ID: 934558264 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:95298905-95298927 |
| Sequence | TCCCATCTCTGTAGTCATGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 171 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 12, 4: 158} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 934558264_934558265 | -8 | Left | 934558264 | 2:95298905-95298927 | CCTGCATGACTACAGAGATGGGA | 0: 1 1: 0 2: 0 3: 12 4: 158 |
||
| Right | 934558265 | 2:95298920-95298942 | AGATGGGAATTTCCAGAGTCAGG | 0: 1 1: 0 2: 0 3: 22 4: 244 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 934558264 | Original CRISPR | TCCCATCTCTGTAGTCATGC AGG (reversed) | Intronic | ||