ID: 934556654

View in Genome Browser
Species Human (GRCh38)
Location 2:95290079-95290101
Sequence GCTTCCTTCTGAAGAGGTAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 206}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934556654_934556665 19 Left 934556654 2:95290079-95290101 CCCTTACCTCTTCAGAAGGAAGC 0: 1
1: 0
2: 0
3: 11
4: 206
Right 934556665 2:95290121-95290143 CAACTTTCTTAGGAGTGATCTGG 0: 1
1: 0
2: 4
3: 7
4: 128
934556654_934556658 9 Left 934556654 2:95290079-95290101 CCCTTACCTCTTCAGAAGGAAGC 0: 1
1: 0
2: 0
3: 11
4: 206
Right 934556658 2:95290111-95290133 AGCCCCCACCCAACTTTCTTAGG 0: 1
1: 0
2: 1
3: 11
4: 150
934556654_934556666 22 Left 934556654 2:95290079-95290101 CCCTTACCTCTTCAGAAGGAAGC 0: 1
1: 0
2: 0
3: 11
4: 206
Right 934556666 2:95290124-95290146 CTTTCTTAGGAGTGATCTGGTGG 0: 1
1: 0
2: 1
3: 8
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934556654 Original CRISPR GCTTCCTTCTGAAGAGGTAA GGG (reversed) Exonic
901195021 1:7435651-7435673 GCCTCCTTCTGACCAGGCAAGGG + Intronic
902354026 1:15882958-15882980 GTTTCCTGCTGAGGAGGGAAGGG - Intronic
902737676 1:18412048-18412070 GCACCCTTCTGCAGAAGTAAAGG + Intergenic
903195854 1:21687686-21687708 GCTTCCTCCTAAAAAGGAAATGG - Intronic
904339066 1:29821627-29821649 GCTTCCTTGTGCAGAGGAAGGGG + Intergenic
904948645 1:34217969-34217991 GATTCCATCTGGAGAGGTCAGGG + Intronic
906572875 1:46859667-46859689 GCGTCCATCTGGAAAGGTAATGG + Intergenic
907566739 1:55442584-55442606 GCATCCATCTGAAGAGGTTTGGG - Intergenic
909354212 1:74688694-74688716 ACTTTCTTTTGAAGATGTAAAGG - Intergenic
910916507 1:92295096-92295118 GCATGCTTCTGAATAGCTAATGG - Intronic
911276004 1:95859346-95859368 GCTTCCATCTTAAGAGATTATGG - Intergenic
915374370 1:155379997-155380019 GTTTCATTCTTAAGTGGTAAAGG - Intronic
915469467 1:156116870-156116892 CCTTCTTTCTGAAGAGTCAATGG + Intronic
917546983 1:175980720-175980742 GGTCACTTCTGAAGAGCTAAAGG + Intronic
917920829 1:179748218-179748240 GTTTCCTTTTGAAGTGGAAACGG - Intronic
920991217 1:210941642-210941664 GCATACTTCTGAGGAGGCAAAGG + Intronic
921593627 1:217031495-217031517 GCTTTCTTCTTAAGAGAAAATGG + Intronic
922354615 1:224764006-224764028 GCTTTATTCTTAAGAGGAAAAGG + Intergenic
924089374 1:240486680-240486702 GCTCCCTTGTGCAGAGGGAAGGG - Intergenic
1063090210 10:2858774-2858796 GCTTCCTTTTATAGAGGAAAAGG + Intergenic
1063144862 10:3287794-3287816 GCTGCTTTCCGAAGAGCTAAAGG + Intergenic
1063197259 10:3755172-3755194 TCTTCCTGCTGCAGAGGAAAGGG + Intergenic
1068669829 10:59711170-59711192 ACTTACTTCTAAAGAGGCAAGGG + Intronic
1070167551 10:73910340-73910362 GCTTCCTATTGAAGTGTTAACGG - Exonic
1075033907 10:119046597-119046619 GTTTTGTTCTGAAGAGGCAAAGG + Intronic
1076195158 10:128512577-128512599 GCTTCCCTCTGAAGATGAAAAGG - Intergenic
1078038559 11:7835160-7835182 TCTTCCTTTGGAAGAGGTATTGG + Intergenic
1078443571 11:11387297-11387319 GCTGCCTTCTGCAGAGGCCACGG + Intronic
1080006884 11:27417998-27418020 GCTTCCTTTACAAGAGGGAAAGG + Intronic
1080897627 11:36459488-36459510 CCTTCCTTCTGGAAAGGCAATGG + Intronic
1085626684 11:78079408-78079430 GCTTGATTCTAAAGAGCTAATGG + Intronic
1087577679 11:100010301-100010323 GCTACCATCTCTAGAGGTAAGGG + Intronic
1088026124 11:105185509-105185531 TCTTTCTCCTGAAGAGCTAAAGG - Intergenic
1088090233 11:106029933-106029955 GTTTTTTTCTGAAGAGGAAAAGG + Intergenic
1089672580 11:120066771-120066793 GCTTTCTTCTTATGAGGTAAGGG - Intergenic
1090998098 11:131885268-131885290 GCTTCCAGCTGGAGAGGAAAAGG + Intronic
1093064212 12:14639702-14639724 ACTTCCTCCAGAAGAGCTAAGGG - Intronic
1096583447 12:52603027-52603049 CCTTCCCTCTGAAGAGGAGAAGG + Intergenic
1098554997 12:71808269-71808291 TCTTTCTTCTGAGGAGGCAAGGG + Intergenic
1100294046 12:93244264-93244286 GCTTCCTCCTGAAGTGGGAGGGG - Intergenic
1101739028 12:107485471-107485493 GCTTCCATCTCAAGAAGCAAAGG - Intronic
1102298625 12:111755880-111755902 GGGTCATTCTGAAGAGGAAAAGG - Intronic
1103087245 12:118071060-118071082 GTTTCCTACTGAAGAGAGAAAGG + Exonic
1104728889 12:131094367-131094389 CCTTCCTTATGAAGAGTGAATGG - Intronic
1104993523 12:132640321-132640343 CCTTCCCTCTGAAGAGGCAGGGG + Intronic
1105660775 13:22491989-22492011 GCTTCCTTCTGAAGGTTTTAGGG - Intergenic
1107101454 13:36597825-36597847 CCTTCCATCTGAAGAAGTAGAGG - Intergenic
1109377831 13:61521055-61521077 TCTTCCACCTGAAGAGTTAAAGG - Intergenic
1112949533 13:104975588-104975610 GCTTTCTACTGAAGAGTTGATGG - Intergenic
1113658051 13:112082440-112082462 GGTTCCTTCTGAAGTTGTGAGGG + Intergenic
1113658152 13:112083172-112083194 GCATTCTTCCGAAGGGGTAAAGG - Intergenic
1113740287 13:112707921-112707943 GCATACTTCTCAAGATGTAATGG - Intronic
1115569184 14:34651024-34651046 GCTTCCTTCTGAAGCTCTAGTGG + Intergenic
1117738323 14:58790176-58790198 GCTCCCTACAAAAGAGGTAATGG + Intergenic
1118052355 14:62043211-62043233 ACTTCCTTCTGAGGGGGTACTGG - Intronic
1121428557 14:93871188-93871210 GCTTCCTTCTGAGGCTGTTAGGG + Intergenic
1122052774 14:99071304-99071326 GGTTCCTTCTGAAGCTGTGAGGG - Intergenic
1122638933 14:103145833-103145855 GCCTCCTTCTGAGGAAGTGAGGG - Intergenic
1126895766 15:53255735-53255757 ACTTCCTTACCAAGAGGTAAAGG + Intergenic
1127759865 15:62128211-62128233 GCTTTCTACTGAAGAGTTGATGG + Intergenic
1128861038 15:71072489-71072511 GCTTCCTTTTGCAGAGGAAGGGG + Intergenic
1131079949 15:89526477-89526499 GCTTCCTCCTGAAATGGCAAGGG + Intergenic
1131940658 15:97561559-97561581 GCTCCCTTCTTAAGAGACAATGG + Intergenic
1132017191 15:98328460-98328482 GTTTCCCTCTGAAGAGGAAAAGG - Intergenic
1132190198 15:99848402-99848424 GCTTCATTTAGAAGAGGAAATGG + Intergenic
1132781010 16:1625639-1625661 GCTTCATTTTGCAGAGGGAAGGG + Intronic
1133327027 16:4948055-4948077 GCTCCGTTCTGAAGCGGAAATGG - Intronic
1134080761 16:11323466-11323488 GCTTCCTCCAGAAGATGGAAGGG - Intronic
1134653788 16:15931184-15931206 CCTTCCTTCTCAATAGGTAATGG - Intergenic
1135882586 16:26273079-26273101 GCTCACTGCTGAAGAGGGAAGGG + Intergenic
1136279297 16:29198654-29198676 GCTTCCCTGTGAAGATTTAAGGG - Intergenic
1138276306 16:55737367-55737389 GCTTGAGGCTGAAGAGGTAATGG + Intergenic
1139419572 16:66842245-66842267 GAGTCCCTCTGAAGAGGAAATGG + Intronic
1140663304 16:77208195-77208217 GCTTCCCTCTGAAGAAAGAAAGG - Exonic
1141133608 16:81451567-81451589 GCCTCCTTTTGAAGAGGGAAGGG + Intronic
1141595398 16:85094295-85094317 GTTTCCTTCTGAAAAGCTATGGG - Intergenic
1142083688 16:88164755-88164777 GCTTCCCTGTGAAGATTTAAGGG - Intergenic
1144251370 17:13419961-13419983 GCTTCCTCCTGTAGATCTAAAGG - Intergenic
1145081796 17:19900381-19900403 GCATTCTATTGAAGAGGTAATGG - Intergenic
1148201739 17:45753905-45753927 GATTCCTCCCGGAGAGGTAAGGG + Intergenic
1152179050 17:78806560-78806582 GCTTCCTGCTGCAGAGGTGCCGG + Intronic
1153148224 18:2057803-2057825 TCTTTCTTCTGAGGATGTAACGG - Intergenic
1153552894 18:6280893-6280915 GCTTCCTTCTGAAGGCTCAAGGG - Intronic
1153915697 18:9742297-9742319 GCTTCCTACTGAAGAGTGGATGG + Intronic
1155558198 18:27045418-27045440 TCTTTCTTCTGATGAGATAAAGG + Intronic
1155801705 18:30113676-30113698 ACTTCTTTCTGTAGAGGTGATGG + Intergenic
1157389495 18:47289246-47289268 ACTTCCTTCAGAAGTGGTACAGG + Intergenic
1158410089 18:57197890-57197912 ACTTCTTTCCGAAGAGGCAAAGG + Intergenic
1158945649 18:62444929-62444951 GCTTTCTTCGGAGGAGGCAAGGG + Intergenic
1159891315 18:73955686-73955708 TCTTTCTTCTGAGGAGGCAAGGG + Intergenic
1159938231 18:74385586-74385608 TCTTTCTTCTGAGGAGGCAACGG - Intergenic
1161637173 19:5396250-5396272 CCTTCCTTCTGATGATTTAAAGG - Intergenic
1162246982 19:9409417-9409439 GCACCCTTCTGCAGAAGTAAAGG + Intergenic
1162921274 19:13904747-13904769 GCTTCCTTTTAAGGAGGTTAAGG + Intronic
925145022 2:1575603-1575625 GCTTCCCTCCGGAGAGGAAAAGG + Intergenic
925377956 2:3401494-3401516 TCTTTATTCTGAAGAGGAAACGG - Intronic
927065339 2:19465278-19465300 GGTTTCTTCTGGTGAGGTAAGGG + Intergenic
927665496 2:25029263-25029285 GCTGCTTACTGAAGAGGTCACGG - Intergenic
929232176 2:39571191-39571213 GCTTTGGTCTGAAGCGGTAAAGG + Intergenic
930697143 2:54423358-54423380 GCCCCCTTCTGAGGAGGGAAGGG + Intergenic
932381524 2:71287987-71288009 TTTTCATTCTTAAGAGGTAAGGG + Intronic
932407352 2:71522303-71522325 GATTCCTACTGAAGAGGAGAAGG - Intronic
932432598 2:71684951-71684973 GCCTCCTTCTGAAAAGCCAAGGG + Intronic
932460700 2:71880085-71880107 TCTGCCTTCTGGAGAGGTCAGGG + Intergenic
934556654 2:95290079-95290101 GCTTCCTTCTGAAGAGGTAAGGG - Exonic
935627726 2:105185151-105185173 GCTTCCTCCAGATGAGGTCATGG - Intergenic
936006539 2:108893880-108893902 GCGTGTTTTTGAAGAGGTAAAGG - Intergenic
936025510 2:109028381-109028403 TCTTCCTTCAGTGGAGGTAAGGG - Intergenic
937024859 2:118689560-118689582 CCTTCCCTCTGAAGTGGAAAGGG - Intergenic
939896145 2:147793384-147793406 TCTTCTTTCTGAAGAGCTAATGG - Intergenic
940160525 2:150707953-150707975 ACTTCCTTCTGCAAAGGCAAGGG + Intergenic
942458561 2:176153714-176153736 GCTTCCTTCTGGAAGGGTTAAGG - Intronic
944937042 2:204580189-204580211 GCTTCCTTCTAAAGAGAGAGGGG + Intronic
945046135 2:205783588-205783610 GCTTCCTTCTGAGGAAGTTCAGG + Intronic
945516989 2:210774773-210774795 ACATCCTTGTGAAGAGGAAAAGG + Intergenic
945673600 2:212831280-212831302 GCATCCTTGTGCAGAGGAAAGGG + Intergenic
946023445 2:216657445-216657467 GGGTCCATCTGAAGAGGGAAGGG + Intronic
946429365 2:219616495-219616517 GCTTCTGTCAGAAGAGGTTAGGG - Intergenic
946739465 2:222787734-222787756 CCTTCCTTATGAGAAGGTAAAGG - Intergenic
947076362 2:226349987-226350009 GGTTCCTTCTGAAGCTGTCAGGG - Intergenic
947273894 2:228370052-228370074 GGTGCTTTCTAAAGAGGTAAAGG + Intergenic
1170248018 20:14245649-14245671 GCTTCCTTTTGAATAGGAGAGGG + Intronic
1171164850 20:22960641-22960663 GCTTCATTCTGAAGACTTCAGGG + Intergenic
1172763702 20:37339528-37339550 GCTCCCTTCTAAAGAGTTCAGGG - Intergenic
1177228709 21:18291170-18291192 GCTTCCTACAGATGAGGAAACGG + Intronic
1178446293 21:32646775-32646797 GCTTGTTTCAGAAGATGTAAAGG + Intronic
1178522611 21:33299126-33299148 GCTTCCTTGTGCAGAGGGAGGGG - Intergenic
1179239599 21:39578293-39578315 GCACCCTTCTGCAGAAGTAAAGG - Intronic
1179487363 21:41719043-41719065 GAATCCTTCTGCAGAGTTAAAGG - Intergenic
1179536023 21:42052960-42052982 GCTTGCTTCTGAAGATTGAAGGG - Intergenic
1182055316 22:27348965-27348987 TCTTCTTTCTGAGGAGGCAAGGG - Intergenic
1182311430 22:29411399-29411421 GCTCCATTCTGAATAGGTATTGG + Intronic
1182689552 22:32148890-32148912 GCTCCATTCTGAATAGGTATTGG - Intergenic
1184193499 22:42910735-42910757 GCATCCTTCTGGAGGGGTGAGGG - Intronic
1184625897 22:45729575-45729597 GCCTCCTGATGATGAGGTAAGGG + Exonic
951506238 3:23448202-23448224 GCTTCATTCTGAAAAGATTACGG - Intronic
954919964 3:54181748-54181770 GCTTCTTATTGAAGAAGTAATGG + Intronic
955498033 3:59556608-59556630 GCTTTCTTCTAAAGAGATACTGG - Intergenic
956591716 3:70922333-70922355 GAATCCTTCTTAAAAGGTAAAGG - Intergenic
956667282 3:71654074-71654096 TCTTCTTTATGAAGAGGAAAGGG - Intergenic
957032174 3:75254712-75254734 GCTTCCTTGTGCAGAGGAAGGGG + Intergenic
959958495 3:112268336-112268358 TTTTCCCTCTGAAGAGGAAAAGG - Intronic
960707689 3:120496075-120496097 GCACCCTTCTGCAGAAGTAAAGG + Intergenic
961011585 3:123440039-123440061 GCTTCCTTCTGTGGAGGTGTTGG + Intronic
962183147 3:133229732-133229754 GATTCCTCATGAAGAGGAAATGG + Intronic
962622046 3:137189944-137189966 TCTATCTTCTGCAGAGGTAAGGG + Intergenic
963292836 3:143510982-143511004 GCTTCATTCTAAAGATTTAAAGG - Intronic
963793146 3:149604725-149604747 CCTTCCTGCTGAAGCGGTACTGG + Intronic
964479854 3:157129795-157129817 GCCTCCTTCTGAAAAGGTGGGGG - Intergenic
965205329 3:165713823-165713845 TCCTCCCTCTGAAGAGGTACAGG + Intergenic
965299422 3:166990998-166991020 TCTTTCTTCTGAGGAGGCAAGGG + Intergenic
966201521 3:177363385-177363407 ACTTCCTTATGAAAAGGTTAGGG + Intergenic
967555211 3:190849106-190849128 GCTTCCTTTTGAAATGATAAGGG - Intergenic
969722658 4:8901129-8901151 GGTTCCTTCTGAAGCTGCAAGGG + Intergenic
971467529 4:26979561-26979583 GAAGCCTTCTGAAGAGGAAAAGG + Intronic
973562244 4:52148866-52148888 GCTTTCTTCTCAGGAGTTAAGGG + Intergenic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
979493508 4:121357830-121357852 GCTTCCAACTGAAGAGGTTAAGG + Intronic
979661430 4:123260016-123260038 GCTGGCCTCTGAAGATGTAAGGG - Intronic
981841240 4:149115056-149115078 GCTTCCTGATGAAGGGGAAAAGG - Intergenic
985290281 4:188379672-188379694 GCATGCATCTGAAGAGGTAATGG + Intergenic
989290606 5:39760788-39760810 GCTTGCATCTGAAGAAGAAATGG - Intergenic
990207912 5:53450186-53450208 GATTCAGTCTCAAGAGGTAAGGG - Intergenic
992030455 5:72716159-72716181 GGTTCCTTCTGAAGGGGTGGAGG + Intergenic
992782545 5:80141377-80141399 GCTGCTTTCTGCAGAGGAAAGGG + Exonic
993167875 5:84382066-84382088 TCTGCCTTCTGCAGAGGTGAGGG + Intronic
995362332 5:111311460-111311482 CCTTCCTTCTAAAGAGAGAATGG - Intronic
998523002 5:142817499-142817521 TCTTCCTGCTGTAGAGGTGAAGG + Intronic
999377539 5:151097219-151097241 GCTTCCTCATCAATAGGTAAAGG + Intergenic
999910118 5:156188531-156188553 GCTTCCTGCTGAGGAAGGAAAGG - Intronic
1000545619 5:162597610-162597632 TCTTACCTATGAAGAGGTAATGG - Intergenic
1000795775 5:165662620-165662642 GCTTCCCTGTTAAGAGGTCAAGG - Intergenic
1002782527 6:378533-378555 GCTTCCTTCTGGAGAGCGATGGG - Intergenic
1005621492 6:27624482-27624504 CCTTCCTTCTGGAGAGAGAAAGG + Intergenic
1007948886 6:45851977-45851999 GCATTCTTCTGCAGAGGTGATGG - Intergenic
1010563756 6:77383533-77383555 ACTTCCTGCTGATGAGGGAATGG + Intergenic
1012360545 6:98372704-98372726 GCTACATTTTGAAAAGGTAAAGG - Intergenic
1015894243 6:138001140-138001162 GCTTCTTTCTGGAGAGGAAGTGG - Intergenic
1016688068 6:146903679-146903701 GCTTCCTTCTGGAGAGGAAGAGG - Intergenic
1018647426 6:165961367-165961389 GCTTCCTTCTGAAGTAGGACAGG - Intronic
1020998196 7:15291856-15291878 GCTTCCTTCTGGAGAAGAAAGGG + Intronic
1022880918 7:34586610-34586632 CCTTGGTTCTGAAGAGGAAAGGG - Intergenic
1022896867 7:34758996-34759018 GTTTCCTTCTGAATAGATTAAGG + Intronic
1031060996 7:117051453-117051475 GTTTCTTTCTGAACAGGCAAAGG - Intronic
1033520368 7:142154335-142154357 GCTGCCTTCTGAAGATAGAATGG + Intronic
1034661873 7:152778158-152778180 GATTCCTTAGGAAGAGATAATGG - Intronic
1034817993 7:154190414-154190436 TCTTCCTTCTCAAAAGGTGATGG + Intronic
1034947405 7:155271919-155271941 GCTGCCTTCCCAAGTGGTAAAGG + Intergenic
1037385536 8:18336416-18336438 GCTTCTTCCTGAAGAGTTAGGGG + Intergenic
1038786328 8:30620068-30620090 GGTTCCTTCTGGAGACATAAAGG - Intronic
1039773751 8:40715696-40715718 GCTTCCTTCCAAAGAGCGAAAGG - Intronic
1042709920 8:71706326-71706348 GCTTAGTCTTGAAGAGGTAAAGG + Intergenic
1044933931 8:97276133-97276155 GCTTCATTCTGCAGTGGCAATGG + Exonic
1046219349 8:111193028-111193050 TCTTTCTTCTGAAGAGGCAAAGG + Intergenic
1046724922 8:117663812-117663834 GCTTCCTTCCAAAGGGGAAAGGG - Intergenic
1048344561 8:133566950-133566972 ACATGGTTCTGAAGAGGTAAGGG - Intronic
1048502601 8:134992397-134992419 GTTTCTTTCTGAGGAGGGAAAGG + Intergenic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1054928808 9:70615369-70615391 GCTTTGTTCTGCAGAGGGAAGGG - Intronic
1056861206 9:90183911-90183933 GATTTCTTTTGAAGAGGTTAAGG + Intergenic
1057408742 9:94797456-94797478 CCTTGTTTCTGAAGAGGTCAGGG - Intronic
1058040791 9:100299375-100299397 TCTTCCTTTTTAAGTGGTAAAGG - Intronic
1058874972 9:109236198-109236220 CCTTGCTTCTGAAGTGGGAAGGG + Intronic
1060144097 9:121236064-121236086 CATTCCCTCTGAAGAGGCAATGG + Intronic
1185580220 X:1206306-1206328 GCTTGCTTCTCAATAGTTAACGG + Intronic
1186234931 X:7497801-7497823 TCTTTCTTCTGAGGAGGCAAGGG - Intergenic
1187295036 X:17990893-17990915 GTTTCCTTATGCAGAGGGAAAGG + Intergenic
1188988631 X:36790448-36790470 GCTTCCTCCTGCAGAGGAAGGGG - Intergenic
1191180157 X:57553445-57553467 GCACCCTTCTGCAGAAGTAAAGG + Intergenic
1192178763 X:68902483-68902505 GCTTCCCTCTGAAGTAGCAAGGG - Intergenic
1192886207 X:75337285-75337307 GTTTCCTTCAGCAGAGGTACAGG - Intergenic
1192890223 X:75382710-75382732 CATTCCTTCTGAAAAAGTAAAGG + Intronic
1193537729 X:82734096-82734118 GCTCTCTTCTGATGCGGTAAGGG - Intergenic
1195646348 X:107235103-107235125 GCTTCCCTCAAGAGAGGTAAAGG - Intronic
1196069309 X:111502228-111502250 GGTTACTTCTGTAGAGGTGAGGG + Intergenic
1196510166 X:116499868-116499890 CCTTCCTTCTGAATAAGTAGAGG - Intergenic
1198971937 X:142291858-142291880 GTTTCATGCTGAACAGGTAAAGG - Intergenic
1200269019 X:154663456-154663478 TCTTTCTTCTGAGGAGGCAAGGG + Intergenic