ID: 934559776

View in Genome Browser
Species Human (GRCh38)
Location 2:95307082-95307104
Sequence ACCCCCTGCCTCACAAAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 201}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934559768_934559776 1 Left 934559768 2:95307058-95307080 CCCTCCCTTCTCTTCTCAGAACC 0: 1
1: 2
2: 7
3: 72
4: 639
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559769_934559776 0 Left 934559769 2:95307059-95307081 CCTCCCTTCTCTTCTCAGAACCC 0: 1
1: 0
2: 4
3: 43
4: 482
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559765_934559776 6 Left 934559765 2:95307053-95307075 CCCTCCCCTCCCTTCTCTTCTCA 0: 3
1: 8
2: 95
3: 1049
4: 6624
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559758_934559776 26 Left 934559758 2:95307033-95307055 CCCTGCCCTCCTGTCCCTGGCCC 0: 2
1: 0
2: 15
3: 142
4: 1213
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559764_934559776 11 Left 934559764 2:95307048-95307070 CCTGGCCCTCCCCTCCCTTCTCT 0: 1
1: 1
2: 38
3: 539
4: 3620
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559770_934559776 -3 Left 934559770 2:95307062-95307084 CCCTTCTCTTCTCAGAACCCACC 0: 1
1: 1
2: 6
3: 58
4: 514
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559759_934559776 25 Left 934559759 2:95307034-95307056 CCTGCCCTCCTGTCCCTGGCCCT 0: 1
1: 1
2: 26
3: 152
4: 1213
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559761_934559776 20 Left 934559761 2:95307039-95307061 CCTCCTGTCCCTGGCCCTCCCCT 0: 1
1: 2
2: 9
3: 198
4: 1976
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559763_934559776 12 Left 934559763 2:95307047-95307069 CCCTGGCCCTCCCCTCCCTTCTC 0: 1
1: 1
2: 24
3: 376
4: 3122
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559766_934559776 5 Left 934559766 2:95307054-95307076 CCTCCCCTCCCTTCTCTTCTCAG 0: 1
1: 0
2: 24
3: 224
4: 1909
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559767_934559776 2 Left 934559767 2:95307057-95307079 CCCCTCCCTTCTCTTCTCAGAAC 0: 1
1: 0
2: 9
3: 95
4: 802
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559762_934559776 17 Left 934559762 2:95307042-95307064 CCTGTCCCTGGCCCTCCCCTCCC 0: 1
1: 1
2: 28
3: 706
4: 5364
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559771_934559776 -4 Left 934559771 2:95307063-95307085 CCTTCTCTTCTCAGAACCCACCC 0: 1
1: 0
2: 7
3: 48
4: 521
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559760_934559776 21 Left 934559760 2:95307038-95307060 CCCTCCTGTCCCTGGCCCTCCCC 0: 1
1: 3
2: 13
3: 238
4: 2241
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934559776 Original CRISPR ACCCCCTGCCTCACAAAGAG GGG Intronic
901717626 1:11169290-11169312 ACCCCATGCATCCCTAAGAGTGG + Intronic
907110239 1:51920470-51920492 ACCCTGTGCCTGACACAGAGGGG + Intronic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
909726352 1:78840753-78840775 TCCTTCTGCCTCACAAAGTGGGG + Intergenic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
913691307 1:121282346-121282368 ACCCTCTGCCAAAAAAAGAGAGG - Intronic
914146236 1:144997635-144997657 ACCCTCTGCCAAAAAAAGAGAGG + Intronic
914658942 1:149769769-149769791 ACACCCTTCCTCACAGAGAAAGG + Intergenic
915413510 1:155721601-155721623 AGCACCTGCATCACAAAGCGAGG - Exonic
916639900 1:166716598-166716620 AGACCCTGCCTCAAAAAGAAAGG + Intergenic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
919851507 1:201676131-201676153 ACACCCTATCTCAGAAAGAGGGG - Intronic
920478631 1:206300822-206300844 ACCCTCTGCCAAAAAAAGAGAGG - Intronic
920615057 1:207483709-207483731 ACCCCCTGACTCACTAAAAGAGG + Intronic
920924872 1:210331342-210331364 AGACCCTGCTTCACAAAGATAGG + Intronic
921054570 1:211534381-211534403 AACCCCCTCCTCACAAAGAGAGG + Intergenic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
922752111 1:228075111-228075133 ACCCCCAGCCTCACACAATGGGG + Exonic
1063245760 10:4216641-4216663 ACCCCCTCCCTGCCAAAGAAAGG + Intergenic
1065924289 10:30422032-30422054 TCCTCCTGCCTCCCAAAGTGTGG - Intergenic
1066070980 10:31811901-31811923 TCCTCCTGCCTCCCAAAGTGGGG + Intronic
1066271648 10:33829876-33829898 ACCCCTTGCCTCTCACAGAACGG - Intergenic
1067055063 10:43045372-43045394 ACCCCGTGCCTGACAAAATGTGG + Intergenic
1068163331 10:53296745-53296767 AGACCCTGCTTCACAAAGATAGG + Intergenic
1068981642 10:63069168-63069190 TGCCTCTGCCTCCCAAAGAGTGG + Intergenic
1069998099 10:72355335-72355357 AAACCATGCCTCACAAACAGTGG - Intergenic
1072759039 10:98040753-98040775 AGACCCTGTCTCAAAAAGAGAGG + Intergenic
1074151530 10:110763720-110763742 AGCCACTTCCTCACAGAGAGGGG + Intronic
1076405026 10:130205921-130205943 ACCCCAGGCCTCACAGAGAGCGG - Intergenic
1077087248 11:759925-759947 ACACCCAGTCTCACAAACAGAGG - Intronic
1077384684 11:2263302-2263324 ACCCTCAGCCTCCCAAAGGGTGG - Intergenic
1078670348 11:13359113-13359135 ACTGCCTCCCTCACAAAGAGTGG - Intronic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1080094920 11:28394465-28394487 ACACTCTGGCTCACAAGGAGGGG + Intergenic
1084794247 11:71494166-71494188 ACTCCCTGACTCACCCAGAGCGG + Intronic
1085082331 11:73645577-73645599 CTCCCCTACCTCCCAAAGAGCGG - Intergenic
1085880798 11:80464206-80464228 ACCCCCTGCTGCACAACAAGTGG + Intergenic
1085987362 11:81802732-81802754 ACCTCCTTCCCCACAATGAGGGG + Intergenic
1086770952 11:90766402-90766424 ACCTCCTGCCACACAAAGTGTGG + Intergenic
1088753482 11:112865701-112865723 TCCCCTTGCCTCAAAAAGAGGGG - Intergenic
1090439193 11:126712350-126712372 AGACCCTGCCTCACTCAGAGAGG - Intronic
1090846107 11:130531285-130531307 CCGCCCTGCCTCACCCAGAGAGG + Intergenic
1091783339 12:3227716-3227738 GTCCCCTGCCTCACATGGAGAGG - Intronic
1092671290 12:10864099-10864121 TCCTCCTGCCTCACAAACACTGG - Intronic
1093710761 12:22327565-22327587 ACACCCTGCCTCACTGAGAAAGG + Intronic
1094653897 12:32402386-32402408 AGACCCTGTCTCAAAAAGAGAGG + Intronic
1095800037 12:46262073-46262095 TCTCCATGCCCCACAAAGAGGGG - Intronic
1095907911 12:47396619-47396641 GCCCCCTGAATCACAAAGGGTGG + Intergenic
1097997922 12:65910141-65910163 ACCACCTGGAACACAAAGAGGGG - Intronic
1101486194 12:105163509-105163531 AGACCCTGCCTCAAAAAGAAAGG - Intronic
1102254556 12:111407987-111408009 ACCTGCTGCCTGGCAAAGAGAGG + Intronic
1102492539 12:113297790-113297812 ACCCCCTCCCTTTCACAGAGAGG + Exonic
1102670710 12:114616509-114616531 ACCCTCAGCCTCCCAAAGTGCGG - Intergenic
1102731394 12:115114003-115114025 AGCTCCTGCCTGACAAACAGTGG - Intergenic
1102901070 12:116637503-116637525 CCACCTTGCCTCACAAAGTGCGG + Intergenic
1103646712 12:122399464-122399486 ACCTCCTGGCACACATAGAGCGG + Intronic
1104950393 12:132437365-132437387 ACCCCCGACCTCACACAGAGCGG + Intergenic
1106244758 13:27939731-27939753 ACTTCCAGCATCACAAAGAGTGG - Intergenic
1106804700 13:33294101-33294123 ACCTCTTGCTCCACAAAGAGGGG + Intronic
1106838094 13:33657713-33657735 ACTCACTGACTTACAAAGAGAGG - Intergenic
1113297484 13:108975710-108975732 ACCACCTGCCTCAAAAAGGAGGG - Intronic
1113345368 13:109472539-109472561 ACCCCCTGCCTGGAAAAGCGAGG + Intergenic
1114454921 14:22848130-22848152 TCCCCCTGCCTCAGGCAGAGAGG - Intronic
1116403850 14:44543694-44543716 CCCCCCTGCCACACAAAAAAGGG - Intergenic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1118788189 14:69064407-69064429 TCCTACTGCCTCAAAAAGAGGGG + Intronic
1118917004 14:70116086-70116108 CCCCCCTCCCCCACAAAGGGAGG + Intronic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1121846518 14:97177035-97177057 TCCTCCTGCCTCTCAGAGAGAGG - Intergenic
1122452087 14:101817614-101817636 ACACCCTGCCTCTTAAAGTGCGG - Intronic
1122589658 14:102838698-102838720 ATCCCCTCCCTCACCAGGAGTGG - Intronic
1125754236 15:42051555-42051577 AACCACAGCCTCAGAAAGAGAGG - Intergenic
1126457249 15:48877140-48877162 AAATCCTGCCTCACAAAGATAGG - Intronic
1128309546 15:66621853-66621875 CTCCACTGCCCCACAAAGAGGGG - Intronic
1129127488 15:73455931-73455953 AACCCCTGCCTCTCAAAGTGTGG - Intronic
1129743828 15:78004180-78004202 GCCCCGTGCCTGACACAGAGTGG - Intronic
1130011554 15:80156483-80156505 ACTCCCAGCCTGACATAGAGGGG - Intronic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1133280246 16:4660989-4661011 AGCCCCTGTCTCAAAAAAAGGGG - Intronic
1137610221 16:49813000-49813022 ACCCCCTGCCACACCACCAGGGG + Intronic
1137805350 16:51299565-51299587 ACCCCCCGACTCACAAAAAAAGG + Intergenic
1138779067 16:59760711-59760733 ACCTCCTGCCTAAAAATGAGGGG + Intergenic
1140961578 16:79917973-79917995 AGCCCCAGCCTCACAAAGCCTGG - Intergenic
1141108628 16:81253947-81253969 AGACCCTGTCTCACAAAGAAAGG + Intronic
1141521018 16:84579600-84579622 ACCCCCCACCTCACACAGAGGGG - Intronic
1143270103 17:5669036-5669058 CCTGCCTGCCTCAGAAAGAGAGG + Intergenic
1143409250 17:6698546-6698568 ACCCTCAGCCTCCCCAAGAGGGG + Intronic
1145253027 17:21306773-21306795 ACGCCCAGCCTCACATGGAGAGG + Intronic
1146478204 17:33180309-33180331 ATCCCAGGCCTCACAATGAGGGG + Intronic
1147705809 17:42423911-42423933 ACACCCTGTCTCAGAAAGGGGGG - Intergenic
1148861312 17:50605705-50605727 ACCCCCTTCCTTTCCAAGAGTGG - Intronic
1150256960 17:63754628-63754650 TCCACCTGCCTCCCAAAGTGCGG - Intronic
1156047046 18:32888677-32888699 GGCCCCTGCCTTTCAAAGAGGGG + Intergenic
1156081936 18:33346073-33346095 ATCCCCAGCCTCCCAAAGCGTGG + Intronic
1157416542 18:47508184-47508206 ACCCCCTACCTCACTAAGTTTGG + Intergenic
1157965330 18:52202514-52202536 ACACCCTGCCTCACAACAATTGG + Intergenic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1161644788 19:5446433-5446455 ACCCCCTGACTTACAGAGATGGG + Intergenic
1163234142 19:16021240-16021262 ACCCCCAGCCTCTCAGAGGGTGG + Intergenic
1164496345 19:28767099-28767121 ACCCCCTGCCTATCAAAGAGAGG - Intergenic
1165680556 19:37770874-37770896 TCCCCCTCCCTTCCAAAGAGTGG + Intronic
1165736213 19:38177497-38177519 ACCCCATTCCCCACAAAAAGGGG + Intronic
1165956738 19:39505817-39505839 ACCCCCTGGGTCACAAGAAGGGG + Intronic
1167658086 19:50779431-50779453 ACCCCCTCCCTCATAAAGGTTGG - Intergenic
926182584 2:10658827-10658849 ACCCTTGGCCTCACAAAGTGTGG - Intronic
926938141 2:18106694-18106716 TCACCCTGCCTCACACAAAGTGG - Intronic
928035061 2:27815215-27815237 AGACCCTGTCTCAAAAAGAGGGG - Intronic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
933101069 2:78258262-78258284 TGCCCCTGCCTCCCAAAGTGTGG + Intergenic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
934490898 2:94761524-94761546 ACCACCTGCCTCTCAGAGGGTGG - Intergenic
934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG + Intronic
935121645 2:100188231-100188253 ACCCCCTCCCTCCCAAAAAAAGG - Intergenic
935274234 2:101462418-101462440 ACACTCTGCCTCAAAAAAAGGGG + Intronic
938069577 2:128301242-128301264 CAGCCCTGCCTCACACAGAGGGG - Intronic
938118874 2:128620112-128620134 GGCCCCTGCCCCACAAGGAGGGG - Intergenic
938278817 2:130050669-130050691 ACCACCTGCCTCTCAGAGGGTGG - Intergenic
938712533 2:133988049-133988071 AATCCCTGCCTCATAAAGAATGG - Intergenic
940519865 2:154731212-154731234 ACACCCTGTCTCACATAGAAGGG - Intronic
942017985 2:171836399-171836421 ATCCACTTCCTCACATAGAGTGG - Intronic
943745680 2:191460646-191460668 AGACCCTGCCTGACAAAGAGGGG - Intergenic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
946911968 2:224471686-224471708 ACGCACAGCCTCACAAAAAGTGG - Exonic
947616068 2:231557592-231557614 AGCCCCTCCCTCACAGTGAGTGG - Intergenic
948116314 2:235496002-235496024 ACCCTCTCCCTCACAGAGGGAGG - Intronic
948537317 2:238655813-238655835 ACCCTCAGCCTCACAGAGAATGG + Intergenic
1169492781 20:6085329-6085351 GCCCCCTGCTGCACACAGAGGGG + Intronic
1170213298 20:13866989-13867011 ACCCCCACCTTCACAAATAGTGG - Intronic
1172006168 20:31820238-31820260 AGCCCCTGCCTCAGAGAAAGGGG + Exonic
1172183829 20:33019432-33019454 ACCCACTGGCTTACACAGAGGGG + Intronic
1173422485 20:42914911-42914933 AGCCCCTGCCTCACACAGATTGG - Intronic
1173716615 20:45212588-45212610 ACCTCCTGCCTCTTAATGAGGGG + Intergenic
1174622505 20:51886784-51886806 ACCCACTACCACACAAAGAAGGG - Intergenic
1174953867 20:55074530-55074552 ACCCCCTGTTTCACAGAAAGAGG - Intergenic
1175916708 20:62429354-62429376 GAGCCCTGCCTCACAAGGAGGGG + Intergenic
1176190555 20:63807762-63807784 ACCCGCTGCCTCACACAGACGGG - Intronic
1176270325 20:64232891-64232913 GCCCACTGCCTGACAGAGAGGGG - Intronic
1178442216 21:32607786-32607808 ACCCCCTGACTCAGACAGAGGGG - Intronic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1179462472 21:41547026-41547048 ACCCCCTGCCTCACAAAGCTGGG - Intergenic
1185204470 22:49529534-49529556 ACTCCCTTCCTAACAAAGAAAGG - Intronic
1185310920 22:50153832-50153854 ACCCCCTGCCCCAGAAGAAGGGG + Intronic
949516174 3:4808859-4808881 CCCCCCTCCCCCACAAAGACTGG + Intronic
950958626 3:17081113-17081135 ACCACCTGCTCCACAAAGAGGGG - Intronic
951168211 3:19507391-19507413 AAGCCCTGCCTCATGAAGAGTGG + Intronic
952284289 3:31953359-31953381 ACCCCCACACACACAAAGAGTGG + Intronic
953333435 3:42073499-42073521 AACCCCTGCCTCACAAAATGGGG + Intronic
954776954 3:53028098-53028120 AGACCCTGTCTCAAAAAGAGTGG - Intronic
956426140 3:69137660-69137682 AGACCCTGCCTCAAAAAAAGGGG - Intergenic
960973841 3:123157178-123157200 GCCACCTGCCTCAGACAGAGAGG - Intronic
961580837 3:127880760-127880782 AAACCCTGCTTCACAAACAGAGG + Intergenic
962501355 3:135996958-135996980 TCCCCCTGCCTCACTAGGAAAGG + Intronic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
967268563 3:187713918-187713940 TTCTCCTGCCTCACAAAGATAGG + Intronic
968739259 4:2319128-2319150 ACCCCCTGCCCCACATATGGGGG - Intronic
969125352 4:4943888-4943910 ACCCCCTGCCTTTCAGAGTGGGG + Intergenic
972423324 4:38910480-38910502 ACTTCCAGCCTCACAGAGAGGGG + Intronic
975997784 4:80336196-80336218 ACCTCCTTCCTCACAGAGAGCGG - Intronic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
977555928 4:98487397-98487419 ACCCCCTGACCCCCAGAGAGGGG + Intronic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
978856744 4:113402268-113402290 CCCTTCTGCCTCCCAAAGAGTGG - Intergenic
980243295 4:130203691-130203713 AGCCACAGCCTCTCAAAGAGTGG + Intergenic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
984658877 4:182351464-182351486 ACCCCCTGAATCACCTAGAGTGG + Intronic
987112621 5:14701542-14701564 ACCCCCTGCCCCAGAAGGAGTGG + Intergenic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
993413682 5:87600930-87600952 ACCCCCTGCCCCCCAACGAGTGG - Intergenic
994563168 5:101403625-101403647 TCCCCTTTCCTCAAAAAGAGGGG + Intergenic
995410570 5:111852651-111852673 ACCCCCTCCCCCACAAAAAATGG - Intronic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
998394502 5:141809971-141809993 ACCCCCAGCCTGAGCAAGAGTGG - Intergenic
999174228 5:149620487-149620509 ACCACCTGCCTAACAAAGAAAGG - Intronic
1000056361 5:157610347-157610369 CCCCCCTTCCCCACAAATAGTGG + Intergenic
1001050408 5:168409462-168409484 ACCCCTGCACTCACAAAGAGGGG - Intronic
1001572256 5:172737730-172737752 CCCCACTACCACACAAAGAGAGG + Intergenic
1002309604 5:178306568-178306590 ACCTTCTGCCTCAGAGAGAGGGG + Intronic
1007130377 6:39466799-39466821 AACTTCTGCCTTACAAAGAGGGG - Intronic
1007339525 6:41181730-41181752 ACACCCTGCCTGGCAAAGACAGG + Intergenic
1007589290 6:43011837-43011859 ACCCCATGCCTGACCAAGGGAGG + Exonic
1009267869 6:61579026-61579048 AGCCCCTGCAGCAGAAAGAGAGG + Intergenic
1012524537 6:100161295-100161317 ACCCTCGGCATCACATAGAGAGG - Intergenic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1014882839 6:126744653-126744675 ACCCCCTGCCTCATGTAGATAGG - Intergenic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1018304833 6:162444028-162444050 ACCCCCTCCCTGCCAAAAAGAGG - Intronic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1018872847 6:167796411-167796433 ACCTCCTGCAGCACAAGGAGAGG + Intronic
1019177179 6:170165897-170165919 ATCCCCAGCTTCGCAAAGAGGGG - Intergenic
1019917077 7:4140412-4140434 ACCCCCGGCCCCACGATGAGGGG + Intronic
1022987513 7:35672315-35672337 ACCCACTCCCTCAAAAATAGTGG - Intronic
1026306551 7:69147455-69147477 AGACCCTGTCTCAAAAAGAGTGG + Intergenic
1029133311 7:98350094-98350116 AGACCCTGCCTCAAAAAGGGGGG + Intronic
1029798258 7:102918526-102918548 ACACCCTGGGTCACACAGAGTGG + Intronic
1034088228 7:148339580-148339602 GCCACCTGCATCACAAAGCGAGG + Intronic
1034870502 7:154679202-154679224 TCCCCCTCCCTCCCTAAGAGTGG - Intronic
1036686371 8:10914220-10914242 ACCCCCTGCCTTGCTAAGACCGG - Intronic
1039286756 8:36050058-36050080 ACACCCAGCCTCACAACAAGGGG - Intergenic
1042172330 8:66004260-66004282 AAGCCCTGCTTCACAAAGACAGG - Intergenic
1042302712 8:67302972-67302994 ACCCCCTGCCCCACATAGCTAGG - Intronic
1043306249 8:78800305-78800327 AAACCCTGTCTCAAAAAGAGAGG - Intronic
1045508533 8:102795423-102795445 CCCTCCTCCCTCACAAAAAGGGG + Intergenic
1048793418 8:138125834-138125856 ACACGCTGCCTGACACAGAGTGG - Intergenic
1049370741 8:142264403-142264425 ACCCTCTGCTACACAAATAGAGG - Intronic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1053667097 9:40324164-40324186 ACCACCTGCCTCTCAGAGGGTGG + Intronic
1053865316 9:42431861-42431883 ACCCCCTGCCCCACAGTCAGAGG + Intergenic
1053916687 9:42949275-42949297 ACCACCTGCCTCTCAGAGGGTGG + Intergenic
1054378243 9:64464192-64464214 ACCACCTGCCTCTCAGAGGGTGG + Intergenic
1054517513 9:66052119-66052141 ACCACCTGCCTCTCAGAGGGTGG - Intergenic
1055091765 9:72370476-72370498 TCCTCCTGCCTCCCAAAGTGCGG - Intergenic
1057214859 9:93222176-93222198 AGACCCTGCCTCAAAAAAAGGGG - Intronic
1059027455 9:110650336-110650358 CCACCCCGCCCCACAAAGAGAGG - Intergenic
1060732929 9:126049480-126049502 GACCCCTGCCTCACAGACAGGGG - Intergenic
1062678057 9:137759917-137759939 ACCCCCTGACCCACAACCAGCGG - Intronic
1189302681 X:39963815-39963837 ATACCCTGCCCCACAAAGGGAGG - Intergenic
1196666291 X:118320371-118320393 TCCCCCTCCCTCACCAACAGAGG - Intergenic
1196888750 X:120272219-120272241 ACCCCCTGCCTCAACAAGCCAGG - Intronic
1197748792 X:129951089-129951111 TCCCCCTGCCCCACAAGGATAGG - Intergenic