ID: 934562844

View in Genome Browser
Species Human (GRCh38)
Location 2:95322062-95322084
Sequence GGCCATAAGAATAATGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934562839_934562844 11 Left 934562839 2:95322028-95322050 CCTCTCTGAGCCTCAGTTTCCTC 0: 278
1: 1523
2: 4305
3: 8323
4: 12462
Right 934562844 2:95322062-95322084 GGCCATAAGAATAATGAGGTTGG 0: 1
1: 0
2: 2
3: 11
4: 150
934562842_934562844 -8 Left 934562842 2:95322047-95322069 CCTCATCTGCAAAATGGCCATAA 0: 1
1: 15
2: 245
3: 1519
4: 5003
Right 934562844 2:95322062-95322084 GGCCATAAGAATAATGAGGTTGG 0: 1
1: 0
2: 2
3: 11
4: 150
934562840_934562844 1 Left 934562840 2:95322038-95322060 CCTCAGTTTCCTCATCTGCAAAA 0: 148
1: 1672
2: 6001
3: 12814
4: 20263
Right 934562844 2:95322062-95322084 GGCCATAAGAATAATGAGGTTGG 0: 1
1: 0
2: 2
3: 11
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934562844 Original CRISPR GGCCATAAGAATAATGAGGT TGG Intronic
902360414 1:15939396-15939418 GGCAATGACAATCATGAGGTGGG - Exonic
904454489 1:30639132-30639154 GGCAATTAGAACAATTAGGTTGG - Intergenic
904473197 1:30748421-30748443 GGCCATAATAATAATGATGATGG - Intronic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
913574702 1:120160566-120160588 GGCCATCAAAGTACTGAGGTAGG + Intronic
914295971 1:146325406-146325428 GGCCATCAAAGTACTGAGGTAGG + Intergenic
914557011 1:148776192-148776214 GGCCATCAAAGTACTGAGGTAGG + Intergenic
914615823 1:149354038-149354060 GGCCATCAAAGTACTGAGGTAGG - Intergenic
914801602 1:150966497-150966519 GGCCATGCGCAAAATGAGGTAGG + Exonic
915276135 1:154789451-154789473 GGTCAAAAGCATAATGTGGTAGG - Intronic
919159506 1:193809620-193809642 GGCCCTATGAAGAATGAGTTTGG + Intergenic
919685692 1:200481653-200481675 GGAGATGAGAATAAAGAGGTGGG + Intergenic
921745116 1:218731690-218731712 GGCCATAAGAATAAAGAGAAAGG - Intergenic
921784745 1:219216761-219216783 GGCCATGAGGATACTGAGCTGGG - Intergenic
923920244 1:238555939-238555961 TGCCAGAAGAATGAAGAGGTGGG - Intergenic
1063544104 10:6963044-6963066 GCTCATGAGGATAATGAGGTTGG - Intergenic
1064270419 10:13860273-13860295 TGCCATAAAAATAATTAGGAAGG + Intronic
1064425627 10:15226728-15226750 GTCCTTAAGAATACAGAGGTGGG + Intronic
1064763842 10:18651124-18651146 GGCTTTATGAATAAGGAGGTAGG - Exonic
1068653067 10:59543998-59544020 GACCATAAGAAGAACCAGGTAGG - Intergenic
1069758156 10:70786516-70786538 GTCCCTCAGAATGATGAGGTGGG + Intergenic
1070041173 10:72781817-72781839 GGCCAAAGGAATAATGATCTTGG + Intronic
1073715451 10:106101432-106101454 GGCAATAAAAATTAGGAGGTGGG + Intergenic
1074758091 10:116642490-116642512 GGCCAGAAGAATGATAAGATAGG - Intronic
1078407005 11:11079167-11079189 GGCAATAAGAGTGAAGAGGTGGG + Intergenic
1079086492 11:17449306-17449328 AGCCATAAAAATGATGAAGTGGG + Intronic
1083091817 11:60207743-60207765 GGCTCTAAGAATAATGGGGTGGG - Intronic
1083308984 11:61775028-61775050 GGCCAGATGCATGATGAGGTTGG - Intronic
1086960183 11:92973255-92973277 GGCAGTAAGAATAAGGAGGCAGG - Intronic
1088360596 11:108985071-108985093 GGCCAGATGCAAAATGAGGTAGG + Intergenic
1089763094 11:120742930-120742952 AGCCATAAAAAGAATGAGATTGG + Intronic
1090157374 11:124455047-124455069 GGAGATAAGAAAGATGAGGTTGG - Intergenic
1090501505 11:127265670-127265692 GGCCCTAAAAATATTGAGGGTGG + Intergenic
1091382353 12:70082-70104 GGCCAGAGGAAGAATGAGGGAGG - Intronic
1092626208 12:10332080-10332102 TGCCAAAAAAATAATAAGGTTGG + Intergenic
1092668831 12:10839246-10839268 TGCCTAGAGAATAATGAGGTGGG + Intronic
1097614383 12:61865873-61865895 GACCAACAGAATAATGAGGATGG + Intronic
1099734017 12:86543234-86543256 TGCCATATGATTAATAAGGTAGG - Intronic
1100870117 12:98901930-98901952 GGCAATAAGAATAATAAAATTGG - Intronic
1103926159 12:124424512-124424534 GTCCATAAGAATAGAGGGGTGGG - Intronic
1108609269 13:52068242-52068264 GACCAAAAGAATAAGGAGGGTGG - Intronic
1109906771 13:68853205-68853227 GATCAAAAGACTAATGAGGTTGG - Intergenic
1110316655 13:74115802-74115824 GGCAATAAGAATACAGAGGCAGG - Intronic
1112881566 13:104112834-104112856 AGTTATAAAAATAATGAGGTTGG - Intergenic
1113471404 13:110549438-110549460 GGCTGTAAGAATCATGAGCTAGG - Intronic
1118647839 14:67857404-67857426 GTACATAAAAATAATGAAGTAGG + Intronic
1119730599 14:76948601-76948623 GGGCAGAAGGATAAAGAGGTCGG + Intergenic
1126038215 15:44567004-44567026 GGCTATTAGAATCTTGAGGTAGG - Intronic
1126746942 15:51835764-51835786 CTACATAAGAATAATGAGGTTGG - Intronic
1127416479 15:58762609-58762631 GGCCATAAGACTAGGGAAGTAGG + Intergenic
1131193495 15:90336116-90336138 GCCATTAAAAATAATGAGGTTGG - Intergenic
1132176035 15:99715787-99715809 GGCCATTAGAGTACTGAGGAAGG - Exonic
1140713405 16:77699213-77699235 AACCATAAAAATAATCAGGTAGG + Intergenic
1142103393 16:88287796-88287818 GGCCATAAGGCTAATGCGGCAGG - Intergenic
1142984670 17:3688675-3688697 GGCTAAAAGAATAGTGAGGGTGG + Exonic
1143410773 17:6707121-6707143 GGCCATGAGGATGATGACGTAGG + Exonic
1143698521 17:8639118-8639140 GGCCATGAGAAGAAAGAGGAAGG - Intergenic
1143849959 17:9803401-9803423 GGATATAAGAATAATGATGCTGG - Intronic
1143979421 17:10855258-10855280 TGCCAAAAGACCAATGAGGTAGG - Intergenic
1146022807 17:29293480-29293502 TGGGAAAAGAATAATGAGGTTGG + Intronic
1147919923 17:43909634-43909656 GCCGCTAAGAATAATGAGTTGGG - Exonic
1150011082 17:61504661-61504683 GGCAATAGGAATACAGAGGTTGG - Intergenic
1151900845 17:77013152-77013174 GGCGATAAGAATAATGAGGCTGG + Intergenic
1155060231 18:22222191-22222213 AGCCAAAAGAATAATGAAGCTGG + Intergenic
1156089348 18:33446877-33446899 GGTCATAATAATCATGAGGGAGG + Intergenic
1156283298 18:35663319-35663341 GGCCATAAGAATAACAATGAAGG + Intronic
1156355178 18:36334569-36334591 GTCCAGAATATTAATGAGGTAGG + Intronic
1156895150 18:42237516-42237538 AGCCAAAAAAATAATGAGGGAGG - Intergenic
1161866519 19:6836580-6836602 GGCCACAAGAGTGATGGGGTGGG + Intronic
1162174599 19:8821960-8821982 GGCCAAAGGAATAATGATTTGGG + Intronic
1166808301 19:45499847-45499869 GGGCATAAGTAGAATGAAGTGGG + Intronic
1168058068 19:53874528-53874550 GGCAAGAAGAACAAAGAGGTTGG - Exonic
926668146 2:15547758-15547780 TGCCAGAAGAATAATTTGGTGGG - Intronic
926976135 2:18518868-18518890 GGCCTTAAGAAACATGAGCTTGG + Intergenic
928138873 2:28710275-28710297 GGCCACAAAAATAATGGGGATGG - Intergenic
929155435 2:38784633-38784655 TGCCATCAGACTAATGAGCTGGG + Exonic
931121532 2:59225588-59225610 GGCCCTAAAAATACTGAGGAGGG + Intergenic
932087733 2:68776603-68776625 GGCCAAAAAAGCAATGAGGTTGG - Intronic
932510735 2:72286703-72286725 GGGAATACGAATAATGAGGGAGG + Intronic
933364639 2:81334965-81334987 GGATATAAGAATTATGAGGTAGG + Intergenic
934562844 2:95322062-95322084 GGCCATAAGAATAATGAGGTTGG + Intronic
935321333 2:101892209-101892231 TGCATTAAGAACAATGAGGTAGG - Intronic
935578428 2:104734771-104734793 GGGCATAAGAGTAAAGAGCTGGG - Intergenic
939422775 2:141995300-141995322 GGCCATAAGAAAACAGAAGTTGG - Intronic
943368261 2:186985036-186985058 GGCCCTAAGGTTAATAAGGTTGG - Intergenic
1173140944 20:40482295-40482317 GGCCAGAAGAATAATTATGTGGG - Intergenic
1176282847 20:64324751-64324773 GGCCAGAGGAAGAATGAGGGAGG + Intergenic
1179042260 21:37814596-37814618 AGCCATAAAAAGAATGAGATCGG + Intronic
1184951850 22:47848711-47848733 GACCAGCAGAAGAATGAGGTGGG + Intergenic
949244446 3:1909397-1909419 GGCCAGAAGTATTATGTGGTTGG - Intergenic
949729708 3:7094388-7094410 GGCCTTTAGAAGAATGAGGCCGG + Intronic
950833308 3:15896496-15896518 AGCTATAAGAATGCTGAGGTAGG + Intergenic
953113325 3:39966012-39966034 GGCCATTAGCAAAATGATGTGGG + Intronic
953690793 3:45117248-45117270 GGAAATAATAATAATTAGGTAGG - Intronic
955215349 3:56980887-56980909 GGCCATGTGGATATTGAGGTGGG - Intronic
955549084 3:60063894-60063916 GCTATTAAGAATAATGAGGTAGG + Intronic
957333671 3:78798997-78799019 GGCCATGAGAAGAATCAGCTTGG + Intronic
958055224 3:88401956-88401978 GGCCATGAGAAAAATGGGATGGG + Intergenic
958431137 3:94043138-94043160 GGCCAAAAAAATAATGAATTTGG + Exonic
958781325 3:98546934-98546956 TGCCTTAAAAATAATGAGCTGGG + Intronic
960229653 3:115210201-115210223 GGCCATCAAAATAAAGAGGGAGG - Intergenic
960346902 3:116544442-116544464 AGCCATAAAAATAATGAGGTCGG + Intronic
961601400 3:128064979-128065001 GGCGATGAGATTCATGAGGTTGG - Exonic
964756062 3:160091810-160091832 GGCAATCAGATTAATAAGGTTGG - Intergenic
965636464 3:170787010-170787032 TGGAATAAGAAGAATGAGGTTGG + Intronic
967499267 3:190177849-190177871 GGCCATAGGGAAAATGAGTTGGG + Intergenic
968184054 3:196619323-196619345 GTCCATGAGTAAAATGAGGTTGG - Intergenic
969574095 4:8026355-8026377 GGCCCTCAGAAAAATGAGGACGG + Intronic
971130331 4:23802146-23802168 GGCCATAAGATTACTGGGATGGG - Intronic
971887210 4:32466130-32466152 AGCCATTAAAATAATAAGGTAGG - Intergenic
972111756 4:35570371-35570393 GACCATAAGAATTAGGAGGATGG - Intergenic
977152783 4:93533962-93533984 AGCCAGAAAGATAATGAGGTGGG - Intronic
979768954 4:124498816-124498838 GGCCATAAGAAAAATCTGCTTGG - Intergenic
981869321 4:149467807-149467829 AGGCAGAAGAATAATGAAGTTGG - Intergenic
985198514 4:187459531-187459553 GGACACAAGAATAATGAGATTGG - Intergenic
985748617 5:1661812-1661834 GGCCAGAAGTAAAATGACGTAGG - Intergenic
987479802 5:18439521-18439543 TACCATAAGAAAAATGAAGTTGG + Intergenic
988068175 5:26250516-26250538 GTCCATCAGAACAATGGGGTTGG - Intergenic
988897788 5:35696908-35696930 GGCCATGAGAATAGTGAGGCAGG + Intronic
989286346 5:39704381-39704403 GTCCACAAGAATAATCAGGAAGG + Intergenic
991361957 5:65830202-65830224 AGCCATTAGAAGAATGATGTGGG + Intronic
995244777 5:109923121-109923143 TACCATAAGGAAAATGAGGTGGG - Intergenic
995333661 5:110974761-110974783 GGCCATACTAATCAAGAGGTAGG - Intergenic
996167551 5:120243626-120243648 GGACATCAGAATAAAGAGGGAGG + Intergenic
1000190769 5:158908631-158908653 GGCCATATTTAAAATGAGGTTGG - Intronic
1001605568 5:172957796-172957818 GGCTCCAAGAATAAGGAGGTTGG - Intergenic
1004361823 6:14978028-14978050 CACTATAAGAATAATGAGGTTGG - Intergenic
1007171608 6:39868035-39868057 GGCCTTAAGAGTTATGAGTTTGG + Intronic
1010650803 6:78453495-78453517 GGCCAAAAGATTACTGAGGAGGG - Intergenic
1010853827 6:80812942-80812964 GGGCAGAAGAATATTGATGTGGG + Intergenic
1011172902 6:84526024-84526046 GGAAATAAGATTAGTGAGGTAGG + Intergenic
1011862152 6:91772235-91772257 GGCCATCAGAAGAAAGAGGTGGG - Intergenic
1012452050 6:99362985-99363007 AACCAGAAGAATAATGAGATTGG + Intergenic
1031003818 7:116449312-116449334 GGCAAAAAGTAGAATGAGGTGGG + Intronic
1031638035 7:124125898-124125920 GGCTATAAGAATAAAAGGGTGGG - Intergenic
1031867080 7:127049606-127049628 GGCTATAAGCTTAATGAGGATGG - Intronic
1032489445 7:132313123-132313145 GGACATAGGTATAGTGAGGTAGG - Intronic
1032684324 7:134216120-134216142 CCCCATAAAAATACTGAGGTAGG - Intronic
1033841486 7:145379612-145379634 GAGCATAAGAAAAATGATGTTGG - Intergenic
1034051556 7:147989478-147989500 GGATATAAGAATGATGATGTTGG - Intronic
1034152456 7:148927699-148927721 AGCCCTAAAAATAATTAGGTAGG - Intergenic
1035687555 8:1536779-1536801 GGAAATAAAAATAAAGAGGTGGG - Intronic
1037512578 8:19598796-19598818 GCCCATAAGAAGAATGTGGGTGG + Intronic
1037650962 8:20838205-20838227 GGACATAAAAATTATGAGCTAGG + Intergenic
1037874612 8:22535469-22535491 GGCCAGATGAACGATGAGGTGGG - Intronic
1038521864 8:28240641-28240663 GGAGATAAGATTAATGAGGATGG + Intergenic
1041873451 8:62661261-62661283 GGCCATCATGATCATGAGGTTGG + Intronic
1044258010 8:90088611-90088633 AGCCTTAAAAAAAATGAGGTGGG - Intronic
1046032058 8:108794210-108794232 GGCCATTAGAAGAATAAGGCAGG + Intergenic
1047067802 8:121305897-121305919 GGACTTAAGAATAATGGAGTGGG + Intergenic
1050516822 9:6453461-6453483 GGACTTAAGAATATTGAGGCAGG + Intronic
1050770715 9:9196145-9196167 GCCCATAAGAATAAATATGTGGG + Intronic
1054952604 9:70869596-70869618 GGGCCTAAGAAGAATGAAGTTGG + Intronic
1055278229 9:74643596-74643618 TGCCATAAAAATATTGAAGTAGG + Intronic
1056667811 9:88595634-88595656 TGACACAAGAATAATGAGCTGGG + Intergenic
1058440472 9:105001981-105002003 GCCATTAAAAATAATGAGGTAGG + Intergenic
1060418319 9:123448951-123448973 GGGCATAGGGATAATGAAGTAGG + Intronic
1186011621 X:5140959-5140981 GACCATAAGGATTATGAAGTTGG - Intergenic
1187227203 X:17384997-17385019 GGAAATAAAAATAATGAGGTAGG + Intronic
1191244209 X:58213122-58213144 TCCCATTAGAATACTGAGGTCGG - Intergenic
1194915960 X:99709015-99709037 GCCAATAAGAAGAATGAGATTGG - Intergenic
1196322858 X:114363250-114363272 GGCAATAAGAATGAAGAGGAAGG + Intergenic
1200022963 X:153226945-153226967 GACCAGCAGAAGAATGAGGTGGG - Intergenic
1200524866 Y:4261135-4261157 GGCCATCAGTATTATTAGGTTGG - Intergenic