ID: 934559776

View in Genome Browser
Species Human (GRCh38)
Location 2:95307082-95307104
Sequence ACCCCCTGCCTCACAAAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 201}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934559761_934559776 20 Left 934559761 2:95307039-95307061 CCTCCTGTCCCTGGCCCTCCCCT 0: 1
1: 2
2: 9
3: 198
4: 1976
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559758_934559776 26 Left 934559758 2:95307033-95307055 CCCTGCCCTCCTGTCCCTGGCCC 0: 2
1: 0
2: 15
3: 142
4: 1213
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559763_934559776 12 Left 934559763 2:95307047-95307069 CCCTGGCCCTCCCCTCCCTTCTC 0: 1
1: 1
2: 24
3: 376
4: 3122
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559770_934559776 -3 Left 934559770 2:95307062-95307084 CCCTTCTCTTCTCAGAACCCACC 0: 1
1: 1
2: 6
3: 58
4: 514
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559769_934559776 0 Left 934559769 2:95307059-95307081 CCTCCCTTCTCTTCTCAGAACCC 0: 1
1: 0
2: 4
3: 43
4: 482
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559768_934559776 1 Left 934559768 2:95307058-95307080 CCCTCCCTTCTCTTCTCAGAACC 0: 1
1: 2
2: 7
3: 72
4: 639
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559760_934559776 21 Left 934559760 2:95307038-95307060 CCCTCCTGTCCCTGGCCCTCCCC 0: 1
1: 3
2: 13
3: 238
4: 2241
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559766_934559776 5 Left 934559766 2:95307054-95307076 CCTCCCCTCCCTTCTCTTCTCAG 0: 1
1: 0
2: 24
3: 224
4: 1909
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559771_934559776 -4 Left 934559771 2:95307063-95307085 CCTTCTCTTCTCAGAACCCACCC 0: 1
1: 0
2: 7
3: 48
4: 521
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559767_934559776 2 Left 934559767 2:95307057-95307079 CCCCTCCCTTCTCTTCTCAGAAC 0: 1
1: 0
2: 9
3: 95
4: 802
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559764_934559776 11 Left 934559764 2:95307048-95307070 CCTGGCCCTCCCCTCCCTTCTCT 0: 1
1: 1
2: 38
3: 539
4: 3620
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559759_934559776 25 Left 934559759 2:95307034-95307056 CCTGCCCTCCTGTCCCTGGCCCT 0: 1
1: 1
2: 26
3: 152
4: 1213
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559762_934559776 17 Left 934559762 2:95307042-95307064 CCTGTCCCTGGCCCTCCCCTCCC 0: 1
1: 1
2: 28
3: 706
4: 5364
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201
934559765_934559776 6 Left 934559765 2:95307053-95307075 CCCTCCCCTCCCTTCTCTTCTCA 0: 3
1: 8
2: 95
3: 1049
4: 6624
Right 934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934559776 Original CRISPR ACCCCCTGCCTCACAAAGAG GGG Intronic