ID: 934558264

View in Genome Browser
Species Human (GRCh38)
Location 2:95298905-95298927
Sequence TCCCATCTCTGTAGTCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934558264_934558265 -8 Left 934558264 2:95298905-95298927 CCTGCATGACTACAGAGATGGGA 0: 1
1: 0
2: 0
3: 12
4: 158
Right 934558265 2:95298920-95298942 AGATGGGAATTTCCAGAGTCAGG 0: 1
1: 0
2: 0
3: 22
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934558264 Original CRISPR TCCCATCTCTGTAGTCATGC AGG (reversed) Intronic