ID: 934555098

View in Genome Browser
Species Human (GRCh38)
Location 2:95282918-95282940
Sequence CTGTGTTTGGGGAGGGCGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 646
Summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 589}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934555098_934555107 11 Left 934555098 2:95282918-95282940 CCCCTCGCCCTCCCCAAACACAG 0: 1
1: 0
2: 4
3: 52
4: 589
Right 934555107 2:95282952-95282974 TCCTGATTTTGCATCGTTCTGGG 0: 1
1: 0
2: 0
3: 10
4: 112
934555098_934555106 10 Left 934555098 2:95282918-95282940 CCCCTCGCCCTCCCCAAACACAG 0: 1
1: 0
2: 4
3: 52
4: 589
Right 934555106 2:95282951-95282973 CTCCTGATTTTGCATCGTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 71
934555098_934555109 30 Left 934555098 2:95282918-95282940 CCCCTCGCCCTCCCCAAACACAG 0: 1
1: 0
2: 4
3: 52
4: 589
Right 934555109 2:95282971-95282993 TGGGAAACCCTTCCAACCCCTGG 0: 1
1: 0
2: 0
3: 15
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934555098 Original CRISPR CTGTGTTTGGGGAGGGCGAG GGG (reversed) Intronic
900204614 1:1426722-1426744 GTGTGTTTGGGGAGGGGCTGGGG - Intronic
900473063 1:2864001-2864023 AGGTGCTTGGGGAGGGCGGGAGG - Intergenic
901029873 1:6300817-6300839 CTGTGTTTGTGGAGAGGGACCGG - Intronic
901098442 1:6701464-6701486 CTGTGTCCGGGTAGGGCCAGAGG - Intronic
901161201 1:7177687-7177709 CTGTGTGTGGGGAGGGGTACTGG - Intronic
901185313 1:7369081-7369103 CTGTGGTGGGGGAGGAGGAGGGG - Intronic
901592189 1:10353800-10353822 GTATGTCTGGGGAGGGGGAGTGG + Intronic
901887039 1:12230366-12230388 CTGTGCTTGGGGAGCTCGCGGGG - Intronic
901922998 1:12549281-12549303 GTGTGTTTGGCGAAGGCGGGCGG - Intergenic
902252516 1:15163820-15163842 CTTTTTTTGGGGGGGGGGAGGGG + Intronic
902650450 1:17833849-17833871 CTGTGCATGGGGAGGGAAAGGGG + Intergenic
902973512 1:20072148-20072170 GTGTGTTTGGGGATGGGGACGGG - Intronic
903167001 1:21527471-21527493 CTTTTTTTGGAGGGGGCGAGGGG + Intronic
903572650 1:24317934-24317956 CTGTGTTGGGGGAAGCCCAGGGG - Intergenic
903979540 1:27176003-27176025 CAGTATTTTGGGAGGCCGAGCGG - Intergenic
905068267 1:35202586-35202608 TTGTGTTGGGGGATGGGGAGAGG + Intergenic
905247445 1:36624975-36624997 GTGTGTTGTGGGAGTGCGAGGGG + Intergenic
905301478 1:36989069-36989091 CTGTGTTTGTGCAGGGAGGGAGG - Intronic
905740904 1:40370700-40370722 CTGTGGTGGGGTAGGGGGAGGGG + Intronic
905867318 1:41383062-41383084 CCGTGTTTGGGGTGGGCGCGGGG - Exonic
907301682 1:53490805-53490827 CAGGGTTGGGGGAGGGCAAGAGG - Intergenic
907445693 1:54506417-54506439 CTGTGATGGGGGAGGGTGTGTGG + Intergenic
908855067 1:68417581-68417603 GTGTGTTTGGGGAGGGTTAATGG + Intergenic
909335682 1:74470583-74470605 TTGTGTTTGGGGAATGAGAGAGG + Exonic
909610767 1:77549594-77549616 CAGTGTCTGGGAAGGGAGAGGGG - Intronic
909811625 1:79938534-79938556 CTGTGGTGGGGTAGGGGGAGGGG - Intergenic
910158061 1:84242772-84242794 GCGTGTTTGGGGAGGGAGAGTGG - Intergenic
910631971 1:89364649-89364671 GTGTGTGTGGGGAGGGGGTGGGG + Intronic
911057378 1:93720535-93720557 CTGTGGTCTGGGAAGGCGAGTGG - Intronic
911961578 1:104310477-104310499 TTGTGTGTGGGGCGGGCGGGGGG + Intergenic
912870834 1:113303925-113303947 CAGGGTTTGGGGAGGGGGAAAGG + Intergenic
913596371 1:120381931-120381953 CTGTCGTTGGGTAGGGGGAGGGG + Intergenic
914090899 1:144497044-144497066 CTGTCGTTGGGTAGGGGGAGGGG - Intergenic
914307704 1:146437163-146437185 CTGTCGTTGGGTAGGGGGAGGGG + Intergenic
914594405 1:149135973-149135995 CTGTCGTTGGGTAGGGGGAGGGG - Intergenic
915515838 1:156412196-156412218 CTGGGCTTGGGAAGGGCCAGTGG + Intronic
917634035 1:176917842-176917864 CTGTGTTTGGTGAAGGCACGTGG - Intronic
917745605 1:178003825-178003847 CTGTGTTTGTGGAGGGAGTGTGG + Intergenic
917833647 1:178921504-178921526 ATGTGTGTGGGGAGGGGGTGGGG + Intronic
918112851 1:181472828-181472850 CTGTTCATGGGGAGGGAGAGTGG + Intronic
919193768 1:194257120-194257142 CTGTGGTGGGGTAGGGGGAGGGG - Intergenic
919918558 1:202154113-202154135 CTGTGTGTGGGGTGGGGGTGGGG + Intronic
920125465 1:203690885-203690907 CTGTGGTGGGGGATGGGGAGGGG - Intronic
920176887 1:204107644-204107666 CTGTGCTTGGGGAGGGGGAGAGG + Intronic
920232710 1:204481145-204481167 GTGTGTATGGGGAGGGTGTGAGG - Intronic
922268244 1:224008494-224008516 CTGTTGTGGGGGAGGGGGAGGGG + Intergenic
922538573 1:226401891-226401913 CTGTGTGGTGGGAGGGGGAGGGG + Intronic
922850247 1:228727000-228727022 CAGTGTATGGTGAGGGCAAGGGG - Intergenic
923030619 1:230246615-230246637 GTGGGCTTGGTGAGGGCGAGGGG - Intronic
923871268 1:237996497-237996519 GTGTGTTTGGGGAATGGGAGGGG + Intergenic
924417813 1:243877051-243877073 CTGTGGTGGGGTAGGGGGAGAGG - Intergenic
924925336 1:248674859-248674881 CTGTGTTTGGGGAGCACTACGGG - Intergenic
924925342 1:248674919-248674941 CTGTGTTTGGGGAGCACTATGGG - Intergenic
924925433 1:248675945-248675967 CTGTGTTTGGGGAGAACTATGGG - Intergenic
1063696094 10:8336548-8336570 GCCTGTTTGGGGAGGCCGAGAGG + Intergenic
1064082654 10:12321051-12321073 CTTTGTTTGGGGAGGGTGAGGGG - Intergenic
1064232453 10:13541202-13541224 CAGTGTTTGCGGATGGGGAGAGG + Intergenic
1064339287 10:14472310-14472332 GTGTGTTTGGTGAGGGTCAGGGG - Intergenic
1064353221 10:14595913-14595935 CTGTGGTTGTGGAGGGCCACGGG - Intronic
1064645130 10:17453406-17453428 GTGTGTTTGAAGAGGGCGCGGGG - Intronic
1066129631 10:32380081-32380103 GTGTGTGTGGGGAGGGGAAGAGG - Intergenic
1066819954 10:39472675-39472697 CTGTGGTGGGGTAGGGGGAGGGG + Intergenic
1067172867 10:43922293-43922315 CCGTGTTTGGGGAGGAAGGGAGG - Intergenic
1067477761 10:46578002-46578024 GTGTGTGTGGGGGGGGGGAGGGG - Intergenic
1067552641 10:47246319-47246341 CTGTGTTTGGGAAGGGAGCTGGG + Intergenic
1068723151 10:60269644-60269666 CTTTTTTTGGGGGGGGGGAGGGG - Intronic
1069556600 10:69402422-69402444 CTGTGTTTGGGTAGAGAGGGAGG - Intergenic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1070411198 10:76142838-76142860 CTGTTGTTGGGTAGGGGGAGGGG - Intronic
1070560585 10:77563727-77563749 ATGTGTTAGGGGAGGATGAGAGG - Intronic
1072407450 10:95168542-95168564 CTGCAGTTGGGGAGGGGGAGGGG + Intergenic
1073048346 10:100653164-100653186 CTGGGTTGGGCGAGGGAGAGGGG - Intergenic
1073113297 10:101075706-101075728 CTGTGTTTGGGAAGGACGCAGGG + Intergenic
1073529288 10:104216640-104216662 CTGTGGGTGGGGAAGGGGAGAGG - Intronic
1073875049 10:107913721-107913743 CTGAGCCTGGGGAGGGAGAGTGG - Intergenic
1073892750 10:108119837-108119859 CTGTGGTTGGGTGGGGGGAGGGG + Intergenic
1074391050 10:113058408-113058430 CTGTTTTTGGAGTGGGTGAGAGG + Intronic
1075420865 10:122299293-122299315 CTGTGTGTGGGGCTGGGGAGAGG + Intronic
1075546459 10:123358741-123358763 CTGTGTATGGGGACCGCTAGTGG + Intergenic
1075861421 10:125679891-125679913 CTGGGGTTGGGGAGTGCGACAGG - Intronic
1076896920 10:133317564-133317586 CTGTGTCTGGGGGGGGTGTGTGG - Intronic
1076897011 10:133317876-133317898 CTGTGTCTGGGGGGGGGGTGTGG - Intronic
1076897104 10:133318207-133318229 CTGTGTCTGGGGGGGGTGTGTGG - Intronic
1076897119 10:133318272-133318294 CTGTGTCTGGGGGGGGGGTGTGG - Intronic
1078062460 11:8056784-8056806 ATGTGGTTTGGGAGGGTGAGGGG + Intronic
1078741999 11:14075427-14075449 CTGTGGGTGGGGAGGGGGAGGGG + Intronic
1078928582 11:15895925-15895947 CTGTGTTCAGGGAGGGAGTGAGG + Intergenic
1079334964 11:19563282-19563304 CTGTGTTTGGGAAGAGAGACTGG - Intronic
1080438414 11:32268048-32268070 CTATGTGTGGGGTGGGGGAGTGG - Intergenic
1081432961 11:42996691-42996713 GTGTGTGTGTGGAGGGCGGGGGG - Intergenic
1081567028 11:44266351-44266373 CTGAGTTTAGGGAGGGAGAGGGG + Intronic
1081908172 11:46682286-46682308 CTGTGCTAGGGGAGGGCCTGTGG - Intronic
1082226311 11:49712026-49712048 CTGTGGTGGGGTGGGGCGAGGGG - Intergenic
1082228039 11:49731150-49731172 CTGTGGTGGGGTGGGGCGAGGGG + Intergenic
1083363485 11:62127748-62127770 CTGTGTTTGGGCAGGGAGTGAGG + Intronic
1083608559 11:63993781-63993803 CAGTGTTTTGGGAGGCCAAGGGG - Intronic
1083938429 11:65882415-65882437 CAGTTTTTCTGGAGGGCGAGAGG - Exonic
1084128919 11:67118874-67118896 GTGTGTGGGGGGAGGGCGCGCGG + Intergenic
1084213748 11:67635680-67635702 ATGTGTGTGGGGCGGGGGAGGGG + Intronic
1084963481 11:72730689-72730711 CTGTTTTTGGGGGAGGCGGGAGG - Intronic
1086921307 11:92590399-92590421 CTGTGTTTGGAAAGGGTGGGAGG + Intronic
1086931889 11:92702587-92702609 GTGTGTTTGTGGAGGACAAGGGG - Intronic
1088559738 11:111101248-111101270 CTGGCTTTGGGGATGGAGAGAGG + Intergenic
1089118513 11:116114962-116114984 GTGTGTTGGGGGATGGGGAGGGG - Intergenic
1089272891 11:117314462-117314484 GTGTGTTTGGGGTGGGCGGAGGG - Intronic
1089432771 11:118436904-118436926 CCGTGTTTGGGGAGAGCGGCGGG + Exonic
1089808468 11:121112974-121112996 CTGTGGGTGGGGAGGGCGCAGGG + Intronic
1089844207 11:121445732-121445754 CTGGCTTTGGGGAGGGTGATAGG - Intergenic
1090172044 11:124613647-124613669 CTCTGTTAGGGGAGGGAAAGAGG + Intronic
1090461837 11:126897932-126897954 CTCTGCTTGGGAAGGGGGAGTGG + Intronic
1090472569 11:126993298-126993320 CTGTGTTAGGGAAGTGGGAGAGG - Intronic
1090846497 11:130534044-130534066 CTGGGTTTGGGGTGGGTGTGAGG + Intergenic
1091201495 11:133784227-133784249 AGGTGTTGGGGGAGGGCAAGGGG + Intergenic
1091678652 12:2510414-2510436 ATGTGTTTTGGGAGTGTGAGAGG - Intronic
1091783006 12:3225671-3225693 CTGTTATTGTGGAGGGCGGGGGG - Intronic
1091816963 12:3446065-3446087 CTGAGGGTGGGGAGGGGGAGTGG - Intronic
1093414720 12:18907074-18907096 CTGTGGGTGGGGAGAGAGAGGGG - Intergenic
1093967756 12:25345267-25345289 CAGTGTCTGGTGAGGGCCAGTGG - Intergenic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1095085797 12:38056531-38056553 GTGTGTGTGGGGAGGGGGTGTGG - Intergenic
1095855374 12:46854544-46854566 CTGTTGTGGGGGAGGGGGAGGGG + Intergenic
1096096440 12:48938641-48938663 CTGGGTTTCGGGAGGTCGAGTGG - Exonic
1096269239 12:50151128-50151150 GTGAGTTTGGGGAAGGCCAGAGG - Intronic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1096841655 12:54383549-54383571 CAGTGTTTGAGGAAGGTGAGTGG - Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097222997 12:57461451-57461473 GTGTGTATGGGGAGGAGGAGGGG - Intronic
1098727816 12:73990493-73990515 TGGTGTTTGGGGAGGCAGAGAGG + Intergenic
1098819266 12:75208369-75208391 GTGTGTTTGGGGAGGCAGAGAGG - Intronic
1099360127 12:81690493-81690515 GTGTGTTGGGGGAGGAGGAGTGG - Intronic
1099448940 12:82785360-82785382 TTGTGTTTGGGGGGGACGGGGGG - Intronic
1099499934 12:83401837-83401859 CTGTGGTGGGGTAGGGGGAGGGG - Intergenic
1099793721 12:87369054-87369076 GTGTGTATGTGGAGGGCGGGGGG + Intergenic
1099802203 12:87471575-87471597 CTGTGTTTTGTGGGGGTGAGGGG - Intergenic
1100141737 12:91627276-91627298 ATGTGTTGGTGGAGGGCGGGGGG - Intergenic
1100542054 12:95566961-95566983 CTGTGTGTGGGGCGGGGGAGAGG - Intergenic
1100900209 12:99231204-99231226 CTGTGTTTTGGGAGGGCTGTGGG + Intronic
1100973607 12:100098217-100098239 CTTTTTTTGGGGAGGGTGCGGGG - Intronic
1102566985 12:113803324-113803346 CTGGGTCTGGGGAAGGAGAGTGG - Intergenic
1102923077 12:116807603-116807625 CTGGGTCAGGGGAGTGCGAGTGG - Intronic
1103297239 12:119898168-119898190 CTTTTTTTGGGGGGGGCGGGGGG + Intergenic
1103373853 12:120439881-120439903 CTGTGATGGGGGCGGGGGAGGGG - Intronic
1103954451 12:124568418-124568440 GTGTGTGTGGGGGGGGCGGGGGG - Intergenic
1104315844 12:127700204-127700226 CTGTGTTTGGTGATGGGGTGCGG - Intergenic
1104360558 12:128129147-128129169 GTGTGTGTGGGGGGGGCGGGGGG - Intergenic
1104463735 12:128974100-128974122 CTGTGCGTGTGGAGGGGGAGAGG + Intronic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1105407257 13:20142721-20142743 CCGTGTTGGGGCAGGGCCAGCGG + Exonic
1106020448 13:25909796-25909818 CTGAGTTGGGGGAGGGCGGCGGG - Intronic
1106083625 13:26521239-26521261 CTTTGCTTGGGGAGGTAGAGTGG - Intergenic
1106411890 13:29516389-29516411 CTGTGTGTGGGGTGTGGGAGTGG - Intronic
1108885218 13:55172157-55172179 ATGAGTTTGGGCAGGGCTAGGGG + Intergenic
1109019775 13:57074391-57074413 CTGTATTTTGGGAGGCTGAGGGG + Intergenic
1110504191 13:76266146-76266168 CTGTGTGTGGGCGGGGGGAGGGG - Intergenic
1111262957 13:85766750-85766772 CTGAGTTTGGGTAGGGAGGGAGG + Intergenic
1113106102 13:106772851-106772873 GTGTGTGTGTGGAGGGAGAGGGG - Intergenic
1113449586 13:110397776-110397798 CTGTGTTTGGGGGCTGTGAGAGG + Intronic
1114260954 14:21035837-21035859 CTGGGATTGGGGAGGTGGAGGGG - Intronic
1114801322 14:25779008-25779030 CTGTGGTGGGGTAGGGGGAGGGG - Intergenic
1115003050 14:28444133-28444155 CTGTGTGTGGGGGGGGAGAGGGG + Intergenic
1115010996 14:28544551-28544573 CTGTGGTGGGGTAGGGGGAGGGG - Intergenic
1115119994 14:29927650-29927672 CTGGGCTGGGGGAGGGCAAGGGG + Exonic
1115804756 14:37038393-37038415 CTGAGTTTGGGAAAGGGGAGAGG - Intronic
1116718251 14:48455831-48455853 CTGTGTGTGGGGATGGGGGGTGG + Intergenic
1117252654 14:53952224-53952246 GTGTCTCTGGGGAGGGGGAGGGG + Exonic
1118084071 14:62395753-62395775 CTGTTTTTGGGTGGGGGGAGGGG - Intergenic
1118154129 14:63221970-63221992 CTGTTTTTGGGTGGGGGGAGGGG - Intronic
1118441744 14:65818516-65818538 TTGTGTGTGGGGAGGGTGGGGGG - Intergenic
1118443257 14:65830583-65830605 CTGTGCTTTGGGAGAGAGAGAGG + Intergenic
1118471592 14:66079716-66079738 CATAGTTTGGGGAGGGAGAGTGG - Intergenic
1118755876 14:68843491-68843513 GTGTGTTTGGGGAGGGAGTAGGG - Intergenic
1118880156 14:69818948-69818970 CGGTGTTTGGGGAGGCGGGGAGG + Intergenic
1119535706 14:75400971-75400993 CTGTGTTTTGGGATGGTCAGGGG + Intergenic
1119663489 14:76467582-76467604 TTGTGTTTGGGGAGGCAGACTGG + Intronic
1120294020 14:82615937-82615959 CTGTGTGTGGGGGCGGGGAGGGG + Intergenic
1121121150 14:91376684-91376706 CTGTCTGTGGGGAGGCCCAGGGG + Intronic
1121774808 14:96583662-96583684 GTGTGTTGGGGGAGGGCGGGTGG + Intergenic
1121879768 14:97489531-97489553 CAGTGTTTGGAGAGGTGGAGTGG + Intergenic
1122211836 14:100178559-100178581 CTGTGGCTGGGGAAGGGGAGTGG + Intergenic
1122913589 14:104845515-104845537 CTGTGGGTGGGGTGGGGGAGGGG - Intergenic
1122931268 14:104933869-104933891 CTGAGTGAGGGGAGGGCGGGAGG + Exonic
1202902820 14_GL000194v1_random:53072-53094 CTGTCATTGGGGACGGAGAGGGG + Intergenic
1123427856 15:20187502-20187524 CTGTGGTGGGGGTGGGCAAGAGG - Intergenic
1123971976 15:25515839-25515861 CTGTGAATGGGGAGGGTGATGGG + Intergenic
1124437583 15:29663707-29663729 CTGTTGTGGGGGAGGGGGAGGGG + Intergenic
1125534619 15:40436140-40436162 CGGGGTTGGGGGTGGGCGAGGGG + Intergenic
1127039010 15:54952659-54952681 CTGTGTTTTGGCTGGGGGAGGGG - Intergenic
1127156637 15:56134761-56134783 CTGTTGTTGGGGAGGGCGGTAGG - Intronic
1128084724 15:64877859-64877881 CTGTCTCTGGGGAAGGCCAGGGG + Intronic
1128385664 15:67146550-67146572 GTGTGTTCGGGGATGGGGAGCGG + Intronic
1128419039 15:67474096-67474118 GTGTGTGTGGAGAGGGAGAGAGG + Intronic
1128786731 15:70403245-70403267 CTATGTTGGGGGAGAGTGAGGGG - Intergenic
1129035539 15:72646473-72646495 CTGTGTCTGGGCAGGGAGTGGGG - Intergenic
1129214345 15:74090743-74090765 CTGTGTCTGGGCAGGGAGTGGGG + Intergenic
1129391063 15:75221182-75221204 CTGTGTCTGGGCAGGGAGTGGGG - Intergenic
1129473244 15:75766687-75766709 CTGTGTCTGGGCAGGGAGTGGGG + Intergenic
1129731487 15:77935093-77935115 CTGTGTCTGGGCAGGGAGTGGGG + Intergenic
1130039351 15:80391923-80391945 CTGTGTGTGTGGAGGGGTAGGGG + Intronic
1130276180 15:82477424-82477446 CTGTGTTTGGGGAGACCCACCGG - Intergenic
1130458272 15:84137201-84137223 CAGTGCTTTGGGAGGCCGAGGGG + Intergenic
1130468539 15:84204817-84204839 CTGTGTTTGGGGAGACCCACCGG - Intergenic
1130495725 15:84468725-84468747 CTGTGTTTGGGGAGACCCACCGG + Intergenic
1130590832 15:85209416-85209438 CTGTGTTTGGGGAGACCCACCGG - Intergenic
1131462166 15:92625149-92625171 CAGAGTTTGGGGAGGGAGGGAGG - Intronic
1131530839 15:93190438-93190460 CTGTGTGTGGGGAGGGTGAGAGG - Intergenic
1131748089 15:95471798-95471820 CTGGCTTTAGGGAGGGAGAGAGG - Intergenic
1132111545 15:99105432-99105454 CTGCGCTGGCGGAGGGCGAGCGG + Exonic
1132195309 15:99910083-99910105 CTGTCTTGGAGGAGAGCGAGAGG + Intergenic
1132422208 15:101680086-101680108 CTGGGTTGGGGGAGGGGGATGGG + Intronic
1132556006 16:572976-572998 CTGTGTCTGAGGAAGGCGAGCGG + Intronic
1135586129 16:23672497-23672519 CTGTGTTTTGGTAGGGAGGGAGG + Exonic
1136330842 16:29575417-29575439 GTGTGTATGGGGAGGGCAGGTGG - Intergenic
1136856439 16:33662259-33662281 CTGTGGTGGGGGTGGGCAAGAGG + Intergenic
1137051370 16:35715931-35715953 CTGTCTTTGGGTGGGGGGAGGGG - Intergenic
1137831231 16:51545269-51545291 CTGTGGTGGGGGAGGGTGAGTGG + Intergenic
1138260878 16:55620952-55620974 CTGTGGTGGGGTAGGGGGAGGGG + Intergenic
1138334010 16:56238105-56238127 ATGTGTGTGGGGCGGGCGGGGGG - Intronic
1138618078 16:58188027-58188049 CTGTGTGTGGGGTGGGGAAGGGG + Intronic
1138845256 16:60557233-60557255 CTTTGTTTGGTGGGGGTGAGGGG + Intergenic
1139825969 16:69757423-69757445 CTGTGTTTGGCCAGGTAGAGAGG - Intergenic
1139940600 16:70602619-70602641 GTGTGTTTGTGTTGGGCGAGGGG + Intronic
1140538691 16:75734979-75735001 CTGTTTTGGGGTAGGGGGAGGGG - Intronic
1141512135 16:84519356-84519378 CTGGGGTTGGGGTGGGGGAGAGG - Intronic
1142205876 16:88782930-88782952 CTGTGTCTGGGGATGGGGCGTGG - Intronic
1203118019 16_KI270728v1_random:1510736-1510758 CTGTGGTGGGGGTGGGCAAGAGG + Intergenic
1143798758 17:9359933-9359955 CTGTGCTTTGGGAGGGACAGAGG + Intronic
1143850178 17:9805264-9805286 ATGTGCTTGGGGTGGGGGAGGGG - Intronic
1144350406 17:14389761-14389783 ATGCGTTGGGGGAGGGGGAGAGG - Intergenic
1145257835 17:21337326-21337348 GTGTGTGTGTGGAGGGGGAGAGG + Intergenic
1145318798 17:21750681-21750703 GTGTGTGTGTGGAGGGGGAGAGG - Intergenic
1146366725 17:32234586-32234608 CTGTGTCTGGAGAGTGGGAGAGG + Intronic
1147156529 17:38546970-38546992 CTGTGCTTGGGGAGGAGGGGAGG - Intronic
1147185539 17:38711346-38711368 CTGTGTTTGGTGGAGGGGAGGGG + Intronic
1147788123 17:42995050-42995072 CTGTGTTTGTTGAGGGCACGGGG - Intergenic
1148046488 17:44748112-44748134 CTGTGGTTGGGGCCGGCCAGAGG - Intronic
1148446843 17:47743087-47743109 CTGTGTTGGGGGAGTCCGGGTGG - Exonic
1148563777 17:48621231-48621253 GTGGGAGTGGGGAGGGCGAGGGG - Exonic
1149430456 17:56593157-56593179 CGGTGTTTGGGGAGGGGGGGCGG - Intergenic
1149560566 17:57605278-57605300 GTGTGTTGGGGGAGGCCGGGTGG + Intronic
1149961642 17:61116085-61116107 CTGTGGTAGGGTAGGGGGAGGGG + Intronic
1150290541 17:63979057-63979079 CTGTGTTTTGGGAGTTTGAGTGG + Intergenic
1150656688 17:67044250-67044272 CTGAGTTGGGAGAGGGCGAGAGG - Intergenic
1151350458 17:73528817-73528839 CTGTGCCTGGGGATGGCCAGGGG - Intronic
1151366742 17:73622528-73622550 CAGTGTTTGAGGAGGGAGGGAGG + Intronic
1151747269 17:76018300-76018322 CTGGGGCTGGGGAGGGAGAGAGG - Intronic
1151784070 17:76266403-76266425 GTGTGTGTGTGGAGGGGGAGGGG - Intronic
1152079098 17:78175480-78175502 CTGGGATTGAGGAGGGCAAGAGG - Intronic
1152110726 17:78356278-78356300 CTGTGGTGGGGGAGGGGGTGGGG + Intergenic
1152190260 17:78883806-78883828 CTGGGGTTGGGGAGGGCGGCAGG - Intronic
1152466338 17:80468654-80468676 GTGTGTTTGGGGAGGGGGAGAGG + Exonic
1152497224 17:80682108-80682130 CTTTGTTTGGGGTGGGGGGGGGG - Intronic
1152511525 17:80792891-80792913 GTGTGTGTGGGGAGGGCGCAGGG - Intronic
1153336205 18:3928084-3928106 CAGTGTGTGTGGATGGCGAGCGG - Intronic
1153727560 18:7972305-7972327 CTGTGGTGGGGTAGGGGGAGGGG + Intronic
1154124629 18:11679449-11679471 CAGTGCTTTGGGAGGCCGAGGGG + Intergenic
1154173060 18:12064315-12064337 CTGGGGTTGGGGAGAGGGAGAGG - Intergenic
1155117451 18:22783705-22783727 CTGTGGGTGGGCAGGGGGAGGGG + Intergenic
1156385385 18:36599953-36599975 CAGTGTTTGGGGTGGGGGTGGGG + Intronic
1156450187 18:37262387-37262409 GTGTGTGTGGGGTGGGGGAGGGG + Intronic
1156614878 18:38771880-38771902 CTGTGTTGTGGGACGGAGAGGGG - Intergenic
1157299274 18:46467914-46467936 GTGTGGTTGGGGAGGGGGAGAGG - Intergenic
1158312206 18:56170971-56170993 CTGGGGTTGGGGAGGGGGAAAGG + Intergenic
1158608913 18:58920786-58920808 GTGTGTTTGGGGAGGGGAGGGGG + Intronic
1158883806 18:61806469-61806491 CTGTGTTTGTGGAAGGCCTGAGG + Intergenic
1159131939 18:64289394-64289416 CTGTTTTGGGGTAGGGGGAGGGG - Intergenic
1160626443 18:80210890-80210912 GTGTGTTTGGGGATGGGGGGTGG - Intronic
1160779528 19:871742-871764 TTGTGTTTTGGTAGGGAGAGGGG + Intronic
1161126879 19:2562815-2562837 CTCTGAGTGGGGAGGGAGAGAGG + Intronic
1161142248 19:2654629-2654651 CTGAGTGGGGGGAGGGAGAGAGG + Intronic
1161209248 19:3057632-3057654 CAGTGTTGGGGGCGGGCGACAGG - Intronic
1162154177 19:8665370-8665392 GTGTGTTTGAGGAGGGCTAAGGG + Intergenic
1162466973 19:10848304-10848326 GTGTGTTTGGGGAAGGGGTGGGG + Intronic
1162568371 19:11456911-11456933 CAGTGTTTCGGGAGGCTGAGGGG - Intronic
1162682411 19:12356000-12356022 CTTTGTTTTGGGAGGTTGAGGGG - Intronic
1163444706 19:17339539-17339561 CTGGGTTGCGGGAGGGCGTGGGG + Exonic
1163448293 19:17360604-17360626 CTGGGTCTGTGGAGGGAGAGAGG + Exonic
1164717511 19:30404297-30404319 CTGTATTTGGGGCAGGCCAGAGG + Intronic
1164857616 19:31537274-31537296 CTGGGTTATGGGAGGGTGAGAGG - Intergenic
1165467071 19:35981122-35981144 GTGTGTTTCGCGGGGGCGAGAGG - Intergenic
1165958484 19:39516102-39516124 CAGGGTTGGGGTAGGGCGAGGGG + Intronic
1166827949 19:45621119-45621141 CTGGGAGTGGGGAGGGGGAGTGG + Intronic
1167249859 19:48394017-48394039 CTGGGTTTGGGGGGGCCGGGGGG - Intergenic
1168028916 19:53664409-53664431 CAGTGCTTCGGGAGGCCGAGGGG + Intergenic
925299829 2:2803915-2803937 CTGTGATTGGGGAGTTGGAGTGG - Intergenic
925388494 2:3479896-3479918 GGGTGTGTGGGGAGGGCAAGAGG - Intronic
925974789 2:9134477-9134499 CTGTGCTTGGGGAGAGACAGAGG + Intergenic
926340146 2:11898649-11898671 GTGTGTGTGGTGAGGGAGAGAGG + Intergenic
927188010 2:20496399-20496421 CTGGGTTTGGGGTGGGGCAGTGG + Intergenic
928028141 2:27756315-27756337 CTGACTGTGGGGAGGGAGAGGGG - Intergenic
928090616 2:28372133-28372155 CTGTGGTGGGGTAGGGGGAGCGG + Intergenic
928268755 2:29835553-29835575 CTGGGTTGGGGAAGGGAGAGTGG - Intronic
928431374 2:31221293-31221315 CTCTGTCTGGGGAGGGCTTGGGG + Intronic
929556351 2:42927762-42927784 CGTTGTTTGGGGAGGGGGTGGGG + Intergenic
929561588 2:42959690-42959712 CTGGGTTAGGGGTGGGCGTGGGG + Intergenic
930441620 2:51415353-51415375 TTGAGTTTAGGGAGGGCAAGTGG - Intergenic
932385946 2:71332399-71332421 TTGTGTTTGGGGTTGGGGAGGGG + Intronic
932400158 2:71474930-71474952 CTGTGATAGGGGAGGGGAAGTGG + Intronic
933365716 2:81351142-81351164 CTGTGGTGGGGAAGGGGGAGGGG - Intergenic
933432164 2:82196916-82196938 CTGGGTCTGTGGAGGGTGAGTGG - Intergenic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
934555098 2:95282918-95282940 CTGTGTTTGGGGAGGGCGAGGGG - Intronic
934661191 2:96144612-96144634 GTGTGTTGGGGGAGGGGGTGGGG - Intronic
934766097 2:96880943-96880965 CTGGGTTTGGGGTGGGTGTGAGG + Intronic
935622314 2:105141006-105141028 CTGTGGTGGGGTAGGGGGAGGGG + Intergenic
936020124 2:108988448-108988470 CTGTGTTGGTGGCGGGGGAGCGG - Intronic
936528700 2:113259897-113259919 CTGCGTTTGGGGAGGGAAACAGG + Intronic
936726821 2:115329583-115329605 CTGTCATTGGGTAGGGGGAGCGG - Intronic
936877166 2:117204245-117204267 CTGTGTGTCGGCAGGGGGAGTGG - Intergenic
937718240 2:125060083-125060105 CTGTTTTTGAAGAGGGTGAGGGG + Intergenic
939939320 2:148330037-148330059 GTGTGTGTGGGGGGGGCGGGGGG - Intronic
939998062 2:148938660-148938682 CTGTGGCTGGGGAGGGTGAAGGG + Intronic
940540614 2:155010924-155010946 CTGGGTTTGGCGGGGGCGGGGGG - Intergenic
940632838 2:156260376-156260398 CTGTGGTTGGGTTGGGGGAGCGG + Intergenic
940951734 2:159682905-159682927 GTGTGTGTGGGGGGGGGGAGGGG - Intergenic
940955667 2:159724828-159724850 CTGTTTTAGGGTAGGGGGAGGGG - Intronic
942091460 2:172495604-172495626 CCGTGGTTCTGGAGGGCGAGAGG - Intronic
942308381 2:174631018-174631040 TTGTGTTTTGGGAGGAAGAGTGG + Intronic
942534666 2:176950461-176950483 CTGGACTTGGGGAGGGGGAGTGG + Intergenic
942628047 2:177924876-177924898 CTGTGGTGGGGTAGGGGGAGGGG - Intronic
943551741 2:189349102-189349124 TTGTGTTTTGAGAGGGCTAGGGG - Intergenic
944883772 2:204042249-204042271 CTTGGGTTGGGGAGGGCGGGGGG + Intergenic
946622071 2:221572115-221572137 CTGTGGTCGGGGACAGCGAGGGG - Intronic
947132957 2:226948411-226948433 CTGTGGTGGGGTAGGGGGAGGGG + Intronic
947291053 2:228574115-228574137 CTGTGTTGGGGTGGGGGGAGCGG + Intergenic
947342313 2:229152861-229152883 TTGGGTTTGGGGAGGGAAAGAGG - Intronic
947377048 2:229506666-229506688 CTGTGGTGGGGTAGGGGGAGGGG - Intronic
947411718 2:229848320-229848342 GTGTGTGTGGGGGGGGCGGGGGG - Intronic
948504572 2:238419813-238419835 CAGTGTTTTGGGAGGCCAAGGGG - Intergenic
948726848 2:239939331-239939353 GGGTTTGTGGGGAGGGCGAGTGG + Intronic
1169466375 20:5844452-5844474 ATGTGTTTGGGGATGGCTGGAGG + Intronic
1169569918 20:6894979-6895001 CTGTGTCTGGGGGTGGGGAGGGG + Intergenic
1170428612 20:16258589-16258611 GTGTGTTTGGGGATGGGAAGGGG - Intergenic
1170457744 20:16549187-16549209 CTGTGGTGGGGTAGGGGGAGGGG - Intronic
1171769403 20:29310965-29310987 GTGTGTGTGGGGAGGGGGTGTGG - Intergenic
1172014490 20:31864885-31864907 CTGTGGTGGGGGAGGGGGAGGGG - Intronic
1173504121 20:43573771-43573793 CTGTGTTTGGGTATGGTGGGTGG + Intronic
1173666352 20:44766074-44766096 CTGTGGTGGGGGAGGGACAGGGG + Intronic
1173823638 20:46033765-46033787 AGATGTTTGGGGAGGGGGAGAGG - Intronic
1174140292 20:48408361-48408383 CTCTGCCTGGGGAGGGGGAGAGG - Intergenic
1174689854 20:52493120-52493142 GTGTGTTTGGGGACGGGTAGGGG + Intergenic
1174924500 20:54742762-54742784 GTGTGTGTGGGGAGGGGGTGGGG + Intergenic
1175158403 20:56989956-56989978 TTGTGTGTGGGGGGGGCGGGGGG + Intergenic
1175162258 20:57017722-57017744 CTTTATTTGGGTAGGGGGAGGGG - Intergenic
1175172511 20:57090444-57090466 CTGGATTTGGGGAGGGCGGAAGG + Intergenic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1175454118 20:59096976-59096998 TTGCATTTGGGGAGGGAGAGAGG + Intergenic
1176551852 21:8226565-8226587 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
1176570761 21:8409564-8409586 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
1176578670 21:8453711-8453733 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
1176622186 21:9067839-9067861 CTGTCATTGGGGACGGAGAGGGG + Intergenic
1176736407 21:10551280-10551302 CTGTTGTTGGGTAGGGGGAGGGG + Intronic
1178083677 21:29091947-29091969 CTGAGCATGGGGAGGGCTAGGGG + Intronic
1178258146 21:31074210-31074232 GTGTGTTTGTGGTGGGGGAGTGG - Intergenic
1178690249 21:34744340-34744362 CTGTGCTTGGGGAGGGGCGGAGG + Intergenic
1178710918 21:34916030-34916052 GTGTGTGTGGGGAAGGGGAGAGG + Intronic
1179344005 21:40539126-40539148 TTGTGGTTGGGGAGGCCGAGAGG + Intronic
1179434437 21:41350540-41350562 CTGGGTTTGGGGTGGGCTGGTGG - Intronic
1180189575 21:46155970-46155992 CTGGGGCTGTGGAGGGCGAGAGG + Intergenic
1180411743 22:12617976-12617998 CTGTGTTTTGGGAAGGCAATGGG - Intergenic
1180816487 22:18792756-18792778 CTGTGTGTGGGGAGGGCACGGGG - Intergenic
1180949638 22:19715242-19715264 TTGTGTATGGGGAGGGAAAGGGG - Intronic
1181051582 22:20240604-20240626 CAGTGGCTGGGGAGGGGGAGAGG - Intergenic
1181176041 22:21036559-21036581 CAGTGCTTTGGGAGGCCGAGGGG + Intergenic
1181202674 22:21227088-21227110 CTGTGTGTGGGGAGGGCACGGGG - Intronic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1182184402 22:28386990-28387012 CTGTTTTGGGGGTGGGGGAGTGG - Intronic
1182204703 22:28611655-28611677 CTGTGGTGGGGTAGGGGGAGCGG - Intronic
1182297441 22:29318126-29318148 ATGTGTTTTTGGATGGCGAGGGG + Intronic
1182489685 22:30663108-30663130 CTGTTTTTGGGGAGGGCTGCAGG + Exonic
1182537672 22:31017352-31017374 CAGTGCTTGGGGAGGCCAAGGGG - Intergenic
1183536414 22:38404216-38404238 CAGTGCTAGGGGAGGGCGGGAGG - Intergenic
1184606546 22:45577708-45577730 CGGTGTTTGGGGAGCGTGAAGGG + Intronic
1184804147 22:46781615-46781637 CTGTTTTTGGGGAGGGCATGGGG + Intronic
1184967787 22:47994081-47994103 CTGGGTTGGAGGAGGCCGAGTGG - Intergenic
1184978641 22:48080868-48080890 GTGTGGTGGGGGAGGGGGAGGGG - Intergenic
1203224239 22_KI270731v1_random:68325-68347 CTGTGTGTGGGGAGGGCACGGGG + Intergenic
1203256873 22_KI270733v1_random:143487-143509 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
1203266587 22_KI270734v1_random:18467-18489 CTGTGTGTGGGGAGGGCACGGGG - Intergenic
949511798 3:4772794-4772816 CTGTTTATGGAGAGGGCCAGAGG + Intronic
950103282 3:10371546-10371568 CTGTGTGTGGGCAGGGGGAGTGG + Intronic
950230397 3:11271060-11271082 CTGCCTTTGGGGAGGGTGGGGGG + Intergenic
950560351 3:13717809-13717831 CTGTGGGTGGGGTGGGGGAGTGG + Intergenic
951710386 3:25580746-25580768 ATGGGTCTGGGGAGGGAGAGAGG + Intronic
952481207 3:33763629-33763651 CAGTGTTGGGGGAGGAGGAGAGG + Intergenic
952591065 3:34954253-34954275 CTGTGTATGGGGAAGGAGATAGG + Intergenic
953005656 3:38976827-38976849 CTGGGTTTGGGTAGGGGGACGGG - Intergenic
953232408 3:41076631-41076653 CCATGTTTGGGGATGGCCAGGGG - Intergenic
953830894 3:46296938-46296960 CTGTATGTGGGGATGGCGGGTGG - Intergenic
954638322 3:52083654-52083676 CTGTGTTTGGTGAGAGGGCGAGG + Intronic
954671191 3:52292155-52292177 CTGAGTTGGGGGAGGGTGTGTGG + Intronic
955566329 3:60250894-60250916 CTGTGTTTGGTGAGGGCAGTGGG - Intronic
955951943 3:64251385-64251407 CTGTGGTGGGGGAGTGGGAGAGG - Intronic
956379966 3:68654867-68654889 CTGAGTTTGGGGGGGGCGGGGGG + Intergenic
956785775 3:72641085-72641107 CTGAGTTTGGAGAGGAAGAGAGG + Intergenic
956897770 3:73681369-73681391 CTGTGTTGGGGTGGGGTGAGAGG - Intergenic
957743762 3:84310369-84310391 TTGTTTTTGGGGAGGGAGAGGGG - Intergenic
957961292 3:87256921-87256943 CAGTGTTTGGGGATGGCGGCGGG - Intergenic
958611619 3:96433707-96433729 CTCTGTTTGGGGTGGGAGTGGGG + Intergenic
960169452 3:114441598-114441620 GTGTGTTTGGGGACGACGCGCGG + Intronic
961081833 3:124033986-124034008 CTGCGTCTGGGGAGGGCGTGGGG + Intergenic
961518478 3:127453335-127453357 CTGGGTTTGGAGAGGGCTAGGGG - Intergenic
961645440 3:128390414-128390436 CTGTATTTTGGGAGGTAGAGGGG + Intronic
961705647 3:128783208-128783230 GTGTGTTTGTGGGGGGCGGGGGG - Intronic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963087280 3:141449962-141449984 CAGGATTTGGGGAGGGCGAGGGG - Intergenic
964327552 3:155563606-155563628 GTGTGTTTGTGGAGGGAGAAGGG - Intronic
964569771 3:158098387-158098409 TTGTGTTTGGGCACGGGGAGAGG + Intronic
964838241 3:160964625-160964647 CAGTGTTTGGGAAGGCAGAGGGG + Intronic
964879929 3:161411797-161411819 CTGTGCTTTGGGAGAGCCAGAGG + Intergenic
965473160 3:169120571-169120593 ATGTGTGTGGAGAGAGCGAGGGG - Intronic
966038165 3:175446238-175446260 CTTTTTTTGGGGGGGGCGGGGGG + Intronic
967129291 3:186455871-186455893 GTGTCTTTGGGGTGGGGGAGTGG - Intergenic
967413043 3:189186251-189186273 TTGTGATTGGTGAGGGTGAGAGG + Intronic
967910807 3:194541250-194541272 CTGAGCCTGGGGAGGGCAAGGGG - Intergenic
968460373 4:721732-721754 CTGTGTATGGGCATGGGGAGGGG + Intronic
968460391 4:721784-721806 CTGTGTATGGGCATGGGGAGGGG + Intronic
968515053 4:1012243-1012265 CGGTGTTTGGAGAGGGGGGGCGG + Intronic
968737309 4:2304123-2304145 CTGTGTGTGAGGAGGGGCAGGGG - Intronic
968752054 4:2395444-2395466 CTGTGTGTGGGGAGAGCGTTGGG - Intronic
970195721 4:13548116-13548138 GTGTGTTTGGGGTGGGGGCGGGG + Intergenic
970305552 4:14728183-14728205 CTGTTGTGGGGGAGGGGGAGGGG + Intergenic
970415910 4:15856669-15856691 CAGTATTTTGGGAGGCCGAGGGG - Intergenic
972149546 4:36071847-36071869 CTGTGTTGGGGTGGGGGGAGCGG - Intronic
973338312 4:48978672-48978694 CTGTGTTTGCTGAGTGTGAGAGG + Intergenic
974288349 4:59897969-59897991 CTGGGTTTGGGGTGGGGGAGGGG + Intergenic
976337685 4:83909601-83909623 ATGTGTGTGGGGAGAGTGAGAGG - Intergenic
976352720 4:84078351-84078373 CTGTGGTGGGGTAGGGGGAGGGG + Intergenic
976879531 4:89902170-89902192 CTGTGGTGGGGTAGGGGGAGGGG + Intronic
977150254 4:93502703-93502725 GTGTGTGTGGGGGGGGGGAGTGG - Intronic
977940348 4:102850924-102850946 CTTTGTTGGGGGCGGGTGAGAGG + Intronic
978419218 4:108512145-108512167 CTATGTTTGGGGAGGCAAAGTGG - Intergenic
978583700 4:110256578-110256600 CTGTGTCTGGGGAGGGCTGCAGG + Intergenic
978628824 4:110719296-110719318 CTGTGTTTGCGGAGGAGGAGGGG + Intergenic
979048832 4:115903616-115903638 CTGTTGTGGGGGAGGGGGAGGGG + Intergenic
979213646 4:118136616-118136638 CTGTGTTTCTGAAGGGTGAGAGG - Intronic
979788950 4:124754144-124754166 CTGTGTTAGAGCAGGGCTAGAGG + Intergenic
981653153 4:147081839-147081861 CTGTGTCTGGGTAGAGCAAGCGG + Intergenic
981937587 4:150251943-150251965 CTCTGTCTGGAGAGGGAGAGAGG - Intronic
981969881 4:150654690-150654712 CTGTTGTTGGGTAGGGGGAGGGG - Intronic
982179696 4:152738323-152738345 CAGTATTTGGGGAGAGCCAGAGG + Intronic
982637631 4:157916857-157916879 ATGTGTGTGAGGAGGGAGAGTGG + Intergenic
982981816 4:162147028-162147050 CAGTGCTTTGGGAGGCCGAGGGG - Intronic
983800326 4:171920223-171920245 CTGTTTTGGGGTAGGGGGAGAGG + Intronic
984370475 4:178858686-178858708 CTGTGGTGGGGTAGGGGGAGTGG - Intergenic
984779061 4:183506779-183506801 CCGTGTTTGGGGAGGGGGTGGGG + Intronic
984833682 4:183999597-183999619 CTGGGTTTGGGAAGGGGGTGAGG + Intronic
985803584 5:2021999-2022021 CTGTGTTAGGGGGAGGCAAGGGG - Intergenic
985852603 5:2399656-2399678 CTGTGTTTGTGGAGTGGGAGGGG - Intergenic
985982731 5:3485735-3485757 CTGCGTCTGGGCAGTGCGAGTGG + Intergenic
986041042 5:3994239-3994261 CTGTGCTTCAGGAGGGAGAGTGG + Intergenic
986397790 5:7347469-7347491 CTGGGTTTTGGTAGGGCAAGAGG - Intergenic
986467968 5:8045874-8045896 CTGTTGTTGGGGAGAGCCAGTGG + Intergenic
986737405 5:10678312-10678334 CTGAGTCTGTGGAGGGCGTGTGG + Intergenic
986898248 5:12397367-12397389 CTGTCTTGGGGCAGGGGGAGCGG + Intergenic
988962719 5:36385697-36385719 GTGGGTTTGGGGTGGGCGTGGGG + Intergenic
989245165 5:39246126-39246148 CTCTGTTTGGGGTGGACCAGTGG + Intronic
991045393 5:62217820-62217842 CTGTGGTGGGGGTGGGCAAGAGG - Intergenic
991967876 5:72109046-72109068 CTTTTATTGGGGAGGGGGAGTGG - Intronic
992691055 5:79240315-79240337 CTCTGTTTGGAGGGGGCGGGGGG - Intronic
993711095 5:91226135-91226157 GTGTGTTGGGGTAGGGGGAGGGG + Intergenic
994335720 5:98563477-98563499 CTGTGTTTGGGGATGGAGAAAGG - Intergenic
994472163 5:100220772-100220794 CTGTTTTGGGGTAGGGGGAGCGG + Intergenic
994531437 5:100977769-100977791 CTGTTGTGGGGGAGGGGGAGGGG - Intergenic
995603937 5:113830478-113830500 CTGTGTTTGGGCAGGGGGTGAGG + Intergenic
995948364 5:117679253-117679275 CAGTGTGTGGGGACGGGGAGTGG - Intergenic
996827377 5:127700591-127700613 CTGTGCTAGGGGAGGACAAGAGG - Intergenic
996952109 5:129139785-129139807 CTGTTTTTGGGTGGGGTGAGGGG - Intergenic
997445264 5:133935662-133935684 CTGAAGATGGGGAGGGCGAGGGG - Intergenic
998098437 5:139411877-139411899 CAGTGGTTGGGGATGGGGAGAGG + Exonic
998200220 5:140113294-140113316 GTGTGTGCGGGGAGGGGGAGCGG + Intronic
998459305 5:142297620-142297642 CTGTGTCAGGGGTTGGCGAGGGG + Intergenic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
999499881 5:152136234-152136256 CTGTGTTTGGGGAATGTGGGTGG - Intergenic
1000151794 5:158509634-158509656 GTGTGTTGGGGGACGGAGAGAGG + Intergenic
1000917589 5:167100696-167100718 CTTTTTTTGGGGTGGGGGAGGGG + Intergenic
1202772925 5_GL000208v1_random:30026-30048 CTGTGGTTGGGTGGGGGGAGGGG - Intergenic
1003110752 6:3250380-3250402 CTGTGCTTGTGAAGGGTGAGTGG + Intronic
1003951624 6:11121562-11121584 GTGTGTGTTGGGAGGGGGAGAGG - Intronic
1004238165 6:13894078-13894100 CTGTGTTTGGGGACATGGAGAGG - Intergenic
1004624136 6:17358822-17358844 ATGAGTTTTGGGAGGGCCAGGGG + Intergenic
1004716692 6:18223341-18223363 CTTTGATTGGGGGGGGCGGGGGG - Exonic
1005899355 6:30204578-30204600 TTGTGTATGGGGAAGGGGAGCGG - Intronic
1006004094 6:30988776-30988798 CTGTGTGTGGGGGGGGAGGGGGG + Exonic
1006104930 6:31710733-31710755 CTGTGTATGGGGAGGGGTGGGGG + Intronic
1006181294 6:32154821-32154843 CTGTGGCAGGGGAGGGAGAGCGG + Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006505402 6:34485860-34485882 CAGTGGCTGGGGAGGGCCAGAGG + Intronic
1007224418 6:40302863-40302885 CTGTGTGAGGGGAGGGCTGGTGG + Intergenic
1007370109 6:41421229-41421251 ATGTGTTTGGGGAAGGCAGGTGG + Intergenic
1007558053 6:42782964-42782986 CCGCGTCTGGGGAGGGGGAGGGG + Intronic
1007904049 6:45441059-45441081 CAGTGTTGGGGCAGGGGGAGTGG + Intronic
1007960199 6:45951872-45951894 GTGTGTTTGGGGAGGGACATGGG - Intronic
1007995985 6:46308458-46308480 ATGTGGTTGGGCAGGGCCAGAGG + Intronic
1008169706 6:48187844-48187866 TTGTGTTTTGGCAGGGCGAGGGG - Intergenic
1009580431 6:65526555-65526577 CTGCGCTTTGGGAGGCCGAGGGG + Intronic
1009874336 6:69486185-69486207 CTGTTTTGGGGTAGGGGGAGGGG + Intergenic
1009951570 6:70402936-70402958 CTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1010331659 6:74630130-74630152 AGGTGTTTGGGGAGGGAGGGAGG - Intergenic
1010896655 6:81373073-81373095 TTGTATTTGTGGAGGGTGAGAGG - Intergenic
1012186595 6:96224565-96224587 CTGTGTTTTGTGTGGGTGAGGGG + Intergenic
1012773125 6:103466378-103466400 GTGTGTTTGGGGAAGCAGAGGGG + Intergenic
1013278468 6:108610089-108610111 CTGTATATGGGGAGGGGAAGGGG - Intronic
1013696596 6:112709610-112709632 CTGTGGTTGGGTCGGGGGAGGGG + Intergenic
1013712158 6:112914513-112914535 CTGTGGTTGGGTCGGGGGAGGGG - Intergenic
1014273908 6:119365379-119365401 GTGTGCTTGGGAAGGGAGAGAGG + Intergenic
1014660525 6:124165663-124165685 CTGTGGTGGGGTAGGGGGAGGGG - Intronic
1014813152 6:125907393-125907415 CTGTGTTTGGGGAGTGTGAAGGG - Intronic
1015050632 6:128835456-128835478 CTGTCTTGGGGTAGGGGGAGGGG + Intergenic
1015480246 6:133700638-133700660 CTGGGATTGGGGAGGGTGGGAGG - Intergenic
1015480416 6:133702281-133702303 CTGGGTTGGGGGAGGCAGAGAGG - Intergenic
1015525429 6:134171364-134171386 GTGTGTGTGTGGAGGGTGAGGGG + Intronic
1016301187 6:142633548-142633570 CAGTGTTTGGGGAGGCTGAGGGG + Intergenic
1016682689 6:146849160-146849182 CTGTGCTTGGAGGGGGCAAGTGG + Intergenic
1017845785 6:158257194-158257216 TTGTTTTTTGGGAGGGAGAGGGG - Intronic
1018715513 6:166529798-166529820 GTGTGTTTGGGGGCGGGGAGAGG - Intronic
1019385712 7:754943-754965 CTGGGTGTGGGGAGGGCCTGCGG - Intronic
1019746796 7:2705299-2705321 CTGTTTCTGGGGTGGGGGAGTGG - Intronic
1019811340 7:3167374-3167396 CTGTGTGTGGGGATGGGGATGGG - Intronic
1019821688 7:3248477-3248499 GTGTGTATGGTGGGGGCGAGGGG - Intergenic
1021264391 7:18501698-18501720 CTGTGTTTGGTGAAGAGGAGGGG + Intronic
1022420883 7:30222568-30222590 CTCTGCTTGGAGAGGGTGAGTGG + Intergenic
1023287190 7:38631747-38631769 TTGTATTTGGGGAGAGTGAGGGG + Intergenic
1023522815 7:41065845-41065867 CTGTGGGTGGGGAAGGCGGGAGG + Intergenic
1023882011 7:44325966-44325988 CTGTGTTATGTGAGAGCGAGGGG - Intronic
1023895900 7:44432633-44432655 CTGTATTTGGGGTGGTGGAGAGG - Intronic
1024753224 7:52495054-52495076 CTGTGGTGGGGTAGGGGGAGAGG - Intergenic
1025263583 7:57438585-57438607 GAGGGTTTGGGGAGGGCCAGTGG + Intergenic
1025614953 7:63110354-63110376 CAGTGTTTGGGAAGGGCCATGGG + Intergenic
1026184240 7:68069535-68069557 CTGTGTGTCGGGGGGGCCAGGGG + Intergenic
1026479341 7:70764831-70764853 CTGTGGTTGGGCAGGGAGAGGGG - Exonic
1027570221 7:79856891-79856913 CTGTGTTTGGGGAGAGAGCATGG - Intergenic
1028405430 7:90468957-90468979 GTGTGGTTGGGGAGGGGTAGAGG - Intronic
1029131368 7:98333732-98333754 CTTAGTTTGGGGAGGGTGGGCGG - Intronic
1029240065 7:99154008-99154030 GTGTTTTTTGGGAGGGGGAGGGG - Intergenic
1029418177 7:100456586-100456608 GTGTGTTTGTGGACGGCGGGAGG - Intergenic
1031943482 7:127814284-127814306 CTGTGTTTGGGGGTAGGGAGAGG + Intronic
1032582554 7:133116863-133116885 GTGTGTGTGGGGAGGGGGGGCGG - Intergenic
1032854919 7:135825971-135825993 GTGTGTTGGGGGAGGGGGAGAGG + Intergenic
1033882588 7:145903283-145903305 GTGTGCTTGGGGAGGGGGATGGG + Intergenic
1033997568 7:147370033-147370055 CTGTGTTTGGGGAGAGGCAAGGG - Intronic
1034324816 7:150220653-150220675 GTGTGTGTGGGGAGAGCCAGGGG + Intergenic
1034352636 7:150427411-150427433 GTGTGTGTGGGGGGGGCGTGGGG + Intergenic
1034768375 7:153748578-153748600 GTGTGTGTGGGGAGAGCCAGGGG - Intergenic
1034988693 7:155533952-155533974 CTGAGGTTTGGGAGGGGGAGGGG + Intergenic
1035661520 8:1351876-1351898 CTGTGTTTGGAAAGGCCGTGCGG + Intergenic
1035661587 8:1352232-1352254 CTGTGTTTGGAAAGGCCGTGTGG + Intergenic
1035973788 8:4284372-4284394 CTCTTTTTGGGGAGGGTGGGTGG - Intronic
1036040695 8:5077090-5077112 CTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1036062610 8:5341164-5341186 CTGTCTTTGGGTGGGGGGAGGGG - Intergenic
1036184140 8:6609815-6609837 CTGTGTGTGGGGGGGGGGCGGGG - Intronic
1036611388 8:10353036-10353058 CTTCGTTTGGGTAGGGGGAGAGG + Intronic
1037062542 8:14532706-14532728 GTGTGTGGGGGGAGGGCGGGGGG + Intronic
1038037645 8:23700082-23700104 CTGTGTTAGAAGAGGGTGAGAGG + Intergenic
1038845813 8:31228769-31228791 CTGTGCTTTGGGAGGCCAAGGGG - Intergenic
1039469187 8:37803015-37803037 CTGTGATTAGGGAGGGGGAGTGG + Intronic
1039697979 8:39932439-39932461 CTGGGATGGGGGCGGGCGAGTGG - Intergenic
1040471090 8:47736772-47736794 GTGTGTGTGGGGGGGGCGGGGGG - Intergenic
1040777444 8:51063005-51063027 CTGTTGTGGGGGAGGGGGAGGGG + Intergenic
1040853375 8:51924706-51924728 CTGTGTTTTGGGAGAGACAGAGG - Intergenic
1041569136 8:59316877-59316899 CTGTAATTGGGGAAGGAGAGAGG - Intergenic
1041626031 8:60028073-60028095 CTGGGTTTGGGGAGGACGTAAGG - Intergenic
1042909324 8:73809130-73809152 GTGTGTTGGGGGTGGGTGAGAGG + Intronic
1043206585 8:77451303-77451325 CAGTGTTTGGGAAGAGAGAGAGG - Intergenic
1043401595 8:79890652-79890674 GTGTGTTTGGGGAGGTGGGGTGG - Intergenic
1044516869 8:93149160-93149182 CTATCTTTGGGGAGAGTGAGAGG - Intronic
1044931863 8:97259301-97259323 CTGTAGGTGGGGAGGGCAAGGGG - Intergenic
1045591451 8:103603144-103603166 CTGTGTTGGGGTGGGGGGAGGGG - Intronic
1045769173 8:105714198-105714220 GTGTGTGTGGGGAGGGACAGGGG + Intronic
1047725312 8:127679249-127679271 CTGGCTTTGGGGAGGGCCGGGGG + Intergenic
1047730337 8:127722790-127722812 GTGGGTTTAGGCAGGGCGAGGGG - Intergenic
1047739467 8:127794902-127794924 GGGCGTTTGGGGAGGGTGAGGGG + Intergenic
1047980964 8:130181659-130181681 CTGTGTGTGGGGAGGGGGCCAGG + Intronic
1048471354 8:134707053-134707075 CTGAGTTTGGGGAGGGGCATGGG - Intronic
1049299560 8:141862399-141862421 CTCTGTTTGGGGAGGGGAAGCGG - Intergenic
1049361784 8:142215518-142215540 GTGTGTGTGGGGAGGCTGAGGGG - Intronic
1049621178 8:143598977-143598999 CTGGGCTTGGGCAGGGCGGGTGG - Exonic
1050649315 9:7758002-7758024 CTGTGTTTGGGTAGGGCTATAGG + Intergenic
1050772805 9:9224302-9224324 ATGTGTATGGGGAGGGAGAAAGG + Intronic
1051967768 9:22849151-22849173 TTTTATTTGGGGAGGGAGAGGGG - Intergenic
1052132725 9:24869492-24869514 CTGTGTTGGGGTGGGGGGAGGGG - Intergenic
1053103708 9:35392636-35392658 CTGTGGTGGGGTAGGGGGAGGGG + Intronic
1053229761 9:36397958-36397980 GTGTGTTTGGAGAGAGGGAGAGG - Intronic
1053651754 9:40176592-40176614 ATGTGTCTGGGGTGGGCGTGGGG + Intergenic
1054893600 9:70281288-70281310 CAGTATTTTGGGAGGCCGAGGGG - Intronic
1055632143 9:78235841-78235863 CTGTGTGAGGCGGGGGCGAGCGG - Intergenic
1057023365 9:91718244-91718266 CGGTGTCTGGGAAGGGAGAGGGG - Intronic
1058239287 9:102536275-102536297 CTGTTTTTGGGTGGGGGGAGGGG + Intergenic
1058843630 9:108934325-108934347 CTGTAATTGGGGGGGGCGGGGGG + Exonic
1059165404 9:112072511-112072533 GTGTGTTGGGAGAGGGGGAGGGG - Intronic
1059246862 9:112856347-112856369 GTGTGTATGGGGAGGGCACGTGG + Intronic
1059486155 9:114628468-114628490 CTGTGTTTTGGGAATGTGAGAGG + Intronic
1059745825 9:117200228-117200250 CTGTTGTTGGGTAGGGGGAGGGG - Intronic
1059921528 9:119165917-119165939 CTGTGTGTGGGGAACGGGAGTGG + Intronic
1060050346 9:120374293-120374315 CTGTCATTGGGGAAGGAGAGGGG - Intergenic
1060120912 9:120988524-120988546 GTGTGTTTGAGGAAGGCTAGTGG + Intronic
1060346501 9:122821397-122821419 GTGTGTTTGGGGATGGTGTGGGG - Intronic
1060722486 9:125988335-125988357 CTGTTTTCGGGGAGTGTGAGGGG - Intergenic
1060828733 9:126700837-126700859 ATGTGTCTGGGGATGGCGGGTGG - Exonic
1060925842 9:127454591-127454613 ATGTGTTTGGTGAGGGAAAGTGG + Exonic
1060933360 9:127502757-127502779 CTGGGCCTGGGGAGGGAGAGCGG - Exonic
1060977074 9:127771150-127771172 CTGGGCCTGGGGAGGGCCAGCGG - Intronic
1061489869 9:130938976-130938998 GTGTGTCGGGGGAGGCCGAGGGG - Intronic
1061781842 9:133000706-133000728 ATGTTTTGGGGGAGGGCGTGGGG + Intergenic
1062079745 9:134617560-134617582 CTGTTTCTGGGGTGGGCGATAGG - Intergenic
1062431617 9:136529053-136529075 CTGGGTCTGGGGAGGGCGTGGGG - Intronic
1203473031 Un_GL000220v1:125169-125191 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
1185749201 X:2597161-2597183 TTGTGTTTGGGGAGGGTGGGCGG + Intergenic
1185798422 X:2986834-2986856 CTGTGGTGGGGTAGGGGGAGGGG - Intergenic
1186037566 X:5441289-5441311 ATGTGTGTGGGGAGGGTTAGGGG + Intergenic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186325076 X:8467179-8467201 GTGTGTGTGGGGAGGGAGGGAGG + Intergenic
1187157876 X:16738031-16738053 CAGTGTTTAGGGAGGGGAAGAGG + Intronic
1187462512 X:19500576-19500598 CTTGGTTTGGGGAGGGAGAGTGG - Intronic
1187951649 X:24476589-24476611 CTGTGTTTGGGGGTGGGGAGGGG - Intronic
1188726077 X:33583816-33583838 CTGTGTGTGGGGGTGGGGAGGGG - Intergenic
1189074924 X:37905431-37905453 GTGTGTGTGGGGGGGGCGTGGGG + Intronic
1189075054 X:37905950-37905972 CTGGGGGTGGGGAGGGAGAGGGG + Intronic
1189252782 X:39614027-39614049 GTGTGTTTGGCGGGGGGGAGCGG - Intergenic
1189284297 X:39840569-39840591 CTGTGTTTGGCTATGGCGCGTGG + Intergenic
1189665406 X:43349963-43349985 CTGTGTGTGGGGTGGGGGTGGGG + Intergenic
1189882919 X:45510766-45510788 CTGTGTGTGGGTAGGGGGATAGG - Intergenic
1190037243 X:47036953-47036975 CTGTGGTGGGGTAGGGGGAGGGG + Intronic
1191585831 X:62825579-62825601 CTGTTTTGGGGTAGGGGGAGGGG + Intergenic
1191727489 X:64296727-64296749 CTGTGTTGGGGGCGGGGGAGGGG - Intronic
1192458087 X:71294384-71294406 CTGTGTTTGGCCAGGTAGAGAGG + Exonic
1192828936 X:74729922-74729944 GTGTGTTTGGGGTGGGGGGGAGG + Intergenic
1193089260 X:77476607-77476629 CTGTTGTTGGGTAGGGGGAGGGG + Intergenic
1193210593 X:78802522-78802544 CTGTTGTTGGGTAGGGGGAGGGG - Intergenic
1193453782 X:81703320-81703342 CTGTTTTTGGGTGGGGGGAGGGG + Intergenic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1194026995 X:88764661-88764683 CAGTGTATGGGGAGTGGGAGAGG - Intergenic
1195322131 X:103728691-103728713 GGCTGTTTGGGGAGGGCCAGAGG + Intergenic
1197096559 X:122603824-122603846 GTGTGGTGGGGGAGGGGGAGGGG - Intergenic
1197144874 X:123160213-123160235 GTGTGTTTGCGGGGGGCAAGAGG + Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1197942358 X:131803168-131803190 CTGGGTTTGGGGCGGGGTAGGGG + Intergenic
1197968099 X:132086200-132086222 GTGTGTTTGGGGGGGGCAATTGG + Intronic
1198113471 X:133522990-133523012 CTGAGATTGGGGAGAGAGAGTGG - Intergenic
1198620229 X:138499663-138499685 ATGGGTTTGGGGAGGGCAAAGGG + Intergenic
1199694962 X:150337416-150337438 CCGTGTGTGGGGTGGGGGAGGGG - Intergenic
1201158702 Y:11153280-11153302 CTGTCATTGGGGATGGAGAGGGG + Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic
1202168659 Y:22018196-22018218 CTATGATTGGGGATGGCCAGTGG - Intergenic
1202222702 Y:22568172-22568194 CTATGATTGGGGATGGCCAGTGG + Intergenic
1202320413 Y:23627488-23627510 CTATGATTGGGGATGGCCAGTGG - Intergenic
1202550354 Y:26042568-26042590 CTATGATTGGGGATGGCCAGTGG + Intergenic