ID: 934556426

View in Genome Browser
Species Human (GRCh38)
Location 2:95289249-95289271
Sequence TCCTCCCCTTTGATTTAGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934556414_934556426 28 Left 934556414 2:95289198-95289220 CCCGTTTCCTTCTTAATCCCTGA 0: 1
1: 0
2: 1
3: 26
4: 299
Right 934556426 2:95289249-95289271 TCCTCCCCTTTGATTTAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 114
934556418_934556426 21 Left 934556418 2:95289205-95289227 CCTTCTTAATCCCTGACAGGGTG 0: 1
1: 0
2: 1
3: 8
4: 114
Right 934556426 2:95289249-95289271 TCCTCCCCTTTGATTTAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 114
934556423_934556426 -8 Left 934556423 2:95289234-95289256 CCCTGAGGCTGCCTGTCCTCCCC 0: 1
1: 1
2: 4
3: 63
4: 515
Right 934556426 2:95289249-95289271 TCCTCCCCTTTGATTTAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 114
934556420_934556426 11 Left 934556420 2:95289215-95289237 CCCTGACAGGGTGAGGTGACCCT 0: 1
1: 0
2: 1
3: 26
4: 134
Right 934556426 2:95289249-95289271 TCCTCCCCTTTGATTTAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 114
934556421_934556426 10 Left 934556421 2:95289216-95289238 CCTGACAGGGTGAGGTGACCCTG 0: 1
1: 0
2: 0
3: 17
4: 222
Right 934556426 2:95289249-95289271 TCCTCCCCTTTGATTTAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 114
934556424_934556426 -9 Left 934556424 2:95289235-95289257 CCTGAGGCTGCCTGTCCTCCCCT 0: 1
1: 0
2: 8
3: 68
4: 501
Right 934556426 2:95289249-95289271 TCCTCCCCTTTGATTTAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 114
934556415_934556426 27 Left 934556415 2:95289199-95289221 CCGTTTCCTTCTTAATCCCTGAC 0: 1
1: 0
2: 4
3: 35
4: 409
Right 934556426 2:95289249-95289271 TCCTCCCCTTTGATTTAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934556426 Original CRISPR TCCTCCCCTTTGATTTAGCC TGG Exonic