGAGGCCTGGGCAGG + Intronic
906215087 1:44033927-44033949 GACTGAGGACAGACTGGGGCAGG + Intergenic
906531341 1:46525680-46525702 GACTGAGGAAAGCCAGGGGCTGG + Intergenic
907351959 1:53839253-53839275 GACTAAGGAAATGCATAGGCTGG + Intergenic
910871241 1:91835078-91835100 GACAGGGGATAGGCAGTGGCTGG - Intronic
913003663 1:114607036-114607058 GGCTGGGCACAGGCATTGGGAGG - Intronic
913365763 1:118036698-118036720 GACTGAGAATGGGCAGTGGCAGG + Intronic
918098574 1:181354362-181354384 GGCTGAGGACAAGGAGTGGCAGG + Intergenic
918143765 1:181738520-181738542 TACTGAGGGCTGCCATTGGCTGG - Intronic
919920109 1:202162338-202162360 GACTGAGGCCTAGCAGTGGCTGG + Intergenic
920290103 1:204915972-204915994 GACTGATGACAGGGAGTGTCTGG - Intronic
921767546 1:218990192-218990214 GACTGAGGTGTGGCACTGGCAGG + Intergenic
922106331 1:222516599-222516621 GACAGAGGACAGGCAGGGGCAGG + Intergenic
923092977 1:230753667-230753689 GACTGAGGAGGGGCCTGGGCTGG - Intronic
924348511 1:243094164-243094186 GACAGAGGAGAGGCAGGGGCAGG + Intergenic
924384372 1:243488176-243488198 GACTGAGGGCAGCCAGAGGCCGG + Intronic
1063121465 10:3107777-3107799 GCCTGGGAACAGGCTTTGGCAGG + Intronic
1063479808 10:6365459-6365481 CACTGAAGGAAGGCATTGGCTGG - Intergenic
1066094798 10:32061690-32061712 GAATTAGGACAGGCCTTAGCTGG - Intergenic
1066727848 10:38410737-38410759 GACAGAGGAGAGGCAGGGGCAGG - Intergenic
1068989102 10:63133190-63133212 GAATGAGGACAGGCAGTGGGTGG - Intergenic
1071480998 10:86064889-86064911 GTCTGAGGAAATGCATTTGCAGG - Intronic
1072685161 10:97532282-97532304 GACTCAGGAAAGGCTTTGGGAGG - Intronic
1072710914 10:97714909-97714931 AGCTGAGGACAGGCCTTGGCTGG + Exonic
1076110617 10:127856465-127856487 GAGTGAAGACAGACATTGGGAGG - Intergenic
1076742528 10:132493870-132493892 GAGTGGGGACAGTCATTGGCAGG - Intergenic
1076807225 10:132864946-132864968 CACTGAGGACAGGTATGTGCAGG - Intronic
1077395378 11:2317919-2317941 GACTGACGTCAGGCCTTGGTGGG + Exonic
1077711493 11:4541602-4541624 GACTCAGGAAAGGCATTCTCTGG + Intergenic
1078452182 11:11448751-11448773 GTCTGAGGTCAGGCAGGGGCCGG + Exonic
1083201934 11:61125908-61125930 GACTGAGGGGAGGCATTGAGTGG - Intronic
1085634938 11:78151463-78151485 GCCTGAGGCCAGGCATTTTCAGG + Intergenic
1090258036 11:125299465-125299487 GACTGAGGCCAGGGAAGGGCGGG + Intronic
1090417749 11:126552260-126552282 GACTGAGGGGAGGCACTGGCTGG - Intronic
1091694948 12:2622193-2622215 AACTGAGGACAGGCAGAGGGAGG + Intronic
1092080894 12:5715321-5715343 GACTAAGGCCAGGTTTTGGCAGG - Intronic
1097008536 12:55936224-55936246 GACAGAGGACAGACACTGTCAGG + Intronic
1103690337 12:122767880-122767902 GACAGAGGAGCAGCATTGGCTGG - Intronic
1104604272 12:130176527-130176549 GAATGTTGTCAGGCATTGGCTGG + Intergenic
1106318237 13:28614206-28614228 AAGTGAAGAAAGGCATTGGCTGG - Intergenic
1106637180 13:31541731-31541753 GACTGAGGCAAGGCATTGATGGG + Intergenic
1106724366 13:32469425-32469447 GACTGAGCACAGTCATGAGCAGG + Intronic
1112568830 13:100574976-100574998 GACTGAGGACAGACATCAGATGG - Intronic
1114587440 14:23827202-23827224 GGCTGAGGACTGGGAGTGGCTGG - Intergenic
1118334861 14:64844255-64844277 AACTGAGGACGTGCATTTGCTGG - Intronic
1118742232 14:68747994-68748016 GACTGAAAACAGGCATTAGAGGG - Intergenic
1119526160 14:75324061-75324083 GGCTGAGGACACACATTGACTGG + Intergenic
1120718959 14:87869787-87869809 GCCTGAGGTCAGTCATTGCCTGG + Intronic
1120809212 14:88785812-88785834 GACTGAAGAGAGGCAGGGGCAGG - Intronic
1121314095 14:92950923-92950945 GACAGAGCACAGGCGTGGGCAGG - Intronic
1121333453 14:93062659-93062681 GACAGAGGTCAGGCACTAGCAGG + Intronic
1121427009 14:93859634-93859656 AAAGGAGGACTGGCATTGGCAGG - Intergenic
1121627796 14:95399391-95399413 CACTGAGGACAGGCAGTGTGAGG - Intergenic
1124054472 15:26229603-26229625 TACCGAGGCCAGGCATGGGCAGG + Intergenic
1124220573 15:27846900-27846922 GGCTGAGGACAGGCAAGGGCAGG + Intronic
1124413155 15:29453134-29453156 GACTGTGGTGTGGCATTGGCAGG - Intronic
1126896614 15:53264444-53264466 GAATACGGACAGGTATTGGCAGG - Intergenic
1127331499 15:57944184-57944206 GTCTCAAGACAGGCATTGGGAGG - Intergenic
1128656362 15:69465013-69465035 TTCTGAGGACAGGGATTGGATGG + Intergenic
1130068424 15:80626375-80626397 AACTTAGCACAGGGATTGGCAGG - Intergenic
1130147626 15:81286486-81286508 GACTGAGAACAGATGTTGGCAGG + Intronic
1131437426 15:92434572-92434594 GACTGGGGCCAGGCGGTGGCAGG + Intronic
1131501276 15:92969349-92969371 GCCTGAGGACAGGGATTGCGGGG - Intronic
1133631884 16:7629644-7629666 GACTGGGGTCAGGAATTGTCAGG - Intronic
1134610820 16:15606635-15606657 GGCTGGGGGCAGGCATGGGCAGG - Intronic
1135414358 16:22257577-22257599 GACGGGGGACAGGCAGTGGTGGG - Intronic
1137443562 16:48516846-48516868 GTCTGAGGCCAGACATTGGATGG - Intergenic
1137589486 16:49684982-49685004 GCCTGAGGACAGCCATCAGCCGG - Intronic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1141421439 16:83920461-83920483 GCCTGAGAACGGGCATGGGCTGG - Exonic
1142445180 16:90131733-90131755 GACAGAGGAGAGGCAGGGGCAGG - Intergenic
1144493118 17:15731537-15731559 GACTGAGGGGGGTCATTGGCAGG + Intergenic
1144763644 17:17721533-17721555 GACTGAGGGCAGGAGTTGGTGGG + Intronic
1144907137 17:18645115-18645137 GACTGAGGGGGGTCATTGGCAGG - Intronic
1145158012 17:20555698-20555720 GACTGAGAAGAGCCATTGGTAGG - Intergenic
1147331688 17:39703113-39703135 AAAGGAAGACAGGCATTGGCTGG - Intronic
1149165814 17:53750516-53750538 GAGTGAGAACAGGCATTGTTTGG + Intergenic
1151195574 17:72429259-72429281 TACTGAGGACAGGATTGGGCTGG + Intergenic
1152278622 17:79372406-79372428 GACTGAGGAGAGCCATAGGATGG - Intronic
1156196596 18:34781047-34781069 GGCTGAGGCCAGCCATTGTCCGG + Intronic
1157967703 18:52226951-52226973 GGCTGAGGACAGGCTATGGATGG + Intergenic
1158876984 18:61743240-61743262 GACTGAGGACAGCCAGCTGCCGG - Intergenic
1160589495 18:79935202-79935224 GACTGTGAACAGGCAATGGTGGG + Intronic
1161075167 19:2281890-2281912 GCCTGAGGACAGGCCTTTGGGGG + Intronic
1161078895 19:2300698-2300720 GACGGAGGCCTGGCAGTGGCGGG - Intronic
1161484973 19:4530506-4530528 GGCTTAGGACAGGCAGAGGCAGG + Intronic
1162029829 19:7912547-7912569 GACTGAGGACAGAGAGTGGGGGG + Exonic
1163663305 19:18591204-18591226 GGCTGAGGACAGGCATCTGAAGG - Intronic
1164348127 19:27294512-27294534 GACTGAGAACATGCATTGTTTGG + Intergenic
1165743761 19:38218472-38218494 GACTGAGGTCAGACTGTGGCAGG + Intronic
1166060435 19:40322225-40322247 GGCTGGGGACTGGCCTTGGCTGG + Exonic
1166806994 19:45493278-45493300 CTCTGTGGACAGCCATTGGCTGG - Exonic
1166811390 19:45516490-45516512 AACTGAGGTCAGGCAGGGGCTGG + Intronic
1166963595 19:46514594-46514616 GACTGAGGGCAGGGGTTGTCGGG + Intronic
1167719902 19:51172176-51172198 GACCAAGGACAGGCATGGGGAGG + Intergenic
1167890499 19:52535969-52535991 GACTGAAGCCAGGCCTGGGCGGG - Intronic
1167934872 19:52897709-52897731 GACAGAGGCCAGGCCTGGGCGGG + Intergenic
925290926 2:2748265-2748287 GGCTGAGGACTGGCACTGCCAGG - Intergenic
925635415 2:5937393-5937415 GACTGAGGCCAGGGACAGGCAGG + Intergenic
926107117 2:10159438-10159460 GACTGAGGTCTGGCCTAGGCGGG + Intronic
927510149 2:23639308-23639330 GACTGAGCCCAGGGCTTGGCGGG + Intronic
928225511 2:29444871-29444893 GTATGTGGACAGGCATGGGCAGG - Intronic
931584467 2:63810510-63810532 GACAGATGACAGGCATTGGAGGG + Intronic
931825165 2:65992590-65992612 CACTGAGGACAGTGACTGGCTGG + Intergenic
934555023 2:95282516-95282538 GACTGAGGACAGGCATTGGCTGG + Intronic
934562010 2:95318235-95318257 GACTCAGGACAAGCCTGGGCTGG + Intronic
934707860 2:96497351-96497373 GACTGAAGGCAGGAGTTGGCCGG - Intergenic
935736029 2:106107323-106107345 GACTGAAGACTGGCCTCGGCTGG - Intronic
937442642 2:121929994-121930016 GAGTGAGGACAGACATTTTCAGG + Intergenic
937771305 2:125723465-125723487 GACTTAGGACAGGAATTATCAGG - Intergenic
939018324 2:136927729-136927751 GACTGATGACAGACATTGATAGG + Intronic
939189842 2:138902794-138902816 GTCTGGGGACAGGCACTGGGCGG + Intergenic
944331342 2:198469811-198469833 GAGGGTGGACTGGCATTGGCTGG - Intronic
946948712 2:224849385-224849407 GACTAAGGACATGCCTTGGCAGG - Intronic
947376679 2:229503310-229503332 GACTGAGGAGAGGCCCTTGCTGG + Intronic
948737190 2:240016781-240016803 GTCTGAGGACTGGCCTGGGCTGG - Intronic
948779384 2:240308512-240308534 GTCTGAGATCAGGCATTGCCTGG + Intergenic
949053201 2:241908847-241908869 GTCTGAGGTCAGGCATCGGCAGG - Intergenic
1172766601 20:37354541-37354563 GACTGAGGAGACACACTGGCGGG - Intronic
1173815278 20:45983538-45983560 GACTCAGGACTGGCTTTGGGAGG - Intergenic
1175518822 20:59586741-59586763 GACTGAGGACAGGACCTGGCTGG - Intronic
1175530328 20:59670579-59670601 AAATGAGGACAGGCATCTGCCGG + Intronic
1178275587 21:31233892-31233914 GCCTGAGGAAGGGCAGTGGCAGG + Intronic
1179466769 21:41581081-41581103 AACTGAGGCCTGGCTTTGGCAGG - Intergenic
1179591596 21:42412702-42412724 GACTGAGGAAAGGGCCTGGCAGG + Intronic
1179942260 21:44647924-44647946 GGCAGGGGACAGGCATGGGCGGG - Intronic
1183491073 22:38115919-38115941 GGCTGAGGACAGGGATTGCGGGG - Intronic
1184159150 22:42687769-42687791 CAGTGAGGACAGGCACAGGCAGG + Intergenic
1184389891 22:44197210-44197232 GACTCTGGATGGGCATTGGCTGG + Intronic
949539446 3:5020652-5020674 GACTGAGGTGGGGCAGTGGCAGG - Intergenic
950465225 3:13149438-13149460 GACAGAGGACAGGCAGGGACAGG + Intergenic
950493950 3:13322622-13322644 GACAGAAGACAGGCATTAGTGGG - Intronic
952482489 3:33775931-33775953 GACTGAGGACATACTTTGGTAGG - Intergenic
953027740 3:39154371-39154393 GAGTCAGGAAAGGCCTTGGCGGG - Intronic
953103359 3:39851965-39851987 GACTGAGGAGAGCCATTTGTGGG + Intronic
954697833 3:52436934-52436956 GCCTGAGGATGGGCATTGGCCGG - Intronic
955314237 3:57921999-57922021 CACTTAAAACAGGCATTGGCTGG - Intronic
955371403 3:58355161-58355183 GCCTGGGCACAGGCATTAGCGGG - Intronic
955595951 3:60590832-60590854 GACAGAGCACAGGCTATGGCAGG + Intronic
956657110 3:71563119-71563141 GACTGTGGCCAGGGAGTGGCTGG + Intronic
956675829 3:71731052-71731074 GAGTGAGGACTGGGAGTGGCTGG - Intronic
956779639 3:72593838-72593860 GACTGAGGCCAGGAAGAGGCTGG + Intergenic
960093915 3:113669796-113669818 GAGTAAGAACATGCATTGGCAGG + Intronic
960943301 3:122948432-122948454 GACTTAGGTCAGACCTTGGCAGG - Intronic
961835952 3:129659799-129659821 GACTGAGCACATGCATTAGCTGG - Intronic
966922199 3:184619759-184619781 GACCGAGGGCTGGCATGGGCTGG - Intronic
967100266 3:186210335-186210357 GAAGGAGGAGAGGCCTTGGCAGG - Intronic
968584274 4:1408722-1408744 GGCTGAGGTCAGGCCGTGGCAGG - Intergenic
968622161 4:1608691-1608713 GGCTGAGGCCAGGCACTGGTGGG - Intergenic
968745398 4:2357307-2357329 GAGCGAGGAGGGGCATTGGCAGG - Intronic
972769578 4:42184550-42184572 GACTTAGGACATCCATGGGCAGG + Intergenic
974697935 4:65398585-65398607 GACTGTGGGCAGCCATAGGCAGG - Intronic
975758171 4:77591800-77591822 GACTGTGCACAGGCACTTGCTGG - Intronic
979254831 4:118599017-118599039 GACAGAGGAGAGGCAGGGGCAGG - Intergenic
980710469 4:136559569-136559591 GACTGAGAAAATGCAATGGCAGG - Intergenic
981686842 4:147464392-147464414 GAGTGAGGACAGGCCATGGAGGG - Intergenic
982989170 4:162249111-162249133 GACACAGGGAAGGCATTGGCAGG + Intergenic
986436999 5:7744129-7744151 GAGTGAGGACAGGCAGTGTTTGG - Intronic
988688507 5:33549081-33549103 AACAGAGGCCAGTCATTGGCAGG + Intronic
989478325 5:41900078-41900100 GATTGATGACAGCCACTGGCAGG - Intergenic
991580493 5:68149683-68149705 GACTGAGGATATGCAATGGTAGG - Intergenic
995355194 5:111229235-111229257 AACTGAGGAAATGCATTGGCTGG - Intronic
995536540 5:113142317-113142339 GCCTGAGGACAGCAAGTGGCTGG - Intronic
997863827 5:137443636-137443658 GAATAAGGGCAGGCTTTGGCAGG - Intronic
998250786 5:140550825-140550847 GACTGAGGTCAGTCAGTGGATGG - Exonic
1002725021 5:181289083-181289105 GACAGAGGAGAGGCAGGGGCAGG - Intergenic
1004558565 6:16724905-16724927 GACTGAGCTCAGGCCATGGCGGG - Intronic
1005696342 6:28355939-28355961 GCCTGAGGACAGGCTGTGGGTGG - Intronic
1006410612 6:33871233-33871255 GACTGAGCAGAGCCATTGGGGGG - Intergenic
1006918786 6:37614097-37614119 GAGTGGGGACAGGTATTGGGAGG + Intergenic
1007314837 6:40979007-40979029 AGCTGGGGTCAGGCATTGGCAGG + Intergenic
1007661348 6:43488718-43488740 GACTGAGCACAGCCACTGACAGG - Intronic
1010338102 6:74712987-74713009 GACTGAGAACATGCATTGTTTGG - Intergenic
1011310165 6:85972714-85972736 GACTGAGGGGTGGAATTGGCGGG - Intergenic
1011925273 6:92635552-92635574 GACTGAAGAATGGTATTGGCTGG - Intergenic
1013602747 6:111720183-111720205 GCATGAGGAAAGGCAGTGGCTGG + Intronic
1017028392 6:150200478-150200500 GACTGAGAACAGGAGCTGGCTGG - Intronic
1017692833 6:156984106-156984128 GGTTGTGGACAGGCAGTGGCTGG + Intronic
1018366036 6:163120848-163120870 GAATGAGGCCAGGCATGGGAGGG - Intronic
1018390463 6:163337276-163337298 GGCTGAGGACAGGCATCCTCCGG - Intergenic
1020084743 7:5304139-5304161 GACTGAGGACCGGCTTATGCGGG - Exonic
1024069922 7:45776696-45776718 GACAGAGGAGAGGCAGGGGCAGG - Intergenic
1029157264 7:98526120-98526142 GCCTGAGCACAGGCATGGGCTGG + Intergenic
1029381320 7:100216979-100217001 TCATGAGGACAGGCATTGTCTGG + Intronic
1029400748 7:100344289-100344311 TCATGAGGACAGGCATTGTCTGG + Intronic
1032047320 7:128620982-128621004 GACAGAGGAGAGGCAGGGGCAGG - Intergenic
1032653695 7:133905501-133905523 GACAGAGGACAGGCAAGGGGAGG - Intronic
1033436924 7:141341605-141341627 CACTGCAGACAGGCAGTGGCTGG + Intronic
1034255023 7:149720181-149720203 GGCTGAGGTCACGCATTGCCTGG - Intronic
1035307516 7:157942789-157942811 CTCTGATGACAGGCAGTGGCAGG + Intronic
1035556968 8:574596-574618 GAATGCGGACAGGCATAGCCAGG + Intergenic
1035796552 8:2362601-2362623 CACTGAGGACAGACAGTGGGAGG - Intergenic
1035982701 8:4391133-4391155 GCCTGAGCACAGGCATTATCTGG - Intronic
1037583292 8:20259468-20259490 GACTGGGGAAAGACATTGGGAGG - Intronic
1037605953 8:20437266-20437288 AACTGAGGAGTGGCATTGGTAGG + Intergenic
1038829742 8:31043779-31043801 GACTGAGGTCAGGCATATGAAGG - Intronic
1045166382 8:99610495-99610517 GACTGAGAACATGCAGTGTCTGG - Intronic
1046455327 8:114452382-114452404 CACAGAGAACAGGCAATGGCTGG + Intergenic
1046747189 8:117888885-117888907 GAAAGAGCACAGGCATGGGCAGG - Intronic
1048315713 8:133360430-133360452 GACTCAGGGCAGGCATTGCCTGG + Intergenic
1048343828 8:133561406-133561428 GACTGAGGGGAGGCAGTGGAGGG - Intronic
1049318066 8:141980253-141980275 GAGTGAGAGCAGGCACTGGCTGG - Intergenic
1050096483 9:2072816-2072838 TAGTGAGGACAGGCTGTGGCTGG + Intronic
1052619222 9:30883638-30883660 GACTGGGGTAAGGCATTGGAGGG + Intergenic
1058864057 9:109145266-109145288 GACTGTGGCCAGGCACAGGCGGG - Intronic
1058902755 9:109456518-109456540 GACTGAGGGGAGGCACTGGGAGG + Intronic
1059614339 9:115932383-115932405 TACTGAGGAGAGGGGTTGGCTGG - Intergenic
1060088208 9:120720604-120720626 GTCTGGGGACAGGCACTGGGTGG - Intergenic
1060155603 9:121317954-121317976 GACTGAGGCCCAGCACTGGCTGG + Intronic
1062750165 9:138246730-138246752 GACAGAGGAGAGGCAGGGGCAGG - Intergenic
1194952395 X:100142204-100142226 AACTGAGGACAAGCCATGGCTGG - Intergenic
1195068828 X:101260666-101260688 GGCTGAGGAAAGGCTTTGACCGG - Exonic
1196735597 X:118978498-118978520 TACTGTAGACAGGTATTGGCAGG + Intronic
1197609826 X:128625339-128625361 GAGAGAGGTCAGGAATTGGCTGG - Intergenic
1198246151 X:134833750-134833772 GAGTGAGGACATGCATTGTTTGG + Intronic
1198806417 X:140499622-140499644 TACTGAGGAGGGGAATTGGCAGG + Intergenic
1200072131 X:153534455-153534477 GTCTGGGGACAGGCATTGGGGGG - Intronic
1201920051 Y:19224186-19224208 GCCTGGGGACTGGCATGGGCAGG + Intergenic