ID: 934563181

View in Genome Browser
Species Human (GRCh38)
Location 2:95323660-95323682
Sequence GGCTTAAAGGCACCAGGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 105}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934563170_934563181 12 Left 934563170 2:95323625-95323647 CCGCGTTTTCTGTTCCCACCCCG 0: 1
1: 0
2: 1
3: 6
4: 168
Right 934563181 2:95323660-95323682 GGCTTAAAGGCACCAGGATCTGG 0: 1
1: 0
2: 1
3: 9
4: 105
934563177_934563181 -7 Left 934563177 2:95323644-95323666 CCCGTCACAACTTTGGGGCTTAA 0: 1
1: 0
2: 0
3: 6
4: 128
Right 934563181 2:95323660-95323682 GGCTTAAAGGCACCAGGATCTGG 0: 1
1: 0
2: 1
3: 9
4: 105
934563169_934563181 15 Left 934563169 2:95323622-95323644 CCACCGCGTTTTCTGTTCCCACC 0: 1
1: 0
2: 0
3: 9
4: 156
Right 934563181 2:95323660-95323682 GGCTTAAAGGCACCAGGATCTGG 0: 1
1: 0
2: 1
3: 9
4: 105
934563175_934563181 -3 Left 934563175 2:95323640-95323662 CCACCCCGTCACAACTTTGGGGC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 934563181 2:95323660-95323682 GGCTTAAAGGCACCAGGATCTGG 0: 1
1: 0
2: 1
3: 9
4: 105
934563176_934563181 -6 Left 934563176 2:95323643-95323665 CCCCGTCACAACTTTGGGGCTTA 0: 1
1: 0
2: 0
3: 12
4: 72
Right 934563181 2:95323660-95323682 GGCTTAAAGGCACCAGGATCTGG 0: 1
1: 0
2: 1
3: 9
4: 105
934563173_934563181 -2 Left 934563173 2:95323639-95323661 CCCACCCCGTCACAACTTTGGGG 0: 1
1: 0
2: 0
3: 1
4: 81
Right 934563181 2:95323660-95323682 GGCTTAAAGGCACCAGGATCTGG 0: 1
1: 0
2: 1
3: 9
4: 105
934563178_934563181 -8 Left 934563178 2:95323645-95323667 CCGTCACAACTTTGGGGCTTAAA 0: 1
1: 0
2: 0
3: 19
4: 175
Right 934563181 2:95323660-95323682 GGCTTAAAGGCACCAGGATCTGG 0: 1
1: 0
2: 1
3: 9
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934563181 Original CRISPR GGCTTAAAGGCACCAGGATC TGG Intronic
905534802 1:38712846-38712868 GGCTTCAAGGAACCAGGATAGGG - Intergenic
905621877 1:39455395-39455417 GTCTTACATCCACCAGGATCTGG - Intronic
907052974 1:51342235-51342257 GGATTCCAGGCACCAGGATTGGG - Intronic
907774114 1:57496285-57496307 GCCTTGAAGCCAACAGGATCTGG + Intronic
908280327 1:62527194-62527216 CTCTTAAAGGCAGAAGGATCAGG - Intronic
910848584 1:91628035-91628057 AGTTTAAAGGCATCAGGACCTGG - Intergenic
911591300 1:99751170-99751192 GGTTTTAAGGCCCCAGGACCAGG - Intronic
913312642 1:117516957-117516979 GGATTAAAGGCAGCAGTTTCTGG + Intronic
922214564 1:223509772-223509794 GGCTGAAGGGCAGCAGGGTCAGG - Intergenic
1064006045 10:11699971-11699993 GGGTTACAGGCACCACCATCAGG - Intergenic
1064484863 10:15775761-15775783 GGATTTCAGGCACCAGGAGCTGG - Intergenic
1064952712 10:20872181-20872203 GGCACAAAGGCAGCAGGAGCAGG + Intronic
1076315140 10:129534536-129534558 CCCTTAAAGGGACCAGGGTCGGG - Intronic
1076996120 11:298354-298376 GGCTGGAGGGCCCCAGGATCAGG + Exonic
1079320674 11:19449123-19449145 GGCTTAACAGAACCAGGAGCTGG - Intronic
1083664325 11:64266402-64266424 GGCGTAAGGGCACCGGGACCGGG + Exonic
1083709712 11:64540627-64540649 GGCTCCAAGGCACCAGCACCAGG - Intergenic
1084673465 11:70621095-70621117 GGCACCAAGGCACCGGGATCGGG + Intronic
1084748729 11:71189880-71189902 GGCTTCAAAGCCCCAGCATCTGG + Intronic
1088541737 11:110920563-110920585 GACTGAAAGTCACCAGGATCTGG - Intergenic
1089449607 11:118583890-118583912 GGCAAAAAAGCACCAGGATTTGG + Exonic
1090948450 11:131451874-131451896 GGCATGAAGGCATCAGGCTCTGG + Intronic
1091361537 11:134981945-134981967 AGCTTAGGGGCACCAGGCTCTGG - Intergenic
1093244334 12:16717443-16717465 GGCTTAATGTAACCAGGACCTGG + Intergenic
1095731106 12:45507903-45507925 GGCAAATAGGCACCAGCATCTGG + Intergenic
1097367303 12:58731311-58731333 GGCTTAAGGGCCCCATGATCTGG - Intronic
1101246883 12:102891911-102891933 GGCTGAATTGCCCCAGGATCTGG + Intronic
1107757821 13:43644778-43644800 GCTTTAAAGGCAGCTGGATCTGG - Intronic
1109418666 13:62079470-62079492 GGCTTCAATGAACCAAGATCAGG + Intergenic
1113921541 13:113915875-113915897 GGCATCAAGGCCCCAGGATATGG - Intergenic
1118093451 14:62509264-62509286 GGATTAAAGGCAACAGAATGTGG + Intergenic
1118858548 14:69643544-69643566 GGTTTAATGGGACCATGATCAGG - Intronic
1121026510 14:90620363-90620385 GGATTAAAGACACCAGAAGCTGG + Intronic
1122282970 14:100635124-100635146 GGCTGAAAGGCACCTGGGGCTGG + Intergenic
1122900002 14:104778494-104778516 GGCTTACAGGAACCAGGTCCTGG + Intronic
1124440181 15:29680082-29680104 GGCTATCAGGCACCAGGACCAGG + Intergenic
1128350842 15:66887310-66887332 TGCTTATAGGCACCATGATCTGG + Intergenic
1128830557 15:70764005-70764027 GGTTTCCAGGCACCAGGATTTGG - Intergenic
1129708708 15:77809314-77809336 GCCTCAAAGGCAGCGGGATCCGG + Intronic
1130960524 15:88655870-88655892 GGCATAAATGCACCAGGAATAGG - Exonic
1131056302 15:89377402-89377424 GATTTGAAGGGACCAGGATCTGG + Intergenic
1132298737 15:100763572-100763594 GACTGAGAGGCCCCAGGATCAGG - Intergenic
1136094561 16:27945730-27945752 GCCTTGAAGCCACCAGGAACTGG - Intronic
1136356486 16:29747634-29747656 GGCTCAAAACCACCAGGATGGGG - Intergenic
1139717988 16:68829233-68829255 GTCTGAAAGGCACCAGCTTCTGG - Intronic
1144704558 17:17358690-17358712 GGAGTTAAGGCACCAGGATGAGG + Intergenic
1145933586 17:28702429-28702451 AGCTGAAAGGCAGCAGGAACTGG - Exonic
1151411154 17:73930687-73930709 TACTTAAAGGCATCAGGACCTGG - Intergenic
1157323387 18:46651181-46651203 GCCTGTGAGGCACCAGGATCAGG + Intronic
1162783404 19:13019086-13019108 GCCTTAAAGCCAGCAGGATGTGG + Intronic
1167419013 19:49392070-49392092 GGCGTGCAGCCACCAGGATCCGG + Intronic
925315515 2:2919796-2919818 GGCTTATCGGCGACAGGATCTGG + Intergenic
929241748 2:39660583-39660605 TGCTCAAAGGCACCAGGATCTGG - Intergenic
929813780 2:45214335-45214357 TGCCTAAAGTCACTAGGATCTGG + Intergenic
934563181 2:95323660-95323682 GGCTTAAAGGCACCAGGATCTGG + Intronic
936750719 2:115638437-115638459 GGCTTACAGGCACTTGGATTCGG - Intronic
937481158 2:122260898-122260920 GGCTTTAAAGCACCAGAAACAGG + Intergenic
941442175 2:165552293-165552315 GGCTTAAGAGCACCAGGAAGTGG - Intronic
948871686 2:240803280-240803302 GCCTTAAAGGCACAGGGATGGGG + Intronic
1170161891 20:13321552-13321574 GGCTTCAAGGCACCAGGCCTAGG - Intergenic
1172443883 20:34983185-34983207 GGCTTAACAGGACCAGGAGCAGG - Intronic
1174532441 20:51224810-51224832 TGCTGAAAGCCACCAGGAGCTGG + Intergenic
1175184822 20:57173120-57173142 AGCTTGGAGGCAGCAGGATCTGG + Intronic
1179099201 21:38341823-38341845 GACTCAAAGGCACCAGGATTGGG - Intergenic
1179929114 21:44555579-44555601 CGGTGAAGGGCACCAGGATCTGG + Intronic
1181032844 22:20156644-20156666 GGCTTCAAGGCCCCAGGAAGTGG + Intergenic
1181940248 22:26470269-26470291 GGCTTGAAGGCAGCTGGATAAGG + Intronic
1182256045 22:29039304-29039326 GGATGAAAGGCTGCAGGATCTGG - Intronic
1184298767 22:43542757-43542779 GGCCTAACGGCACCAGGATGGGG + Intronic
955009365 3:54999079-54999101 GGCTCAAAGGCAGTAGGACCAGG + Intronic
955326780 3:58014661-58014683 GGCCTAAAGGCTCCAGGCCCTGG - Intronic
957534333 3:81481942-81481964 GGCTGAAAGACACTGGGATCAGG - Intergenic
962846260 3:139276460-139276482 GGCTTAAAGTCACCAGGGGATGG - Intronic
965897829 3:173599045-173599067 GGCTTAAAAGAACTACGATCTGG - Intronic
966637010 3:182146644-182146666 GGCTTAAGGGGACAAGGATCTGG - Intergenic
969003245 4:3999621-3999643 GGATTCTAGGCACAAGGATCTGG - Intergenic
969810681 4:9645198-9645220 GGATTCTAGGCACAAGGATCTGG + Intergenic
973540484 4:51930412-51930434 GCATTAAAGGCAGCAGGATTTGG + Intergenic
975270322 4:72424484-72424506 GGCTTAATGGAAGCAGGATTTGG - Intronic
975288225 4:72645488-72645510 GGCTTAGAGGTACCAAGATGGGG + Intergenic
978485584 4:109250281-109250303 GGCTTTAAGGCACAAATATCTGG + Intronic
980964699 4:139509773-139509795 GATTTAAAGGCACCAGGATAGGG - Exonic
990981244 5:61604305-61604327 TGCCTAAAGGCACCTGGATGAGG - Intergenic
992669857 5:79048451-79048473 TGATTAAAGGAACCAGGATATGG - Intronic
993668955 5:90736577-90736599 GCCATAAAGGCATCAGGTTCTGG + Intronic
998409678 5:141900014-141900036 GTCTTAGAACCACCAGGATCTGG - Intergenic
999417612 5:151412838-151412860 CCCTTAAAAGCACCAGCATCTGG + Intergenic
999928868 5:156408847-156408869 TGCCTAAAGTCACCAGGAACTGG - Intronic
1013296609 6:108763390-108763412 GGGTGAAAGGCATCAGGATATGG - Intergenic
1018813054 6:167311654-167311676 GGGTTAAAGAGACCAGGATGTGG - Intronic
1020220339 7:6231839-6231861 GGTTTAAAGGCATCGGGACCCGG + Intronic
1020853565 7:13388997-13389019 GGCTCAGGGGCACCATGATCAGG - Intergenic
1023136348 7:37056616-37056638 GGCTGAAAGGCACCAAGGGCAGG + Intronic
1023225118 7:37960933-37960955 GGGGAAAAGGCACCAGGGTCAGG + Intronic
1031083903 7:117283431-117283453 GGCTTAAGGGGGCCAGGATAAGG + Intronic
1035155553 7:156909231-156909253 GGCTCCAAGGCCCCAGGAGCAGG - Intergenic
1038852952 8:31297908-31297930 TACTTAAAGACACCAAGATCAGG + Intergenic
1040287198 8:46106481-46106503 GGCTGTAAGTCCCCAGGATCTGG - Intergenic
1040293281 8:46136346-46136368 GGCTGTAAAGCACCAGGCTCTGG - Intergenic
1040301973 8:46192752-46192774 GGCTGTAAGGCACCAGGCTTTGG + Intergenic
1040314097 8:46251823-46251845 GGCTTTAAAGCACCAGGGTTTGG + Intergenic
1041992212 8:64006847-64006869 GGCTTGATGGCACCAGGAAGAGG - Intergenic
1043863508 8:85350005-85350027 TGCATAAAGGAAACAGGATCAGG - Intronic
1044276811 8:90310735-90310757 TGCTTAAAGTCTCCAGGGTCTGG + Intergenic
1045148814 8:99379235-99379257 GTCTTTATGGCACCAGGAACTGG - Intronic
1049120855 8:140735939-140735961 TGCATAAAGGCACCATTATCTGG + Intronic
1051628669 9:19122874-19122896 AGCTTTATGGCACCAGGAACTGG - Intronic
1052366455 9:27617292-27617314 AGCTTAAAGAGACCTGGATCTGG - Intergenic
1053390536 9:37732216-37732238 GGGTGAAAGGCAGCAGGACCAGG - Intronic
1056519066 9:87383448-87383470 GCCTGAAAGGCAGCAGGACCTGG - Intergenic
1058544472 9:106045542-106045564 GGCTTATTGCCACCAAGATCAGG + Intergenic
1061946755 9:133912894-133912916 TCCTTAAAGTCACCAGGATCAGG - Intronic
1062476324 9:136729110-136729132 GGCTTAGAGGGAGCAGGAGCTGG + Intergenic
1186463503 X:9766250-9766272 GCCTTAAAGGCATCAAAATCAGG - Intronic
1197651884 X:129074068-129074090 TGCGTAAAGGCATCAGCATCAGG + Intergenic
1200886964 Y:8280305-8280327 GGCATAATGGGACCAGGACCGGG - Intergenic