ID: 934567001

View in Genome Browser
Species Human (GRCh38)
Location 2:95346657-95346679
Sequence CAGAGGCGCAGCGCCCGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 145}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934566991_934567001 9 Left 934566991 2:95346625-95346647 CCCCGGCGCCCGCGGGGCTGGAG 0: 1
1: 1
2: 3
3: 32
4: 294
Right 934567001 2:95346657-95346679 CAGAGGCGCAGCGCCCGCGCCGG 0: 1
1: 0
2: 4
3: 17
4: 145
934566993_934567001 7 Left 934566993 2:95346627-95346649 CCGGCGCCCGCGGGGCTGGAGAG 0: 1
1: 0
2: 0
3: 14
4: 178
Right 934567001 2:95346657-95346679 CAGAGGCGCAGCGCCCGCGCCGG 0: 1
1: 0
2: 4
3: 17
4: 145
934566983_934567001 17 Left 934566983 2:95346617-95346639 CCCCCGCGCCCCGGCGCCCGCGG 0: 1
1: 1
2: 18
3: 132
4: 704
Right 934567001 2:95346657-95346679 CAGAGGCGCAGCGCCCGCGCCGG 0: 1
1: 0
2: 4
3: 17
4: 145
934566979_934567001 28 Left 934566979 2:95346606-95346628 CCGCCGCCGCGCCCCCGCGCCCC 0: 1
1: 4
2: 27
3: 410
4: 2480
Right 934567001 2:95346657-95346679 CAGAGGCGCAGCGCCCGCGCCGG 0: 1
1: 0
2: 4
3: 17
4: 145
934566989_934567001 14 Left 934566989 2:95346620-95346642 CCGCGCCCCGGCGCCCGCGGGGC 0: 1
1: 1
2: 7
3: 77
4: 684
Right 934567001 2:95346657-95346679 CAGAGGCGCAGCGCCCGCGCCGG 0: 1
1: 0
2: 4
3: 17
4: 145
934566987_934567001 15 Left 934566987 2:95346619-95346641 CCCGCGCCCCGGCGCCCGCGGGG 0: 1
1: 1
2: 6
3: 66
4: 474
Right 934567001 2:95346657-95346679 CAGAGGCGCAGCGCCCGCGCCGG 0: 1
1: 0
2: 4
3: 17
4: 145
934566999_934567001 0 Left 934566999 2:95346634-95346656 CCGCGGGGCTGGAGAGGGGGCGA 0: 1
1: 0
2: 2
3: 36
4: 271
Right 934567001 2:95346657-95346679 CAGAGGCGCAGCGCCCGCGCCGG 0: 1
1: 0
2: 4
3: 17
4: 145
934566981_934567001 25 Left 934566981 2:95346609-95346631 CCGCCGCGCCCCCGCGCCCCGGC 0: 2
1: 8
2: 32
3: 240
4: 1633
Right 934567001 2:95346657-95346679 CAGAGGCGCAGCGCCCGCGCCGG 0: 1
1: 0
2: 4
3: 17
4: 145
934566992_934567001 8 Left 934566992 2:95346626-95346648 CCCGGCGCCCGCGGGGCTGGAGA 0: 1
1: 0
2: 4
3: 21
4: 252
Right 934567001 2:95346657-95346679 CAGAGGCGCAGCGCCCGCGCCGG 0: 1
1: 0
2: 4
3: 17
4: 145
934566985_934567001 16 Left 934566985 2:95346618-95346640 CCCCGCGCCCCGGCGCCCGCGGG 0: 1
1: 2
2: 16
3: 89
4: 523
Right 934567001 2:95346657-95346679 CAGAGGCGCAGCGCCCGCGCCGG 0: 1
1: 0
2: 4
3: 17
4: 145
934566998_934567001 1 Left 934566998 2:95346633-95346655 CCCGCGGGGCTGGAGAGGGGGCG 0: 1
1: 0
2: 3
3: 50
4: 463
Right 934567001 2:95346657-95346679 CAGAGGCGCAGCGCCCGCGCCGG 0: 1
1: 0
2: 4
3: 17
4: 145
934566982_934567001 22 Left 934566982 2:95346612-95346634 CCGCGCCCCCGCGCCCCGGCGCC 0: 1
1: 8
2: 46
3: 277
4: 1733
Right 934567001 2:95346657-95346679 CAGAGGCGCAGCGCCCGCGCCGG 0: 1
1: 0
2: 4
3: 17
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934567001 Original CRISPR CAGAGGCGCAGCGCCCGCGC CGG Intronic
900384258 1:2402349-2402371 CAGAGGCGCTGCCGCCACGCCGG + Intronic
901272303 1:7961801-7961823 CACATGCGCCGCGCCCCCGCTGG - Intronic
903668657 1:25022746-25022768 CAGAGGCCCAGAGCCCACGGTGG - Intergenic
910676401 1:89820983-89821005 CAGAGCTGCAGCGCCTGCACGGG + Intronic
912831344 1:112956408-112956430 CAGGGGCGCAGCGCGCGGGTCGG - Intronic
913075536 1:115338151-115338173 GAGGGGCGCAGCGCGGGCGCGGG - Intronic
913972443 1:143424669-143424691 CAAAGGCACAGCGCGGGCGCAGG - Intergenic
914066825 1:144250282-144250304 CAAAGGCACAGCGCGGGCGCAGG - Intergenic
914112328 1:144716072-144716094 CAAAGGCACAGCGCGGGCGCAGG + Intergenic
915973629 1:160370929-160370951 CTGTGGCGCGGCGCCGGCGCCGG - Exonic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
922116274 1:222617824-222617846 CAGAGGGGCGGCGCCCGCGAAGG - Intergenic
924957687 1:248945017-248945039 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
1062759936 10:10728-10750 CAAAGGCGCAGCGCCGGCGCAGG + Intergenic
1065114964 10:22476343-22476365 CAGGGTCGTAGCGCCCGGGCTGG - Intergenic
1065590677 10:27258787-27258809 GAGACGCTCTGCGCCCGCGCTGG - Intergenic
1065660318 10:27999059-27999081 GAGACGCTCTGCGCCCGCGCTGG + Intergenic
1073297655 10:102450820-102450842 CGGCGGCGCAGGGCCGGCGCAGG + Exonic
1074696621 10:116055641-116055663 CAGAGCCGCAGCGAGCGCCCTGG - Intergenic
1075210302 10:120485339-120485361 CAGAGGCTCAGCTCCTGAGCAGG - Intronic
1075616129 10:123891858-123891880 CAGAGGCGCGGGGCGGGCGCAGG + Intronic
1075963181 10:126586812-126586834 CAGAGGAGCAGCGCCTGTGGTGG - Intronic
1076013095 10:127006277-127006299 CAGAGGCCCAGGGCCAGCACAGG - Intronic
1076358496 10:129869773-129869795 CAGAGGCGCAGAGCACACACTGG + Intronic
1076661157 10:132056918-132056940 CAGAGGTCCAGCTCCCGCCCTGG + Intergenic
1076963535 10:133786531-133786553 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
1077360795 11:2139432-2139454 CCGCGGCCCAGGGCCCGCGCGGG + Intronic
1078659861 11:13277988-13278010 CAGGGGCGCAGCGCCCGCGAGGG - Intronic
1080887024 11:36376746-36376768 CATAGGCTCAGCAACCGCGCAGG + Intronic
1083927612 11:65818058-65818080 CGCAGGCACAGCGCCCGCCCCGG + Intergenic
1085076775 11:73598316-73598338 CAGAGGGGCCGCGCCCTCTCCGG + Intergenic
1089556267 11:119317268-119317290 CCTAGGCGCAGCTCCCGGGCTGG - Intronic
1089622407 11:119729347-119729369 CAGAGGCGGATCGCGAGCGCGGG + Intergenic
1091372988 11:135076366-135076388 CAAAGCCGCCGCGCCGGCGCAGG - Intergenic
1091915512 12:4269898-4269920 CAGCGGCCCAGCGCCCCGGCGGG + Intergenic
1095976067 12:47941961-47941983 CAGAGGCCCAGCCCCCGCTCGGG + Intronic
1103698522 12:122835572-122835594 CTGCGGCTCAGCACCCGCGCCGG - Exonic
1104568276 12:129903875-129903897 CCGAGGCGCAGCGGCCGGCCTGG - Intergenic
1113082260 13:106532756-106532778 CAGAAACGCAGGGCCCTCGCAGG + Intronic
1113480352 13:110615823-110615845 CCGAGGGGCAGCCCGCGCGCGGG + Intronic
1113989971 13:114353410-114353432 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
1114653152 14:24299499-24299521 CAGAGGCGCAGCTTCCGGGCCGG + Intronic
1118925686 14:70188469-70188491 CAGCGGCTCATCGCCCCCGCGGG + Exonic
1122137915 14:99645301-99645323 CAGAGGCGCAGCGGCTGCGTCGG - Exonic
1122325896 14:100880486-100880508 CAGAGACCCAGCGCCAGCCCTGG - Intergenic
1122768359 14:104086109-104086131 CAGGGGCGCAGCGGCAGCACAGG - Intronic
1124629571 15:31328623-31328645 TGGAGGCTCAGCGCCCGCCCTGG - Intronic
1129288014 15:74541255-74541277 CCGAGACGCAGCTGCCGCGCCGG + Exonic
1129334274 15:74843120-74843142 CAGCGAGGAAGCGCCCGCGCGGG - Exonic
1132398023 15:101488936-101488958 CAGAGGGGCCGCTCCCCCGCGGG + Intronic
1132585786 16:705338-705360 CCGAGGCCCAGCGGCCGCGGGGG + Intronic
1132665847 16:1081012-1081034 CTGAGAGGCAGCGGCCGCGCGGG + Intergenic
1134024646 16:10944644-10944666 GAGCGGCCCAGCGCCCGCGGCGG - Exonic
1134442931 16:14310077-14310099 GAGAGGCGCAGAGCTCGGGCTGG - Intergenic
1134554455 16:15154211-15154233 CAGGGCCGCTGTGCCCGCGCCGG + Intergenic
1140046119 16:71441603-71441625 CAGGGGTGCAGCGAGCGCGCCGG + Intergenic
1142135691 16:88451071-88451093 CAGGGGCACAGGGCCCGAGCTGG + Intergenic
1142192462 16:88724149-88724171 CTGAGGAGCAGAGCCAGCGCGGG + Intronic
1146955860 17:36936117-36936139 CGGAGGCGCGGCGCCGGCGCGGG - Intergenic
1148271761 17:46267014-46267036 CTGAGGCGCGGCGGCGGCGCGGG - Intergenic
1152267899 17:79306842-79306864 CAGAGGCCCAACGCCCAGGCTGG - Intronic
1152538795 17:80964580-80964602 CAGAGGCGCCGTGGCCGCGGGGG - Exonic
1152745615 17:82037335-82037357 GAGAAGCGCAGCGCCCGCGAGGG + Intronic
1152786090 17:82248838-82248860 CCGAGGCCCAGCGCCCGCCCGGG + Intronic
1152952807 18:10924-10946 CAAAGGCGCAGCGCCGGCGCAGG + Intergenic
1160633383 18:80262845-80262867 CAAAGGCGGCGCGCCCGCGCAGG - Intergenic
1160653416 19:246546-246568 CAGGCGCGGCGCGCCCGCGCAGG + Intergenic
1160960571 19:1718877-1718899 CCGGGGCGCAGAGCCCGCGGCGG + Intergenic
1161042543 19:2117668-2117690 CAGAGGCGGGGAGCCCGCGGGGG - Intronic
1162612511 19:11767382-11767404 CAGGGCCGCAGTGGCCGCGCAGG - Intronic
1163490898 19:17616723-17616745 CAGAGACCCAGCGCCCACGGAGG + Intronic
1164834753 19:31349887-31349909 CGGGGGCGCGGCGCCCCCGCGGG - Intergenic
1165320290 19:35080722-35080744 CAGAGGGGCAGTGCCCACGGTGG - Intergenic
1166983960 19:46648976-46648998 CCGCGGCCCAGCGCCCACGCTGG - Exonic
1167510891 19:49894896-49894918 CAGAGGCCCAGGGCTGGCGCTGG + Intronic
1167596797 19:50432318-50432340 CAGAGCCGCGGCGCCCTCCCCGG + Intergenic
1167636749 19:50659906-50659928 GAGAGGGGCAGAGGCCGCGCTGG - Intronic
924958317 2:10841-10863 CAAAGGCACCGCGCCCGCGCAGG + Intergenic
924958372 2:11160-11182 CAGGCGCACCGCGCCCGCGCAGG + Intergenic
924958377 2:11189-11211 CAGGCGCACCGCGCCCGCGCAGG + Intergenic
924958382 2:11218-11240 CAGGCGCACCGCGCCCGCGCAGG + Intergenic
924958387 2:11247-11269 CAGGCGCACCGCGCCCGCGCAGG + Intergenic
924958392 2:11276-11298 CAGGCGCACCGCGCCCGCGCAGG + Intergenic
925009034 2:468185-468207 CTGGGGCGCAGAGCCCGCCCAGG + Intergenic
925146090 2:1584392-1584414 CAGCAGGGCAGCGCCCGCGGTGG - Intergenic
928904501 2:36355866-36355888 CAGCGGCGCAGCCTCCGGGCCGG - Intergenic
929998704 2:46846786-46846808 CAGAGGGGCAGCCCCAGCCCTGG + Intronic
930096378 2:47569990-47570012 CCGACGCGCTGCGCCCGCGCTGG - Exonic
934177143 2:89585636-89585658 CAAAGGCACAGCGCGGGCGCAGG - Intergenic
934287450 2:91659995-91660017 CAAAGGCACAGCGCGGGCGCAGG - Intergenic
934567001 2:95346657-95346679 CAGAGGCGCAGCGCCCGCGCCGG + Intronic
935572394 2:104675887-104675909 CAGAGGAGCAGCGCCCATCCAGG + Intergenic
938547970 2:132352656-132352678 CAAAGGCCCAGCGCCCGCGCAGG + Intergenic
942444295 2:176067861-176067883 CGCAGGAGCAGCGACCGCGCAGG - Intergenic
948188976 2:236044054-236044076 CAGAGGCTCAGCGTCCACTCTGG - Intronic
1170756942 20:19213004-19213026 CGGAGCCGCAGCGCCCACTCGGG - Intronic
1171876838 20:30585429-30585451 CAAAGGCCCAGCGCCGGCGCAGG + Intergenic
1173454164 20:43190005-43190027 CCGAGGCGGAGCGCCCGGGCGGG - Intergenic
1174317526 20:49713927-49713949 CGGAGGCGGGGCGCACGCGCGGG + Intergenic
1181516196 22:23415075-23415097 CACAGGCGAAGCCACCGCGCCGG + Intergenic
1183458205 22:37934095-37934117 CAGAGGAGCCGTGCCCGCTCTGG - Intronic
1183601659 22:38843743-38843765 CCGCCGGGCAGCGCCCGCGCCGG + Exonic
1184796897 22:46738048-46738070 CAGCGCAGCAGAGCCCGCGCGGG + Exonic
1185278579 22:49960466-49960488 CGCAGGCGCAGTGCCCGCGCGGG - Intergenic
1185386321 22:50532641-50532663 CAGAGGCCCAGCGGCGGCACTGG - Intergenic
1185419680 22:50728483-50728505 CAGAGGCACAGGGCAGGCGCGGG - Intergenic
1185430382 22:50807256-50807278 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
949089615 3:11741-11763 CGCAGGCGCAGCGCCGGCGCAGG + Intergenic
949105767 3:198065-198087 CGGAGGAGCAGCAGCCGCGCGGG + Intronic
953021859 3:39119678-39119700 CAGAGGGGCAGTGCCAGCTCTGG + Intronic
961828709 3:129612268-129612290 CAGAGGGGCAGGGCCGCCGCGGG + Intergenic
966861900 3:184235198-184235220 CAGAAGCTCAGCGCCAGCACGGG - Exonic
966911275 3:184561758-184561780 CAGAGCGGCCGCGCCAGCGCTGG + Intronic
968148179 3:196317622-196317644 CACAGATGCAGCTCCCGCGCCGG + Intronic
968815069 4:2817895-2817917 CAGAGCCGAGGCTCCCGCGCCGG + Intronic
969379105 4:6782791-6782813 CAGAGGAGAGGCGCCCCCGCCGG + Exonic
971268350 4:25114141-25114163 CACAGGCGCAGCCCCCCTGCTGG + Intergenic
976774931 4:88697793-88697815 CAGAGGCCCTGCACCCGAGCTGG + Exonic
979455424 4:120922094-120922116 CAGCGGAGCAGCGTGCGCGCGGG + Intronic
979547170 4:121951567-121951589 CGGAGCCGCAGCGCCGCCGCCGG - Exonic
984715202 4:182917982-182918004 TCGAGGCACAGCGCCCCCGCCGG - Intergenic
985466789 4:190203974-190203996 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
985467604 5:12460-12482 CAAAGGCGCCGCGCCGGCGCAGG + Intergenic
992089358 5:73303649-73303671 GAGATGCGCGGCGTCCGCGCGGG + Intergenic
1001133250 5:169081323-169081345 CAGAGGCCCAGCTGCCCCGCTGG - Intronic
1002190076 5:177473378-177473400 CAAAGGCGCGGCGGCGGCGCGGG + Intronic
1002450774 5:179317356-179317378 CAGAAGGGCAGCGTCCGAGCAGG - Intronic
1002710322 5:181191266-181191288 CAGAGCCTCAGCGCGCGCGTCGG + Intergenic
1003942601 6:11044116-11044138 CGAACCCGCAGCGCCCGCGCCGG + Intronic
1004234837 6:13865351-13865373 CAGAGGCACAGCGGCCACGGAGG + Intergenic
1004241416 6:13925259-13925281 CGGCTGCGGAGCGCCCGCGCGGG + Intronic
1007702105 6:43771505-43771527 GAGAGGCTCACCGCCCACGCGGG + Intronic
1007705011 6:43785237-43785259 GAGAGGCTCAGCGCCAGGGCTGG - Exonic
1017810625 6:157981486-157981508 GGGAGGCGCAGCGCCCCCGGCGG + Intergenic
1018400670 6:163415745-163415767 CGGAGGAGCGGGGCCCGCGCCGG - Intronic
1019716686 7:2542479-2542501 GAGAGGGGCAGTGCCCGCTCAGG + Intronic
1020098656 7:5382322-5382344 CAGAGGCCCAGCCCCAGCCCAGG + Intronic
1020105351 7:5420159-5420181 CCCCGGCGCAGCGCCCGCCCGGG + Intronic
1025004728 7:55344904-55344926 CGCAGGCGCCGCGCCCCCGCGGG - Intergenic
1026595792 7:71733177-71733199 TGCAGGCGCAGCGCCCCCGCTGG + Intergenic
1029373988 7:100167058-100167080 CAGAGCCGCAGCGTCCTGGCAGG + Exonic
1029813984 7:103075237-103075259 CAGAGCCGCAGCGCCGGGCCAGG - Exonic
1034223088 7:149460453-149460475 CAGAGGGGCGGCGCGCGGGCCGG - Intronic
1034306623 7:150048921-150048943 GCGGGGCGCAGCGCCCGCGAGGG - Intergenic
1034441415 7:151087608-151087630 CTGAGGCTCAGCGACCGCGTGGG + Intronic
1035265983 7:157690563-157690585 CCGGCGCCCAGCGCCCGCGCGGG + Intronic
1035649867 8:1256414-1256436 CAGACGCACAGCGCCCAAGCAGG - Intergenic
1039981023 8:42410199-42410221 CAGAGGCCCAGCGGCTGCACGGG + Intergenic
1042785096 8:72537387-72537409 CCGAGGCGCAGCGGCGGCGGCGG - Exonic
1043527448 8:81112077-81112099 CCGAGGCGGAGCAGCCGCGCGGG + Intergenic
1049418199 8:142505134-142505156 CAGAGGCACAGTGCCCGCACAGG - Intronic
1049419707 8:142511218-142511240 CAGAGGCGCATGGACCCCGCCGG - Intronic
1049556221 8:143283543-143283565 CAGAGGCCCAGAGGCCGAGCTGG - Intergenic
1057313474 9:93955298-93955320 CGGAGGCGCAGGGCGCGGGCGGG + Exonic
1057478647 9:95426809-95426831 CAGAGCCGCAGCCGCCGCGCAGG - Intergenic
1059234497 9:112750689-112750711 CCGAGGCGCCGCGGCCGCCCGGG - Intergenic
1061128037 9:128689171-128689193 CGGAGGCGGAGCATCCGCGCGGG + Intronic
1061869581 9:133513590-133513612 TAGAGGGGCAGCCCCCGCTCTGG + Intergenic
1062349860 9:136133323-136133345 CAGCCGCGCAGTCCCCGCGCTGG + Intergenic
1186350109 X:8731883-8731905 TGGAGGCGCAGCGAGCGCGCTGG + Exonic
1186496545 X:10015887-10015909 CCGGGTCGTAGCGCCCGCGCCGG - Intronic
1188248650 X:27864180-27864202 CAGAGGCCCAGCGCGTCCGCAGG - Intergenic
1192817981 X:74614292-74614314 CAGAGGCTCAGCGCCGCCTCCGG - Intronic
1197749235 X:129953351-129953373 CGGAGGCTCAGCACCCGCGGCGG - Intergenic
1199595678 X:149504411-149504433 CTGAGGCACAGCGCCCTCCCTGG - Intronic
1200098202 X:153673901-153673923 CTGCGGCGCCGCGGCCGCGCTGG - Intronic
1201416281 Y:13751930-13751952 TGGAGGCGCAGCGGGCGCGCAGG - Intergenic