ID: 934567066

View in Genome Browser
Species Human (GRCh38)
Location 2:95346886-95346908
Sequence GCTCACATGCCCCCGGCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 165}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934567066_934567080 14 Left 934567066 2:95346886-95346908 CCGCCTGCCGGGGGCATGTGAGC 0: 1
1: 0
2: 1
3: 11
4: 165
Right 934567080 2:95346923-95346945 AGAGGCCGTGCGGGCTGCAGGGG 0: 1
1: 0
2: 1
3: 30
4: 285
934567066_934567071 4 Left 934567066 2:95346886-95346908 CCGCCTGCCGGGGGCATGTGAGC 0: 1
1: 0
2: 1
3: 11
4: 165
Right 934567071 2:95346913-95346935 GCCGCCCCCGAGAGGCCGTGCGG 0: 1
1: 0
2: 0
3: 5
4: 121
934567066_934567069 -4 Left 934567066 2:95346886-95346908 CCGCCTGCCGGGGGCATGTGAGC 0: 1
1: 0
2: 1
3: 11
4: 165
Right 934567069 2:95346905-95346927 GAGCCGTCGCCGCCCCCGAGAGG 0: 1
1: 0
2: 1
3: 13
4: 79
934567066_934567073 5 Left 934567066 2:95346886-95346908 CCGCCTGCCGGGGGCATGTGAGC 0: 1
1: 0
2: 1
3: 11
4: 165
Right 934567073 2:95346914-95346936 CCGCCCCCGAGAGGCCGTGCGGG 0: 1
1: 0
2: 0
3: 12
4: 126
934567066_934567078 12 Left 934567066 2:95346886-95346908 CCGCCTGCCGGGGGCATGTGAGC 0: 1
1: 0
2: 1
3: 11
4: 165
Right 934567078 2:95346921-95346943 CGAGAGGCCGTGCGGGCTGCAGG 0: 1
1: 0
2: 1
3: 22
4: 192
934567066_934567079 13 Left 934567066 2:95346886-95346908 CCGCCTGCCGGGGGCATGTGAGC 0: 1
1: 0
2: 1
3: 11
4: 165
Right 934567079 2:95346922-95346944 GAGAGGCCGTGCGGGCTGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 234
934567066_934567082 20 Left 934567066 2:95346886-95346908 CCGCCTGCCGGGGGCATGTGAGC 0: 1
1: 0
2: 1
3: 11
4: 165
Right 934567082 2:95346929-95346951 CGTGCGGGCTGCAGGGGCCCCGG 0: 1
1: 0
2: 1
3: 47
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934567066 Original CRISPR GCTCACATGCCCCCGGCAGG CGG (reversed) Intronic
900505915 1:3029698-3029720 GCTCACAGGCCCCAGGAAGAAGG + Intergenic
902385403 1:16073109-16073131 GTTCCCAGGCACCCGGCAGGGGG + Intronic
903251237 1:22054300-22054322 GCTCACTTGACCCCGGGAGGCGG - Intronic
906082355 1:43101706-43101728 GCTCACAGGACACCTGCAGGGGG + Intergenic
907196387 1:52690763-52690785 GCTCACTTGAGCCCGGGAGGTGG - Intronic
916070801 1:161168560-161168582 CCTCACCTGCCCCCAGCAGCAGG - Exonic
916359255 1:163949678-163949700 ACTCACATGACCTCGGCAGCTGG - Intergenic
918488514 1:185054782-185054804 GATCGCTTGACCCCGGCAGGCGG - Intronic
919761357 1:201100058-201100080 GGGCACATTCCCCAGGCAGGCGG + Intronic
920027229 1:203007653-203007675 GCTCGCGTGCCCGCGGCTGGAGG + Intronic
920171247 1:204073592-204073614 GCTCACATGCCCCCGCGACGCGG - Exonic
921312571 1:213858813-213858835 GCAAACATGCCCCCTACAGGAGG + Intergenic
923536905 1:234859429-234859451 AATCACATGAACCCGGCAGGCGG + Intergenic
923702560 1:236314205-236314227 GTTCACATGCCTCTGACAGGAGG - Intergenic
924106495 1:240654413-240654435 GCTCACATGCACATGGCAGGTGG - Intergenic
1064140407 10:12785402-12785424 GCTCCCATGCCTCCTGCAAGAGG - Intronic
1065657110 10:27963092-27963114 AATCACATGAACCCGGCAGGCGG - Intronic
1067155962 10:43781671-43781693 GCTCACCTTCCCCAGGCAGCAGG - Intergenic
1067340942 10:45403029-45403051 ACTCATATACCACCGGCAGGAGG + Intronic
1069911430 10:71762124-71762146 GCTGACATGCCCCTGGCCTGTGG - Intronic
1070906612 10:80078855-80078877 GCTCACAGGCCGCGGGCCGGGGG + Intronic
1071291623 10:84193469-84193491 CCTCAAAGGCCCCTGGCAGGGGG + Intergenic
1075251081 10:120874557-120874579 CCTCACATGCCCCCGCCAACAGG + Intronic
1075745464 10:124724392-124724414 CCTCACAAGGCCCAGGCAGGGGG + Intronic
1077541794 11:3150150-3150172 GCCCTCCTGCCCCAGGCAGGAGG + Intronic
1079979301 11:27132223-27132245 GCTCCCATGAGCCCAGCAGGTGG + Intergenic
1081542952 11:44049331-44049353 GATCACTTGACCCCGGCAGCTGG + Intronic
1084451711 11:69242875-69242897 GCTCACATGCCCCAGACATCAGG - Intergenic
1084756783 11:71244787-71244809 GATCACTTGAACCCGGCAGGCGG - Intronic
1087423622 11:97964127-97964149 TCTCACATTCCCCCTTCAGGAGG + Intergenic
1088653409 11:111977397-111977419 GTTGAGATGCCCCCGCCAGGGGG + Intronic
1091694400 12:2618164-2618186 TCTGACATTCCCCTGGCAGGTGG + Intronic
1093176248 12:15916535-15916557 GCTCACTTGAACCCGGGAGGCGG - Intronic
1094218574 12:27970542-27970564 GCGCCCACGCCCCCGGCACGGGG - Intronic
1094553963 12:31479664-31479686 GCTCAAATGCCTCCCGAAGGGGG + Exonic
1094621592 12:32085444-32085466 TCTCACATGAGCCCGGGAGGCGG - Intergenic
1097606568 12:61761996-61762018 TCTCACATGCCCAGAGCAGGAGG - Intronic
1097989915 12:65824166-65824188 GCTCACGTGCTCCCGCCCGGCGG - Exonic
1102559456 12:113751922-113751944 GCTCACAGGCTCCAGGCATGAGG + Intergenic
1103993863 12:124816624-124816646 GCTGACTTGCCCCCGGCACACGG - Intronic
1104659484 12:130600385-130600407 GCTGACATCCTTCCGGCAGGAGG - Intronic
1107015782 13:35706795-35706817 GCTCCCATGCCCCAGGGTGGGGG - Intergenic
1109208194 13:59505126-59505148 GCTCACTTGCTCCAGGAAGGAGG + Intergenic
1110364558 13:74667397-74667419 GCTCAGGTGGCCCAGGCAGGAGG - Intergenic
1111608770 13:90576463-90576485 GCTCACATGCTCCCTCCAAGGGG + Intergenic
1113435823 13:110290265-110290287 GCTAACAAGCGCTCGGCAGGCGG + Intronic
1113468123 13:110526121-110526143 CCACACATGCCCCAGGGAGGAGG - Intronic
1118383435 14:65236427-65236449 GGTCACATGCCCACAGCTGGTGG - Intergenic
1119644677 14:76339733-76339755 ACTCACAAGCCCGGGGCAGGGGG + Intronic
1120323851 14:83000856-83000878 GCCCAAATGCCCCAGGCAAGAGG + Intergenic
1122624612 14:103077993-103078015 GCTCACATGGCCCAGCCTGGTGG + Intergenic
1122955205 14:105067217-105067239 GCTCCCCTGCCCCTGCCAGGTGG + Intergenic
1127320507 15:57840697-57840719 ACTCACAAGCTCCCTGCAGGTGG + Intergenic
1130159642 15:81385716-81385738 TCTCACAGGCCCCCGACAGCCGG - Intergenic
1132631384 16:919331-919353 CCCCACATGCCCGCGGCAGGGGG + Intronic
1133794500 16:9035050-9035072 GCTTACATGGCCAGGGCAGGAGG + Intergenic
1134236965 16:12474149-12474171 GATCACTTGCCCAGGGCAGGTGG - Intronic
1134291243 16:12903785-12903807 ACACACAGGCCCCCGGCAGAGGG - Intronic
1134771723 16:16815040-16815062 GCTCACATTCCCCTAGCTGGTGG - Intergenic
1136220174 16:28823426-28823448 GGCCACAGGCCCCAGGCAGGGGG - Exonic
1138781321 16:59791657-59791679 CCTCACATGGCCCTGGCAGGGGG - Intergenic
1141689718 16:85589211-85589233 TCTCCCATGCCCCAGGCAGGAGG - Intergenic
1142397017 16:89837767-89837789 ACTCACACGCCCCCCGCACGGGG - Intronic
1147109734 17:38253112-38253134 ACTCACTTGAACCCGGCAGGGGG + Intergenic
1148740988 17:49892463-49892485 GCTCAAATGCCACCTCCAGGAGG - Intergenic
1148906353 17:50914964-50914986 GCTCCCATGCCCCCAGCCTGCGG + Intergenic
1149660711 17:58332712-58332734 TCTCTCATGCCCTGGGCAGGTGG + Intergenic
1151763870 17:76122210-76122232 CCGCACAGGCCCCCGCCAGGCGG + Intergenic
1151917702 17:77130704-77130726 GCTCACTTGACCCCGGGAGAGGG - Intronic
1152729552 17:81962718-81962740 GTCCACATGGCCCCGGCCGGCGG - Intergenic
1152928241 17:83097694-83097716 GGTCAGATGCCCCCAGCAGATGG - Intergenic
1156840526 18:41605221-41605243 GCTCACATTCCCCATGGAGGCGG + Intergenic
1157553744 18:48599049-48599071 GCTCTCAGGCCCCCGTCGGGTGG - Intronic
1157815550 18:50727304-50727326 TGTCACATTCCCCCGGCAGTGGG - Intronic
1160374675 18:78402420-78402442 GCTCACAGGCCACCCCCAGGAGG + Intergenic
1161409039 19:4106493-4106515 AATCACATGCACCCGGGAGGCGG - Intronic
1161509800 19:4663926-4663948 GCTCAGATCCCCCCGGCTGAAGG - Intronic
1161851111 19:6738618-6738640 GCTCAGAAGCCACCAGCAGGTGG + Intronic
1162106608 19:8373686-8373708 TCTCCCCTGACCCCGGCAGGAGG + Exonic
1163251333 19:16127971-16127993 GCTCAGATGCGCCCGGCGGCTGG + Intronic
1163690115 19:18734013-18734035 AATCACTTGACCCCGGCAGGTGG + Intronic
1164715117 19:30385342-30385364 GCACCCAGGCCCCAGGCAGGTGG - Intronic
1164862195 19:31570538-31570560 GGCCACATGCCCCTGGCGGGAGG + Intergenic
1165113312 19:33514384-33514406 GCTCATGTGACCCTGGCAGGAGG - Intronic
1165570164 19:36769173-36769195 ACTCACTTGAACCCGGCAGGCGG + Intronic
1166191349 19:41178947-41178969 GGTCACATGACCCGGGAAGGTGG + Intergenic
1166282733 19:41805868-41805890 CCTCACCTGCCCTCTGCAGGAGG + Intronic
1167645245 19:50702276-50702298 GCTCAGATGACCCTGTCAGGAGG - Intronic
1168120324 19:54248424-54248446 ACTCACAAGACCCGGGCAGGTGG + Intronic
1168406245 19:56112073-56112095 GGTCCCATGCCCCCGCCATGAGG - Intronic
925036612 2:692158-692180 CCACACAAGCCCCAGGCAGGAGG - Intergenic
925267163 2:2574330-2574352 GATCACCTGCCCAAGGCAGGTGG + Intergenic
927874698 2:26647601-26647623 TCCCACATGCCCCAGGGAGGGGG + Intergenic
929317471 2:40497187-40497209 TTTCACATGCCCCAAGCAGGAGG - Intronic
929856562 2:45643023-45643045 ATCCACATGCCCCAGGCAGGCGG - Intergenic
931025866 2:58113220-58113242 ACTCACATGAACCCGGGAGGCGG + Intronic
932303927 2:70688029-70688051 TCTCACATGCAGCCTGCAGGTGG + Exonic
932381637 2:71289244-71289266 ACTCACATGAACCCGGGAGGCGG - Intronic
932830668 2:74986650-74986672 GATCACTTGAACCCGGCAGGTGG - Intergenic
933049955 2:77590755-77590777 GCGCACAAGCCCACGGCGGGTGG - Intronic
934118933 2:88822099-88822121 GCTCACCTGCGCCAGGCATGGGG + Intergenic
934567066 2:95346886-95346908 GCTCACATGCCCCCGGCAGGCGG - Intronic
935237549 2:101151285-101151307 GCTCACATCTCCCCGGCCGCCGG + Intronic
938407459 2:131040424-131040446 GCTCACATGCTCCAGGAAGCAGG - Exonic
938817499 2:134918953-134918975 GCTCTCGTGCCGCCAGCAGGCGG + Exonic
944518956 2:200544366-200544388 GATCACTTGAACCCGGCAGGTGG - Intronic
945818183 2:214631278-214631300 GCCCACATGCCCCTGCCAGGAGG + Intergenic
946201420 2:218072904-218072926 GCTCAGATGGCATCGGCAGGAGG - Intronic
946763999 2:223023215-223023237 ACTCACATGCCCACAGCAGCAGG + Intergenic
947524222 2:230868688-230868710 GGTCTCAGGCCCTCGGCAGGAGG + Intronic
948696723 2:239736575-239736597 GCTCCGATGCCCACGGGAGGAGG + Intergenic
1172364444 20:34338181-34338203 GATCACGTGACCCCGGGAGGTGG + Intergenic
1172952389 20:38730401-38730423 TCTCACATGCCCCTTGCAAGCGG - Intergenic
1172966661 20:38840320-38840342 ACTCACATTCCCCAGGCAGGTGG - Intronic
1174059593 20:47823267-47823289 GCTCACAGGTCCCAGGAAGGTGG + Intergenic
1174578301 20:51553224-51553246 GCTCACAGGCTCCCGGCAGGTGG - Intronic
1174615101 20:51829383-51829405 GCTCACTTGAACCCAGCAGGTGG - Intergenic
1175945165 20:62555281-62555303 GCTCTCAGGCCCCCGACAGGTGG - Intronic
1175963471 20:62648494-62648516 GCTCCCATGCAGCCGGCAGGTGG - Intronic
1176102452 20:63370633-63370655 GCTCAGAAGCCCAAGGCAGGTGG - Intronic
1183567678 22:38627689-38627711 GTTCACATGAACCCGGGAGGCGG - Intronic
1183812519 22:40269218-40269240 GCTCACTTGAACCCGGGAGGTGG - Intronic
1184529666 22:45047002-45047024 GCTCACATGCCTGGAGCAGGGGG - Intergenic
1184980008 22:48089387-48089409 GCCCCCATTCCCCCTGCAGGTGG - Intergenic
950782804 3:15407101-15407123 GCTCACTTGAACCCGGGAGGTGG - Intronic
954068517 3:48125973-48125995 GCTCAGATGCCACCCCCAGGAGG - Intergenic
954574751 3:51669848-51669870 GCTTAGGTGCCCCAGGCAGGCGG - Intronic
960404870 3:117247346-117247368 GCTCACATGCCACCTACATGGGG + Intergenic
961688206 3:128650299-128650321 GCTGACGTGGCCCAGGCAGGAGG + Intronic
969538066 4:7768856-7768878 CAGCACATGCCCTCGGCAGGGGG + Exonic
971030935 4:22635892-22635914 GCTCACCTGACCCCTGCTGGCGG - Intergenic
971140670 4:23921597-23921619 GCTCACACCCCACAGGCAGGTGG + Intergenic
975991477 4:80263818-80263840 GCTGAGATGTCCCCAGCAGGGGG + Intergenic
977607382 4:98996089-98996111 GCCCACATGGCCGCGGCGGGTGG - Intronic
982712176 4:158768865-158768887 GCTCACGTAACCCCGGCGGGAGG - Intergenic
985412109 4:189695909-189695931 GCCCACAAGCCCCGGGCAGTGGG - Intergenic
988264020 5:28927735-28927757 GCTCAGGTGCCGCCGGCTGGCGG + Intergenic
990604459 5:57395034-57395056 CCTCATTTGCCCCCGTCAGGAGG + Intergenic
998127452 5:139634211-139634233 GCTGACAGGCCCCAGGCATGGGG - Intergenic
998438079 5:142130985-142131007 TCTCTCATGCCCCAGGCTGGAGG + Intronic
999862998 5:155668529-155668551 GCTCACGTGCCTGGGGCAGGGGG - Intergenic
1002033966 5:176451282-176451304 GCTCACTTGAACCCGGGAGGTGG + Intronic
1002987930 6:2209408-2209430 GCTCACCTTCCCCCTGCAGGGGG + Intronic
1006439081 6:34042177-34042199 GATCACATGAACCCGGGAGGCGG + Intronic
1007760019 6:44127982-44128004 GCGCACCTGCACCGGGCAGGTGG - Intronic
1009925677 6:70117933-70117955 GCTGACATGCCCTCTGCAGTTGG + Intronic
1015559639 6:134500798-134500820 GATCACTTGAGCCCGGCAGGCGG + Intergenic
1019858656 7:3635791-3635813 GATCACCTGACCCCGGGAGGTGG - Intronic
1020154749 7:5713513-5713535 GCTCACACCCACCAGGCAGGAGG + Intronic
1021337869 7:19425824-19425846 GATCACTTGAACCCGGCAGGTGG + Intergenic
1023891914 7:44398863-44398885 GCCCACATTCCCCCAGCAGCAGG - Intronic
1029133136 7:98349100-98349122 GGTCACATGTCCCCAGCAAGGGG - Intronic
1029458703 7:100683629-100683651 GCCCCCCTGCCCCCTGCAGGTGG - Exonic
1034678762 7:152911898-152911920 GCTCTCAGGGCCCTGGCAGGAGG + Intergenic
1034816013 7:154172685-154172707 GATCACTTGCCCCCAGGAGGCGG - Intronic
1035171972 7:157021890-157021912 GCTCCCAAGACCCCGGCGGGAGG - Intergenic
1035514993 8:225132-225154 AATCACATGAACCCGGCAGGCGG + Intergenic
1036296635 8:7543075-7543097 CCTCACATGTCCCCTGGAGGTGG + Intergenic
1036325931 8:7777944-7777966 CCTCACATGTCCCCTGGAGGTGG - Intergenic
1036693661 8:10960725-10960747 CCTCACATTCCCAAGGCAGGAGG + Intronic
1040927791 8:52702627-52702649 GATCACTCGCACCCGGCAGGTGG + Intronic
1043361806 8:79481370-79481392 GGTCTCATGCCCCACGCAGGAGG + Intergenic
1049192312 8:141295158-141295180 GCTCACATGCCTCCAGCCTGTGG - Intronic
1049734680 8:144198718-144198740 TCTCCCATGCCCCAGGCATGAGG - Intronic
1058711331 9:107681939-107681961 GCTCCCTTGCTCCCGGGAGGAGG - Intergenic
1059111828 9:111565035-111565057 AATCACATGAACCCGGCAGGCGG + Intronic
1059394810 9:114027718-114027740 GCTCCCCTGGCCCAGGCAGGTGG - Intronic
1060793817 9:126501925-126501947 GGTCACATCGCCCCAGCAGGAGG - Intronic
1061898945 9:133663147-133663169 GCTCACCAGGCCCAGGCAGGAGG - Intergenic
1062305477 9:135904310-135904332 GATCACTTGAGCCCGGCAGGCGG + Intronic
1203670485 Un_KI270755v1:7072-7094 GCCCACAAGCCCCGGGCAGTGGG + Intergenic
1187874212 X:23790297-23790319 GCTCACGTGAACCCGGGAGGTGG + Intergenic
1191639784 X:63417576-63417598 GCTCACTTGAACCCGGGAGGCGG - Intergenic
1194821339 X:98510447-98510469 GCTCCCATTCCCCAGCCAGGTGG - Intergenic
1197454824 X:126665939-126665961 GCACAGATGCCCTCTGCAGGGGG + Intergenic
1198216331 X:134558411-134558433 GCTCACTTGGCCTGGGCAGGTGG - Intergenic
1202377876 Y:24255078-24255100 TCCCACATGCCCCCATCAGGAGG - Intergenic
1202492906 Y:25415043-25415065 TCCCACATGCCCCCATCAGGAGG + Intergenic