ID: 934559488

View in Genome Browser
Species Human (GRCh38)
Location 2:95305400-95305422
Sequence ATGCTGTCATTGGGGAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 253}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934559488_934559492 9 Left 934559488 2:95305400-95305422 CCTGGTTTCCCCAATGACAGCAT 0: 1
1: 0
2: 4
3: 30
4: 253
Right 934559492 2:95305432-95305454 CTACAACACAATAGCACAACTGG 0: 1
1: 0
2: 1
3: 31
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934559488 Original CRISPR ATGCTGTCATTGGGGAAACC AGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900776082 1:4586421-4586443 ATGCAGTCATTTGGAACACCGGG + Intergenic
901095245 1:6673588-6673610 GTGCTAACATTGGGGGAACCTGG - Intronic
902285436 1:15405401-15405423 ATGCTGTCCTCAGGGAAAACAGG + Intergenic
902421058 1:16280570-16280592 ATGCTAACATTAGGGAAACTGGG + Intronic
902536694 1:17123096-17123118 ATGGGGTCATGGGGGAAGCCTGG + Intergenic
903222205 1:21875233-21875255 AGCCTGTCATTGGGGACCCCAGG - Intronic
903250336 1:22048789-22048811 ATGCTGTGATTGGCCAAGCCTGG + Intergenic
904814447 1:33184637-33184659 ATGCAGTCATTCAGGAACCCAGG - Intergenic
906305937 1:44719201-44719223 ATTCTGTGATTGGGAAAACCAGG + Intronic
907071261 1:51537246-51537268 AGGCTCTCATTGGCCAAACCTGG - Intergenic
907929273 1:58984185-58984207 ATGTTGACATTTGGGAAATCTGG + Intergenic
908577150 1:65472293-65472315 GGGCTGTCATTTGGGAAAACGGG + Intronic
909504774 1:76376203-76376225 ATGTTATCATTGGAGAAAACTGG - Intronic
911065835 1:93787198-93787220 ATCCAGTCATTGGGGACACAGGG - Intronic
911792686 1:102038585-102038607 ATGCTGTCATATTGGAAACTCGG + Intergenic
912130960 1:106599575-106599597 ATACTCTGATTGGGAAAACCAGG + Intergenic
912377426 1:109222269-109222291 ATGTTATCATTGGGGAAAACGGG - Intronic
918756827 1:188348623-188348645 ATGTTATTATTGGGAAAACCTGG - Intergenic
919778096 1:201206998-201207020 ATGCTGACTATGGGGAAGCCAGG + Exonic
920433965 1:205936399-205936421 ATGGTGTGTGTGGGGAAACCAGG + Intronic
923247918 1:232151223-232151245 TTCCTGTCATTTGGGAAACCTGG - Intergenic
923720797 1:236465062-236465084 ATGCGATCACTGGGGAAAACAGG - Intronic
924074248 1:240316806-240316828 ATGCTATCATTGGGGAAAACTGG - Intronic
924329269 1:242925874-242925896 ATGCTGTCTTTGGGGGCACGAGG - Intergenic
1062954902 10:1533625-1533647 ATGCTGCCCTTGGGAATACCAGG + Intronic
1064553182 10:16522186-16522208 CTGCTGGCAGTGGGGAAATCGGG - Intergenic
1065406996 10:25379460-25379482 AGGCTGTCATTGAGAAAGCCAGG + Intronic
1066722086 10:38350457-38350479 ATGTTGTAAATGGGGAAAACTGG - Intergenic
1067100695 10:43332336-43332358 ATGTTATCATTGGGGGAAACTGG + Intergenic
1068479036 10:57565280-57565302 ATTCTGTCATTTGTGAAACATGG - Intergenic
1070520005 10:77244380-77244402 TGGCTTTCATTGGGGAAATCAGG - Intronic
1070551097 10:77491390-77491412 ATGCTGTCCGAGGGGAAACTGGG - Intronic
1070643372 10:78184823-78184845 ATGCTCTCATTTGTAAAACCGGG + Intergenic
1072696092 10:97603939-97603961 ATGTTGCCATTGGGGAAAACTGG - Intronic
1073980890 10:109152310-109152332 ATGTTACCATTGGGGAAAACTGG - Intergenic
1080010295 11:27452325-27452347 ATGTTGCCATTGGGAAAAGCTGG - Intronic
1080636284 11:34126583-34126605 ATGCTGGCATGGGGGTAAACTGG - Intronic
1081058265 11:38438638-38438660 ATGCTTACATGGGGGAATCCAGG - Intergenic
1081443994 11:43111896-43111918 ATGTTATCATTGGGGGAAACTGG + Intergenic
1082216766 11:49580236-49580258 ATGCACTCATTTGGAAAACCTGG - Intergenic
1082821620 11:57547891-57547913 GTGCTGGCATAGGAGAAACCAGG - Intronic
1084064668 11:66696927-66696949 AAGCTGGAAGTGGGGAAACCAGG - Intronic
1085256817 11:75178921-75178943 ATCCTGTCATTGTGAAAACCTGG - Intronic
1086632785 11:89043839-89043861 ATGCACTCATTTGGAAAACCTGG + Intronic
1087117413 11:94540618-94540640 CTGCTGTCATTGGCCAAACCTGG - Intergenic
1087744481 11:101927415-101927437 ATGTTATCATTGGGGGAAACTGG - Intronic
1087816888 11:102668390-102668412 ATGTAATCATTGGGGAAAACTGG - Intergenic
1088359389 11:108975099-108975121 CTGGTGTCATTGGGGAGACGTGG + Intergenic
1089571283 11:119412213-119412235 ATGTTGCCATTGGGGGAAACTGG - Intergenic
1089875700 11:121719706-121719728 ATGCTGTCATTGGAGAACCAGGG - Intergenic
1089971598 11:122698072-122698094 ATTCTCTCAGTGAGGAAACCAGG + Intronic
1092988388 12:13869858-13869880 ATGCTATCATCGGTGAAACCAGG + Intronic
1094107473 12:26829868-26829890 ATGCTGCTATTGGTGAAACCTGG - Intronic
1094286327 12:28798548-28798570 ATGCTTTCATTAGGAAAACCAGG + Intergenic
1095740801 12:45604481-45604503 TTGCTTTAATTGGGCAAACCTGG + Intergenic
1096189428 12:49605643-49605665 ATGATGTCACTGGGGAAAAGAGG - Intronic
1098090119 12:66892460-66892482 TTGCTCTCATTGGTGAGACCTGG - Intergenic
1098556816 12:71828182-71828204 ATGCTATCACTGGGAAAAACTGG - Intergenic
1101615553 12:106333204-106333226 ATGCTGTCCTTGGGGGCAGCTGG + Intronic
1102175337 12:110869982-110870004 ATGTTTACATTGGGGGAACCGGG - Intronic
1102651107 12:114443209-114443231 ATTCTCTAATTTGGGAAACCTGG + Intergenic
1110116073 13:71818239-71818261 ATGCTATAATTAGGGAAAACAGG + Intronic
1110310029 13:74038176-74038198 ATGCTACCAGTGGGGAAAACTGG + Intronic
1113355473 13:109576044-109576066 ATTCTGGCATTGGGAAACCCTGG - Intergenic
1115076418 14:29397694-29397716 ATGTTATCATTGGAGAAAACTGG - Intergenic
1115801930 14:37004439-37004461 ATGCTGTGTTTGAGGACACCTGG + Intronic
1118195322 14:63620269-63620291 ATCCTGTCATTTGTGAAACAGGG + Intronic
1118489833 14:66248148-66248170 ATGCTGTCAGTGCAGAAAGCAGG + Intergenic
1119170870 14:72535457-72535479 ATGTTGCCATTGGGGCAAACTGG - Intronic
1119801528 14:77449492-77449514 ATGCTGTCTTTGGGGAAGAACGG - Intronic
1120965366 14:90162486-90162508 ATGTTGCCATTGAGGAAAACTGG + Intronic
1121591940 14:95121584-95121606 ATACTGGCATTGGACAAACCTGG - Intronic
1121601929 14:95211755-95211777 ATGCTGTCACTGGAGGAAGCTGG - Intronic
1121859983 14:97308363-97308385 ATGCTGCCATCAGGGAAACAGGG - Intergenic
1123960878 15:25398587-25398609 ATGCTGTCATTTGTGACAGCAGG - Intronic
1124592262 15:31063784-31063806 ATGGCCTCATTGGGAAAACCAGG + Intronic
1124918677 15:34002066-34002088 ATGTTATCATTGGGGTAAACTGG - Intronic
1127487442 15:59432404-59432426 GTGCTGTCCTTGGGGAAGACAGG + Intronic
1127749034 15:62014381-62014403 ATGCTGTCCTTGTAGAAACTTGG - Intronic
1128411928 15:67408122-67408144 ATGCTGTTATTGCGAAAAACTGG - Intronic
1129328015 15:74812328-74812350 ATGCTTTTGTTGAGGAAACCAGG + Intergenic
1129559454 15:76551392-76551414 ATCCTGTCATTATGGCAACCTGG + Intronic
1129737224 15:77973140-77973162 ATGCTGGCTTTGAGGAAAGCAGG - Intergenic
1129848854 15:78780495-78780517 ATGCTGGCTTTGAGGAAAGCAGG + Intronic
1129949137 15:79570752-79570774 ATGCAGCTATTGGGGGAACCTGG - Intergenic
1130253098 15:82313585-82313607 ATGCTGGCTTTGAGGAAACCAGG - Intergenic
1131821105 15:96274525-96274547 ATGCTGTCTTTGGGGAAAGCCGG + Intergenic
1134394258 16:13848562-13848584 ATGCTGTCACTGTGGAACACTGG - Intergenic
1135511917 16:23092780-23092802 AAGCTGGCATTGGAGAAAGCTGG + Intronic
1135908018 16:26531320-26531342 ATGCTGGCTTTGGAGAAATCAGG + Intergenic
1137438248 16:48476021-48476043 ATGGTGTCTTTGGGGGAACATGG + Intergenic
1137545792 16:49402325-49402347 ATGCAGTCATTAAGAAAACCTGG + Intergenic
1139297840 16:65918591-65918613 ATGCTGTCATTCAGGGACCCAGG - Intergenic
1140246505 16:73254586-73254608 ATGCTGCCATTGGAGGAAGCTGG - Intergenic
1143247455 17:5498924-5498946 AGGCTGACATTGGGGAACCGTGG + Intergenic
1144095938 17:11900817-11900839 TTCATGTCATTGGGGAAACCAGG + Intronic
1144489952 17:15700051-15700073 AAGCTGTCCCTGGGGGAACCGGG - Exonic
1144911009 17:18681908-18681930 AAGCTGTCCCTGGGGGAACCGGG + Intronic
1146727537 17:35168444-35168466 CTGCTGTCCTTGAGGAGACCAGG + Intronic
1147814587 17:43199722-43199744 ATGCAGTCATGGGAGAAAACTGG - Intronic
1147822097 17:43247599-43247621 ATGATTACCTTGGGGAAACCAGG + Intergenic
1149186263 17:54001332-54001354 GTGCCCTCATTGGGGAAAACTGG - Intergenic
1150137078 17:62701970-62701992 ATGCTGTCTTTGGGGGAAGCTGG - Intronic
1151119356 17:71774859-71774881 ATGCTGAATTTGGGGAAATCAGG + Intergenic
1156310126 18:35914478-35914500 ATGTTACCATTGGGGAAACTGGG - Intergenic
1157906997 18:51578058-51578080 ATGCAGTCATTCAGGGAACCAGG - Intergenic
1160853967 19:1207662-1207684 ATCCTGTCAGAGGGGAACCCTGG + Intronic
1160888348 19:1363087-1363109 ATGCTGCCAGTGGGGAAGCCCGG - Intronic
1161006405 19:1939301-1939323 AGGATGTCATTGGGGACAGCTGG - Intergenic
1161387481 19:4003770-4003792 ATACTATCACTGGGGAAAGCTGG + Intergenic
1161515591 19:4694504-4694526 ATGCAGTCACTGGGGAAGGCTGG + Intronic
1161930586 19:7336916-7336938 ATGCTGTCATTCAGGAAGACAGG - Intergenic
1163140298 19:15343354-15343376 ATGCTGAGATTGGGGAAAATGGG - Intergenic
1163897885 19:20075529-20075551 TTGTTGTCATTGGGGCATCCAGG + Intergenic
1165637177 19:37350474-37350496 ATATTATCATTGGGGAAAGCAGG - Intronic
1167571787 19:50293104-50293126 ATGCTGTCCCTGGGTAACCCTGG - Intronic
1168212706 19:54902264-54902286 ATGCTAACTTTGGGGAAATCTGG + Intergenic
925085491 2:1104665-1104687 GTGCTGGCATTGTGAAAACCTGG + Intronic
927690644 2:25205661-25205683 ATGTTACCATTGGGGAAAACTGG - Intergenic
927981377 2:27377150-27377172 ATGCTGTGATGGGGGAAGCAGGG - Intronic
928032510 2:27793914-27793936 ATGCTAATATTGGGGAAACTAGG + Intronic
928197970 2:29228669-29228691 ATGCTGTCGCTGAGGAAGCCTGG + Intronic
928508665 2:31981265-31981287 GGGCAGTCATTGAGGAAACCAGG - Intronic
929963870 2:46519099-46519121 AGGCTGTCACTGGGGAAGGCTGG + Exonic
931547511 2:63405995-63406017 AAGATGTCACTGGGGAAACTGGG + Intronic
933884678 2:86707121-86707143 ATGTTATCATTGGGGGAAACTGG - Intronic
934559488 2:95305400-95305422 ATGCTGTCATTGGGGAAACCAGG - Intronic
940009212 2:149037635-149037657 ATGCCTGCAGTGGGGAAACCTGG - Intergenic
941036403 2:160573744-160573766 ATGTTACCATTGGGGAAAACTGG + Intergenic
942209997 2:173660598-173660620 AGGCTGACATTGGGGAAACCTGG + Intergenic
943565513 2:189511130-189511152 ATGCTACCATTTGGGAAACTGGG + Intergenic
943644899 2:190399722-190399744 ATGCTAACACTGGGGAAAGCTGG + Intergenic
949020381 2:241737882-241737904 GTGCTGTCATTGGGAAGATCTGG + Intronic
1171152249 20:22837484-22837506 AAGCTGCCATTGTGGACACCTGG - Intergenic
1171297210 20:24028478-24028500 ATGATGATATTGGGGAAGCCTGG - Intergenic
1173038465 20:39435692-39435714 ATGCTATCATTGAGGAAACTGGG - Intergenic
1173045857 20:39511100-39511122 ATGTTATCATTGGGGGAAACTGG - Intergenic
1173498223 20:43534190-43534212 ATGCTGTGCCTGGGGAAACTGGG - Intronic
1173655095 20:44694675-44694697 ATGTTTTCAATGGGGAAACTAGG - Intergenic
1173663071 20:44747272-44747294 ATTTTGCCTTTGGGGAAACCAGG - Intronic
1173878511 20:46392660-46392682 ATGCTGTGTTTGGGAAAAGCAGG - Intronic
1174976001 20:55335039-55335061 ATGCTATCATTTGGGGAAGCTGG - Intergenic
1175377196 20:58536264-58536286 CTTCTCTGATTGGGGAAACCAGG + Intergenic
1176359789 21:5985085-5985107 GTGCTTGCATTGGGGAATCCGGG + Intergenic
1177438229 21:21083805-21083827 ATGCTGTCATTGGGAGAAACTGG - Intronic
1178031059 21:28526692-28526714 ATGCAGTAATTCAGGAAACCTGG - Intergenic
1178111138 21:29371373-29371395 ATGCTCTCAGTTGGCAAACCCGG + Intronic
1178790597 21:35696253-35696275 ATGATATCATTGGGGGACCCTGG + Intronic
1179055639 21:37930186-37930208 ATGCAGCCATTTTGGAAACCAGG + Intergenic
1179224059 21:39436964-39436986 ATGCAGTTAGTGGGGAAGCCAGG - Intronic
1179763729 21:43553465-43553487 GTGCTTGCATTGGGGAATCCGGG - Intronic
1180714070 22:17859588-17859610 ATGCTGTCTTTGGTGTGACCTGG - Intronic
1180947186 22:19702648-19702670 ATGGCATCATTGGGGAAAACTGG + Intergenic
1181763549 22:25075024-25075046 ATGCTAACATTAGGGGAACCGGG - Intronic
1184624330 22:45711600-45711622 ATGTTACCATTGGGGAAAACTGG + Intronic
949107257 3:215246-215268 ATCCTGTCATTGTGGTAACATGG + Intronic
949159915 3:869044-869066 ATATTGTCATTGGGGGAAGCTGG - Intergenic
949332047 3:2933423-2933445 CTTCTGTCATTGTGGGAACCTGG + Intronic
949469975 3:4384334-4384356 ATGTTGCCATTGGGGAAAACTGG - Intronic
950548790 3:13654375-13654397 GTGTTGTGATGGGGGAAACCGGG + Intergenic
950814166 3:15681074-15681096 TTGCTGTCAGTGGGGAGTCCTGG - Intronic
952831185 3:37566439-37566461 ATGTTATCATTGGGAAAAGCCGG - Intronic
953267006 3:41400117-41400139 ATGCTTCCATTGGGGAAACTGGG - Intronic
953435224 3:42872475-42872497 ATGGTTTCATTGGAGAAAGCTGG + Exonic
953728547 3:45424009-45424031 ATGTTATCATTGGGCAAAGCTGG - Intronic
954637636 3:52079854-52079876 CTGCTGACCTTGGAGAAACCAGG + Intronic
954965651 3:54608250-54608272 ATGTTATCATTGGGGGAAGCTGG + Intronic
955024151 3:55151148-55151170 ATGTTATCACTGGGGAAAACTGG - Intergenic
955536402 3:59928346-59928368 CTGATGACATTGGGGCAACCTGG - Intronic
955722322 3:61895945-61895967 ATGCTACCTTTGGGGAAACTAGG - Intronic
956088247 3:65636563-65636585 AGCCTGTCAGAGGGGAAACCAGG - Intronic
958858487 3:99416588-99416610 ATGTTAACATTGGGGAAAACTGG + Intergenic
959575701 3:107930970-107930992 ATGCTGTGAGTGGGTAAAACAGG + Intergenic
959807719 3:110577350-110577372 CTGCTTTCATAGGGGAAGCCAGG + Intergenic
960444436 3:117730394-117730416 ATACTATCATTGGGGAAAGTTGG - Intergenic
960677111 3:120205855-120205877 ACGATGTTATTGGGGAAAGCTGG - Intronic
961954907 3:130791428-130791450 ATGCACTCATTGGGCAAGCCAGG + Intergenic
962121881 3:132569941-132569963 ATGTTACCATTGGGGAAACTGGG + Intronic
965016384 3:163163365-163163387 ATGCAGTCATTAGAGAAACATGG - Intergenic
970151008 4:13090023-13090045 CTGCTGTCATGAGAGAAACCAGG - Intergenic
970472263 4:16390702-16390724 ATGGTGTCATTTAGGTAACCTGG - Intergenic
970513045 4:16799920-16799942 ATGTTTTTATTTGGGAAACCTGG + Intronic
970536452 4:17035024-17035046 ATGCTGTTATTGGGGGAAGCTGG - Intergenic
971439058 4:26660285-26660307 ATACTGTCTTTGGTGAAACTAGG + Intronic
972615126 4:40690838-40690860 ATGCAGCCTTTGGGGAGACCTGG + Intergenic
974297031 4:60013439-60013461 ATGCTGTTAATTAGGAAACCAGG + Intergenic
975240151 4:72047574-72047596 GTTCTGTGATTTGGGAAACCTGG - Intronic
976459036 4:85286281-85286303 ATGCTTTCATGGGGGAAACATGG - Intergenic
976616305 4:87081070-87081092 ATGCTAACATTTGGGAAATCTGG + Intronic
978207431 4:106094611-106094633 ATTCTGTCATCAGGGAAATCAGG - Intronic
978453480 4:108862535-108862557 CTGCTGTAATAGGGGAAACAAGG - Exonic
979497083 4:121395635-121395657 ATCCTCTCACTGGGGAAACTTGG + Intergenic
981039367 4:140209341-140209363 ATTCTGACATGGGGGAGACCAGG - Intergenic
982554870 4:156847671-156847693 ATGCTAACATTGGAGGAACCTGG + Intronic
982699372 4:158642593-158642615 ATTCTGTCATTGTGGCAACTAGG - Intronic
983584961 4:169344603-169344625 ATGTTACCATTGGGGAAAACTGG - Intergenic
984460215 4:180025942-180025964 ATGTTACCAATGGGGAAACCAGG + Intergenic
985496989 5:214289-214311 ATGCTTCCACTGGGGAAAGCTGG + Intronic
988661296 5:33272146-33272168 ATGCTATCATTGGGGGAAGTTGG + Intergenic
988690479 5:33566966-33566988 GTGCAGTCATTTGGGAACCCAGG - Intronic
988692323 5:33585180-33585202 AAGCTCTCATTGGGGGTACCAGG + Intronic
990508880 5:56471918-56471940 ATGCAGTCATTTAGGAATCCAGG + Intronic
990909338 5:60838103-60838125 ATAATGTCAGTGGGGAATCCTGG - Intronic
991452599 5:66768770-66768792 ATGTTACCATTGGGGAAACTGGG + Intronic
992989152 5:82266091-82266113 ATACTATCATTTGGGAAAGCTGG - Intronic
992996686 5:82340749-82340771 TTCCTGTCATTGAGGAAAACAGG + Intronic
995738132 5:115325159-115325181 ATGCTCTAATTGTGGAATCCCGG - Intergenic
996869493 5:128172279-128172301 ATGTTATCATTGGGGGAAACTGG - Intronic
998835442 5:146198554-146198576 ATGCTGCCATTGGAGGAAACTGG - Intergenic
999099283 5:149009229-149009251 TTCCTATAATTGGGGAAACCTGG + Intronic
1003907000 6:10710736-10710758 ATGTTATCATTGGGAAAACCGGG - Intergenic
1004086630 6:12455992-12456014 ATGGTGTCAATGGACAAACCAGG + Intergenic
1004971557 6:20916287-20916309 ATGATATCATTCGGGGAACCTGG + Intronic
1008044357 6:46836512-46836534 ATGCTAACATTAGGGAAAGCTGG - Intronic
1008097243 6:47351479-47351501 ATGTGGTCAGTGGGGAACCCAGG - Intergenic
1008327387 6:50199748-50199770 ATTCTGTCATTGTGAAAACATGG + Intergenic
1008709870 6:54211799-54211821 ATGCTGGCATTGAGAAACCCTGG + Intronic
1008988643 6:57577045-57577067 ATGCAGTTTTTGGGGAAACATGG - Intronic
1009168788 6:60373315-60373337 ATGTTTTCATTGGGGAGAACTGG - Intergenic
1009177245 6:60475604-60475626 ATGCAGTTTTTGGGGAAACATGG - Intergenic
1011275869 6:85630917-85630939 ATACTGTCATGGGGGCAACTGGG + Intronic
1013305056 6:108840018-108840040 ATGTTGCCATTGGAGAAACTGGG - Intergenic
1013983221 6:116158713-116158735 ATGCTGTCAGTGGTGATCCCAGG + Intronic
1015324679 6:131911122-131911144 ATGTAATCACTGGGGAAACCAGG - Intergenic
1016272580 6:142305604-142305626 ATGCTACCATTGGGGGAACTGGG - Intronic
1019877721 7:3829577-3829599 CTGCTTTCATTGGAGAAACGAGG - Intronic
1021987131 7:26107769-26107791 AAGCTGCCATGGGGGAAGCCAGG + Intergenic
1022039846 7:26570370-26570392 ATGCTATCATTTGGGGAAACAGG + Intergenic
1022484012 7:30764001-30764023 ATGCAGTCATTCAGGGAACCAGG + Intronic
1022654062 7:32302885-32302907 ATGCTCTTATTGGGGCAACTTGG - Intergenic
1023658694 7:42451738-42451760 CTGTTGTCATTGGGGAACCCTGG - Intergenic
1024685881 7:51744670-51744692 TGGCTTTCAGTGGGGAAACCCGG - Intergenic
1027706638 7:81542444-81542466 ATTCTGGCATTAGGTAAACCTGG - Intergenic
1028121114 7:87058071-87058093 ATGTTGTAATTGGGGAAATCAGG - Intronic
1028552748 7:92088888-92088910 ATGGTATCATTGGGAAAAGCTGG + Intronic
1028669959 7:93390487-93390509 ATGTTGCCATTGGGGAAAACTGG + Intergenic
1031510172 7:122639408-122639430 GTGCTATCATTAGGGAAAACTGG - Intronic
1031981782 7:128131977-128131999 AGGCTTTCAGTGGTGAAACCTGG + Intergenic
1032384110 7:131509583-131509605 ACGCTGTCATTGGGAAAACGAGG + Exonic
1034463440 7:151211240-151211262 ATGCTGTGATTAAAGAAACCTGG + Intronic
1037594099 8:20340158-20340180 ATAATGTCATTGGGGGAACTGGG + Intergenic
1037941576 8:22955509-22955531 CTGCTTCCATTGTGGAAACCAGG + Intronic
1039001674 8:32988114-32988136 ATGCTGTGATTTGGGGATCCAGG + Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041557881 8:59179281-59179303 ATGCTACCATTGGAGAAAACTGG - Intergenic
1043475375 8:80600580-80600602 ATTTTGTCCTTGAGGAAACCAGG + Intergenic
1044055351 8:87562942-87562964 ATGCTATCATTGAGGAAAACGGG - Intronic
1044080727 8:87879718-87879740 ATGCTTTCTTTGGTGAAACAGGG + Intergenic
1045265600 8:100616324-100616346 ATGATGTCTTTGGGGAAGGCAGG + Intronic
1045906366 8:107350169-107350191 TTGCTGTCATTTAGGAAACATGG - Intronic
1051334247 9:16052302-16052324 GGGCTGTCATTGTGGAAAGCTGG + Intronic
1053005089 9:34599040-34599062 ATGCAGTGGTTGGGGAACCCTGG + Intergenic
1053434459 9:38066373-38066395 GTGCAGGCACTGGGGAAACCTGG - Intronic
1055310586 9:74975502-74975524 ATGCTATCTTTGGGGGAAGCTGG + Intergenic
1055468903 9:76592212-76592234 ATGCCGTCATTGTGCAAACAGGG + Intergenic
1056109227 9:83378069-83378091 ATGCTGTAAGTGAGGAAACCAGG - Intronic
1056175261 9:84028616-84028638 ATGCTATCATTTTGGAAAACTGG - Intergenic
1056875771 9:90328989-90329011 ATGTTACCATTGGCGAAACCTGG - Intergenic
1057425979 9:94950148-94950170 ATGCTGTCATGGGGGAAAGCTGG - Intronic
1058571339 9:106348621-106348643 ATGTTGACATTGGGGAAAACTGG + Intergenic
1060020754 9:120128784-120128806 ATGGTACCATTGGGGGAACCTGG + Intergenic
1060037478 9:120268533-120268555 ATGCTGCCATTGGGGGAAACTGG + Intergenic
1060186808 9:121568601-121568623 ATGCGGTCCTTGGGGAGGCCAGG + Intronic
1060821449 9:126663881-126663903 AGGCTGTCTTTGGGGAATCCCGG + Intronic
1062084778 9:134642819-134642841 ACGCTGTCCCTGGGGAAAGCAGG - Intronic
1062295454 9:135822921-135822943 CAGCTGTCCTTGGGGAGACCGGG + Exonic
1203454438 Un_GL000219v1:151863-151885 GTGATGACATTGGGCAAACCTGG + Intergenic
1186039512 X:5460704-5460726 ATGCTGACTTTGGGGAAAAGGGG - Intergenic
1186262145 X:7791082-7791104 ACTATGTCATGGGGGAAACCAGG + Intergenic
1186683572 X:11900803-11900825 ATGCTGTGATTGGAGAAAGGGGG + Intergenic
1187118415 X:16378686-16378708 ATGTTAACATTGGGGAAACGGGG + Intergenic
1188570216 X:31576097-31576119 ATGCTATCATTGGGAGAAGCTGG - Intronic
1189510793 X:41659188-41659210 AAGTTGTCAGTGGTGAAACCAGG - Intronic
1189826259 X:44921275-44921297 ATGCTAACATTGGGGAAAGTTGG - Intronic
1189994138 X:46623077-46623099 ATGGTGGCTTTGGGGAAATCAGG + Intronic
1191776898 X:64824179-64824201 ATGCTGTCATTGGAGACTACAGG + Intergenic
1191963262 X:66726905-66726927 ATCCTGTGAATGGAGAAACCCGG - Intergenic
1192184787 X:68939685-68939707 ATTTTCTCATTGGGGACACCAGG + Intergenic
1195066316 X:101241369-101241391 ATGTTGTCATTTGGGGAAACTGG + Intronic
1195911446 X:109892014-109892036 ATGTTACCATTGGGGAAAACTGG - Intergenic
1196811627 X:119633639-119633661 ATGCTGTCATGGGCCAAGCCAGG - Intronic
1196928544 X:120658432-120658454 ATGGTGTCATTAGGAGAACCTGG + Intergenic
1196936069 X:120732282-120732304 ACACTGTCATTGGGGGAAACCGG + Intergenic
1198058580 X:133020721-133020743 ATGCTGGCTTTGGGGAAAAAGGG + Intergenic
1198589986 X:138168025-138168047 ATGATAGCATTGGGGAAAACTGG - Intergenic
1198789177 X:140324171-140324193 ATGCTATCATTGGAAAAAACTGG + Intergenic
1198804482 X:140480751-140480773 ATGCTGTGATTGGAGAAAGGGGG - Intergenic