ID: 934558532

View in Genome Browser
Species Human (GRCh38)
Location 2:95300265-95300287
Sequence CTGGATCCACAGTCCAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934558532_934558534 -7 Left 934558532 2:95300265-95300287 CCATTTTTGGACTGTGGATCCAG 0: 1
1: 0
2: 1
3: 17
4: 156
Right 934558534 2:95300281-95300303 GATCCAGAGCTAGGAAGTAAAGG 0: 1
1: 0
2: 1
3: 16
4: 216
934558532_934558536 15 Left 934558532 2:95300265-95300287 CCATTTTTGGACTGTGGATCCAG 0: 1
1: 0
2: 1
3: 17
4: 156
Right 934558536 2:95300303-95300325 GACCCCAACATTTTAAATTCAGG 0: 1
1: 0
2: 1
3: 13
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934558532 Original CRISPR CTGGATCCACAGTCCAAAAA TGG (reversed) Intronic
900677295 1:3895757-3895779 CTGCTCCCACAGTCCAAAAAAGG + Intronic
902978365 1:20105758-20105780 CTGGATCCAGACCCCAAAAGAGG - Intergenic
903646452 1:24898951-24898973 CTGGGACCACAGCCCAACAATGG - Intergenic
904494387 1:30878462-30878484 CTGGATCCCCAGAACAAGAAGGG - Intronic
905004365 1:34698188-34698210 AGGGATCCAGAGTCCAGAAATGG + Intergenic
906848790 1:49224787-49224809 AGGGATTCACAGTCCAAAAATGG + Intronic
910198525 1:84672647-84672669 CTTGATCCACAGTCCAGATCTGG - Intronic
910772752 1:90846451-90846473 GTGGATCCAGAGTACAGAAAAGG - Intergenic
911782203 1:101895594-101895616 ATGGATCAAAGGTCCAAAAATGG - Intronic
912193094 1:107363635-107363657 GAGGATCCACATTCCACAAAGGG - Intronic
914913204 1:151802739-151802761 CTGAAGCCACTTTCCAAAAAGGG - Intronic
916660613 1:166920021-166920043 CTCCATCCACAGCCCCAAAATGG - Intronic
919517763 1:198548482-198548504 CTAGATCTATAGACCAAAAAAGG + Intergenic
919976173 1:202614376-202614398 TTGGTTCCACAGACCAGAAATGG + Intronic
924216182 1:241824717-241824739 CTGGAGCCACAGCTCAAAGATGG + Intergenic
1063257351 10:4342849-4342871 CTGTATCCACTGTGAAAAAACGG + Intergenic
1063848600 10:10160458-10160480 CTGGATCCAGACCCCAAGAAAGG + Intergenic
1064159005 10:12927899-12927921 CTACATACACAGTCCAGAAATGG + Intronic
1064648060 10:17480342-17480364 CTGGATCCACAGTCTAAAATAGG - Intergenic
1065179601 10:23111457-23111479 CTGTATTCACAGTGCAAAGAGGG - Intronic
1065469170 10:26059596-26059618 CTGTATCCACTGTTCCAAAATGG + Intronic
1065570696 10:27068665-27068687 CTGGATCCCCAGTACATGAAAGG - Intronic
1068223157 10:54069174-54069196 CTGGATCCAAAATCTAAGAATGG + Intronic
1068261606 10:54590494-54590516 CGGGACCAACATTCCAAAAATGG + Intronic
1070576014 10:77679610-77679632 CTTGATCCAGACTCCAAAAGAGG - Intergenic
1073120594 10:101120484-101120506 CTGAATCTACGATCCAAAAAAGG + Intronic
1074452770 10:113572710-113572732 CTGGATCCTCAGCCCTAAAAAGG + Intronic
1074544864 10:114394510-114394532 CTGGATCTTGAGTCCAAAGAAGG - Intronic
1079724443 11:23863579-23863601 ATTGGTCCACAGTGCAAAAAAGG - Intergenic
1079793774 11:24772716-24772738 CTGGATCCACAGTGTCAACAGGG + Intronic
1080124749 11:28719858-28719880 CTGGAGTCACAGTCCATAGAAGG - Intergenic
1080558648 11:33440813-33440835 ATGGATCCACTATCCAAAAATGG - Intergenic
1081345274 11:41978226-41978248 CTGGATCAAGAGTCCAAGCATGG + Intergenic
1083633041 11:64105485-64105507 CTGCATCCCCAGTGCAGAAAGGG - Intronic
1089451985 11:118605294-118605316 CAGGATCCAGAGGCCAGAAACGG + Intergenic
1090964455 11:131585816-131585838 CTGGAGCCACAGTGGGAAAAAGG - Intronic
1093670513 12:21868873-21868895 CTGTATGCCCAGTCCAATAAAGG - Intronic
1094151580 12:27290401-27290423 CAGGATCCACATTTCTAAAATGG - Intronic
1096553881 12:52391407-52391429 CTGGAACCAAAATCCCAAAAGGG + Intergenic
1098158584 12:67625216-67625238 CTGAATCAACAGACCAAGAAGGG + Intergenic
1098338803 12:69430805-69430827 CTGGATAGATAGCCCAAAAAAGG - Intergenic
1100123643 12:91397253-91397275 GTGGATGCATAGTCCACAAAAGG - Intergenic
1101729087 12:107411926-107411948 CTGGTGCCACAGGCCATAAAAGG - Intronic
1104361666 12:128138842-128138864 CCGGATCCAGACTCCAAGAAAGG + Intergenic
1105512580 13:21062483-21062505 CCAGATCCACAGTCCTCAAATGG - Intergenic
1106174636 13:27319622-27319644 CTGGATACAGAGTCCACAAAAGG + Intergenic
1106247261 13:27960913-27960935 CTTGCTCCACTGTCCAAACAGGG + Intergenic
1106855067 13:33842409-33842431 CTGGATCCACTGGACAAAGAGGG - Intronic
1107989836 13:45810078-45810100 CTGAAGGCACAGTCCAACAAAGG + Intronic
1116400489 14:44500426-44500448 CTGTATTAACAGACCAAAAATGG + Intergenic
1117969389 14:61237067-61237089 CTGTATCCAGACCCCAAAAAAGG - Intronic
1119954288 14:78778951-78778973 CTAGAACCAAAGTCCAAATATGG + Intronic
1120289236 14:82545628-82545650 CTGGATCCAGATCCCAAAAGAGG - Intergenic
1121981438 14:98457844-98457866 CTGAGTCATCAGTCCAAAAAAGG - Intergenic
1124491814 15:30162707-30162729 CTGGTTCCACAGACCAGAAATGG + Intergenic
1124751723 15:32375602-32375624 CTGGTTCCACAGACCAGAAATGG - Intergenic
1125383086 15:39108171-39108193 CTGGTTACTCAATCCAAAAATGG - Intergenic
1125809396 15:42524654-42524676 CTGGTTCCCCAGTGCCAAAAAGG + Intronic
1129150216 15:73683964-73683986 CTGGCACCACAGCCCAGAAAGGG - Intronic
1131558886 15:93422585-93422607 CAGGATTCACAGTCCAGAGACGG - Intergenic
1131637042 15:94247105-94247127 GTAGATTCACAGGCCAAAAAAGG + Intronic
1133979631 16:10623467-10623489 GTGGACCCACAGACCAAAAAGGG - Intergenic
1135863560 16:26079752-26079774 CTAGATGCACAGTCCTCAAAAGG - Intronic
1140602072 16:76488532-76488554 ATGGATCAACAATCCAAATAAGG - Intronic
1144404675 17:14941201-14941223 ATGGATCCAAAGACCAAAGACGG + Intergenic
1144628902 17:16860148-16860170 CTGAATTCAGAGACCAAAAATGG - Intergenic
1145077866 17:19870052-19870074 CTGTATTCACAGGCCAAACATGG + Intergenic
1146585790 17:34080451-34080473 CTGGATCCAGACTCCACAAATGG + Intronic
1148631252 17:49111079-49111101 TTGTATACACACTCCAAAAATGG + Intergenic
1149320505 17:55476422-55476444 CTGGGTGCTGAGTCCAAAAAAGG - Intergenic
1150135738 17:62694019-62694041 CTGGAGCCGCAGCCCAGAAACGG - Intergenic
1151953814 17:77370735-77370757 CTGGACACACAGTCCCAGAAGGG - Intronic
1154195709 18:12264897-12264919 CTGGATCCACTGCCCTCAAAGGG + Intronic
1154463558 18:14620566-14620588 CTGGATCCAGACTCCAAGAGAGG + Intergenic
1160019781 18:75171541-75171563 CAGGACCCACAATCCAACAACGG - Intergenic
1160721933 19:601484-601506 CTCGATCCACAGTAGCAAAAAGG - Intronic
1161130101 19:2583366-2583388 CGGGTTCCACAGTCTACAAAGGG - Intronic
1164231725 19:23294817-23294839 CTGGACCTTCTGTCCAAAAAAGG + Intergenic
1165102374 19:33446616-33446638 CTGGATGCACTGTGCAAACAGGG - Intronic
1165116534 19:33532529-33532551 CTGGATCCAGACCCCAAGAAAGG - Intergenic
1165296394 19:34929629-34929651 CTAGATCAACATTCCCAAAATGG + Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1168460327 19:56549974-56549996 CTGTGTCCACACTGCAAAAAAGG - Intronic
929189889 2:39130101-39130123 CTGGGTCAACAGACCAAGAAGGG + Intergenic
932633537 2:73367929-73367951 CTGGATTAACAGGCCCAAAAGGG + Intergenic
933469414 2:82702261-82702283 CAGGATACACAGTTCCAAAAGGG + Intergenic
933759665 2:85665018-85665040 CAGGAGCCAAAGTACAAAAACGG - Intronic
934558532 2:95300265-95300287 CTGGATCCACAGTCCAAAAATGG - Intronic
935527291 2:104186520-104186542 TTGGGACCACAGTCCAGAAAAGG - Intergenic
939389579 2:141549215-141549237 CAGTATCCACATCCCAAAAATGG + Intronic
939580313 2:143938706-143938728 CTGGAACCACATTTAAAAAAAGG - Exonic
944977774 2:205076675-205076697 CTAGATCCACAGTTCACAATAGG - Intronic
948913488 2:241018338-241018360 CTGGATCCACAGGACAGAGATGG + Intronic
1171329854 20:24327949-24327971 CTGAATCCACAGGCAAAGAAAGG - Intergenic
1173743512 20:45419223-45419245 CGGGATCCACATTCCAGAGATGG - Intronic
1175636285 20:60586982-60587004 CTGGGGCCACTGTCCAAAGAAGG - Intergenic
1176810966 21:13537806-13537828 CTGGATCCAGACTCCAAGAGAGG - Intergenic
1177511897 21:22098117-22098139 CTGTATCCACAGCCCACAATGGG + Intergenic
1182345508 22:29661193-29661215 TTGGATCCACAGAATAAAAAGGG + Exonic
950670868 3:14524633-14524655 CTGGATCCTCATTTCACAAATGG + Intronic
951165774 3:19483788-19483810 CTTGATCCTCAGTGAAAAAAAGG - Intronic
952590358 3:34945456-34945478 CTGGATTCAAAGGCCAAGAAGGG - Intergenic
955992621 3:64644009-64644031 CTGTTTCCACAATCAAAAAATGG + Intronic
956105332 3:65811450-65811472 TTGGATTCCCAGTCCAAATATGG - Intronic
957089057 3:75710151-75710173 ATGGATACACAGTTTAAAAAGGG + Intronic
961899461 3:130196877-130196899 CTGCAGCCACAGTCCAGAAATGG + Intergenic
965008763 3:163058465-163058487 CTGGACTTACAGTCCAACAAAGG + Intergenic
965778252 3:172256201-172256223 CTGGAAGGACAGGCCAAAAAAGG - Intronic
967498469 3:190169103-190169125 CTGAATCTACAGTTTAAAAAAGG + Intergenic
972124713 4:35748919-35748941 ATGGATCCACAGTCCAAATCTGG + Intergenic
972154348 4:36140078-36140100 CTGGATCTACAATCCAATGAAGG - Intronic
978273983 4:106926536-106926558 CAGGATCCTCATTCCAAACACGG + Intronic
978754162 4:112285306-112285328 CTGGAGCCACACTGCATAAATGG + Intronic
979627429 4:122861267-122861289 ATGAATCCAGAGTTCAAAAAAGG - Intronic
981009186 4:139907335-139907357 TTGTATCCAGAGTCCAAATAGGG - Intronic
981147324 4:141340279-141340301 CTGGTTTCACAGTACAAAAGAGG - Intergenic
983699025 4:170568555-170568577 CAGGAACCACAGTGAAAAAATGG + Intergenic
984494174 4:180473842-180473864 CTGAGTTCACAGTCCAAAATGGG + Intergenic
984854676 4:184184724-184184746 ATGGGTCCACAGGCCCAAAAAGG + Intronic
985040140 4:185882755-185882777 CAGGATAGAGAGTCCAAAAAAGG + Intronic
987558651 5:19488886-19488908 CAGAATCCAGAGTCCGAAAATGG - Intronic
988560939 5:32280688-32280710 CTGGGGCCACAGTCCAAATATGG + Intronic
991283714 5:64945086-64945108 GAGGAACCACAGTCCAGAAAAGG - Intronic
991677210 5:69099625-69099647 CTGGACCTAGAGTCCTAAAAAGG - Intronic
994964325 5:106648483-106648505 CAGATTCCTCAGTCCAAAAATGG - Intergenic
996913799 5:128686689-128686711 CCTGATCCACAATCCCAAAAGGG - Intronic
997643490 5:135465306-135465328 CTGAAACCACAGCCCACAAAGGG - Intergenic
1001539233 5:172525808-172525830 GAGTATCCAAAGTCCAAAAAGGG - Intergenic
1003687569 6:8319653-8319675 CTTCCTCCACAGTCCAAAAGAGG - Intergenic
1004761920 6:18676852-18676874 CTGCATCCACATGCCACAAATGG - Intergenic
1005563255 6:27062885-27062907 CTGGATCCAGATTCTGAAAATGG - Intergenic
1006771451 6:36556590-36556612 CTGGATCCACAGACTAGCAATGG + Intergenic
1011019584 6:82797305-82797327 ATGGATCCTCAGTCCAACAATGG - Intergenic
1012611146 6:101222589-101222611 CTGGTTACTCAGTACAAAAATGG - Intergenic
1013211102 6:107987528-107987550 CTGGATCCAGACTCCAAGAGAGG + Intergenic
1018065101 6:160119045-160119067 TTGGATCCACAGTCCCAGGAGGG + Intergenic
1018413190 6:163576925-163576947 TTGGATGCACAGTCCAACTATGG - Exonic
1021776019 7:24056194-24056216 CAGCAACCACAGTCCAACAAGGG - Intergenic
1024590765 7:50880883-50880905 CTGAAGCCACAGTCCACAGATGG + Intergenic
1026492808 7:70877578-70877600 CGGGATCCAAATTCCAAATATGG - Intergenic
1028465301 7:91144722-91144744 CTGGAGCAAGTGTCCAAAAAGGG + Intronic
1029414548 7:100434754-100434776 CTGATTCCACAGCACAAAAAAGG - Intergenic
1030237635 7:107283722-107283744 TTGTTTCCACAGTCCAGAAAAGG - Exonic
1030860644 7:114621697-114621719 CTGGTTCCAAAGTTCAAGAATGG - Intronic
1031628959 7:124022750-124022772 CTGAATCAACAGGCAAAAAAGGG + Intergenic
1036055581 8:5249813-5249835 CTGGATCCAGAGATTAAAAAAGG + Intergenic
1036251662 8:7167702-7167724 CTGCAGCCACAGGCCAGAAATGG + Intergenic
1036365827 8:8119758-8119780 CTGCAGCCACAGGCCAGAAATGG - Intergenic
1038958642 8:32494792-32494814 CTGGATGCACAGACACAAAAGGG - Intronic
1040613277 8:49008440-49008462 CTGGATTCAGAGTCCAAGAGAGG + Intergenic
1042342639 8:67696038-67696060 CTGAATCAACAGGCCAAAACGGG + Intronic
1042429141 8:68684275-68684297 CAGGATCCCCAGTTCAGAAAAGG + Intronic
1042702892 8:71636330-71636352 CTGGAGCCACTGACCAAAGAAGG - Intergenic
1043717010 8:83499461-83499483 CTGGCTCCACACTCAAAAAAAGG - Intergenic
1046184406 8:110694048-110694070 CTGGATCCAGACCCCAAGAAAGG + Intergenic
1048140300 8:131787724-131787746 CTGGAGCCACTGTGCACAAAAGG + Intergenic
1051691978 9:19724507-19724529 CTCTACCCACACTCCAAAAAAGG - Intronic
1052495555 9:29219229-29219251 CAGGCTCAACAGGCCAAAAACGG + Intergenic
1052663343 9:31464258-31464280 CTGGATCCAGACTCCAAGAGAGG + Intergenic
1052775423 9:32728140-32728162 ATGGATCCAATGTCCAGAAATGG + Intergenic
1054234338 9:62543609-62543631 CAGCCTCCACAGTCCAAAGAGGG - Intergenic
1056136760 9:83637366-83637388 CTGGATCCACTCTCCATAGAAGG - Intronic
1056496094 9:87156850-87156872 CAGTTTCCACATTCCAAAAATGG + Exonic
1059371678 9:113844619-113844641 CTGGATCCACAAGCCATACAAGG - Intergenic
1203488534 Un_GL000224v1:81811-81833 ATGGATACACAGTTTAAAAAGGG - Intergenic
1203501155 Un_KI270741v1:23707-23729 ATGGATACACAGTTTAAAAAGGG - Intergenic
1185939255 X:4296872-4296894 TTGGATCCACAGTGCTAAAATGG - Intergenic
1186232501 X:7471068-7471090 CTTGATCCTGAGTCCCAAAATGG + Intergenic
1189213268 X:39302488-39302510 TTGCATGCACAGTCCACAAAAGG - Intergenic
1189237395 X:39497815-39497837 CTGGATTCATATTGCAAAAAGGG + Intergenic
1190779561 X:53580259-53580281 CTGGATCCACAGCCCAACCAAGG + Intronic
1194976205 X:100398844-100398866 CTGGATCTACAGCTCATAAAGGG + Intronic
1196368141 X:114946107-114946129 CTGGATCCAGACTCCAAGAAAGG - Intergenic
1197152498 X:123235184-123235206 CTGGATCCACAGTACCTCAAAGG + Intronic
1197411820 X:126124859-126124881 AGGGATCCACACTCCAAAACGGG - Intergenic