ID: 934557240

View in Genome Browser
Species Human (GRCh38)
Location 2:95293945-95293967
Sequence GGAGGAGCCCACAGAGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934557225_934557240 30 Left 934557225 2:95293892-95293914 CCATGTGAAACACTCTAGTCAGG No data
Right 934557240 2:95293945-95293967 GGAGGAGCCCACAGAGAAAGAGG No data
934557236_934557240 -4 Left 934557236 2:95293926-95293948 CCAGGCTCTTAGGACCCTTGGAG No data
Right 934557240 2:95293945-95293967 GGAGGAGCCCACAGAGAAAGAGG No data
934557234_934557240 4 Left 934557234 2:95293918-95293940 CCATGGGGCCAGGCTCTTAGGAC No data
Right 934557240 2:95293945-95293967 GGAGGAGCCCACAGAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934557240 Original CRISPR GGAGGAGCCCACAGAGAAAG AGG Intergenic