ID: 934568247

View in Genome Browser
Species Human (GRCh38)
Location 2:95352500-95352522
Sequence GGGGCTGCTAAGTCCAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934568247 Original CRISPR GGGGCTGCTAAGTCCAGTGC TGG (reversed) Intronic
900290483 1:1921632-1921654 AGGGCTGCAAAGCCCAGGGCAGG - Intergenic
900678389 1:3902356-3902378 GTGGCTGCGCAGTCCAGGGCTGG + Intergenic
900737055 1:4305559-4305581 GGGGGTGCTCAGACCAATGCAGG + Intergenic
900767401 1:4514392-4514414 GGGGCTGTTAAGGCCAGGGTGGG - Intergenic
900959015 1:5907550-5907572 GGAGGTGCTCAGTCCAGTGCTGG - Intronic
901203004 1:7477188-7477210 GCGGCTTCTAAGACCAGGGCTGG - Intronic
901818559 1:11810428-11810450 GGTGCTGCTATGGCCAGTGGGGG - Intronic
903258787 1:22120089-22120111 GGTGCTGCTTCGTCAAGTGCCGG - Exonic
912430086 1:109624346-109624368 GGGGCTGCTGAGCCCAGGGAGGG + Intronic
914318965 1:146541151-146541173 TGAGCTGCTAAGTCCACTTCTGG - Intergenic
914495392 1:148192206-148192228 TGAGCTGCTAAGTCCACTTCTGG + Intergenic
916212773 1:162372304-162372326 TGTGCTGCTCAGTACAGTGCTGG + Intronic
917619598 1:176782611-176782633 TGGGATTCTAAGTCCAGTGTTGG + Intronic
922725577 1:227921560-227921582 GGTGCTGCTATGTGGAGTGCAGG - Exonic
924354988 1:243163333-243163355 GTGGCTGCAAAGGCCAGTGTGGG - Intronic
1066261857 10:33737087-33737109 GTGTGTGCTAAGCCCAGTGCAGG + Intergenic
1068023588 10:51616246-51616268 GGATCTGCTAGCTCCAGTGCAGG - Intronic
1070809531 10:79290660-79290682 GGGGCTGCGCAGCCCAGTGAAGG - Intronic
1070819401 10:79346205-79346227 GGGGCAGGTCAGTCCAGAGCTGG + Intergenic
1072629527 10:97135705-97135727 GGGGCTGCTCAGTCAAGTGGAGG + Intronic
1073147049 10:101287986-101288008 GGGGCTGCTGGGTCCACTTCGGG - Intergenic
1074291484 10:112140868-112140890 GTGGCTGGTAAGTGCAGAGCAGG + Intergenic
1076879209 10:133231619-133231641 GGGGCTGCAAAGGTCAGGGCAGG + Intergenic
1077920337 11:6637266-6637288 GGAGCTGCTAAGTGCCTTGCAGG + Intronic
1078194230 11:9121618-9121640 GGGGCTGCTGAGCCCAGTGTGGG + Intronic
1082005741 11:47418109-47418131 GGGGCGGCCAAGTCCAGGGCAGG + Intergenic
1083315480 11:61812470-61812492 GGTGCTGCTCAGTGCAGTTCAGG - Exonic
1085530366 11:77189053-77189075 GCGGCTGCTGAGCCCAGAGCAGG + Intronic
1091193537 11:133713898-133713920 GTGGCTGGTAAGTGCAGTGCTGG - Intergenic
1096776140 12:53965505-53965527 GGGGCTGTGAAGGCCAGTTCAGG + Intergenic
1096789496 12:54036028-54036050 GGAGCTGCATAGACCAGTGCTGG + Intronic
1102091648 12:110194739-110194761 GGAGCTGTTAAGTCATGTGCTGG - Intronic
1103200287 12:119082632-119082654 GGGGCTGCTGGGTGCAGGGCTGG - Intronic
1104480278 12:129101453-129101475 GGGGCTGCAAATTCAAGTGCTGG - Intronic
1104638423 12:130452007-130452029 GGGGCTGCTGAGCCCTGTCCTGG + Intronic
1104975435 12:132549994-132550016 GGGGAGGCTGAGTCCAGTCCAGG + Intronic
1109276202 13:60306741-60306763 GGGGCCCCTAAGCCCAGTCCAGG + Intergenic
1113922451 13:113920760-113920782 GTGGCTGCTGAGTGCAGAGCTGG + Intergenic
1114674594 14:24431825-24431847 GGAGCTGCTGAGTCTGGTGCAGG + Exonic
1120781953 14:88493480-88493502 GGGGCAGCTAAGTCCAGAGAAGG + Intronic
1121109022 14:91299890-91299912 GGTGCTGCTATGTGCAGGGCCGG + Intronic
1122929930 14:104928478-104928500 GGGGCTGCCTGGTCCAGAGCAGG - Intronic
1123048748 14:105530695-105530717 GGGGCTGCCAGCTCCCGTGCTGG - Intergenic
1123563108 15:21514904-21514926 GGGGCTGCAATGTCCATGGCAGG + Intergenic
1123599357 15:21952187-21952209 GGGGCTGCAATGTCCATGGCAGG + Intergenic
1127961735 15:63895363-63895385 GGGGCTGCAGAGTCCAGGCCAGG - Intergenic
1128777888 15:70337566-70337588 GGGACTGCAAAGGCCAGAGCAGG - Intergenic
1131090135 15:89618028-89618050 GGGTCTGATAACACCAGTGCTGG - Intronic
1132642507 16:984264-984286 GGGGCTGCTGAGTGCCGTGTGGG - Intronic
1133999275 16:10770096-10770118 GAGGCTGCAAAGCCCAGGGCAGG + Intronic
1134188180 16:12100530-12100552 GGGGCTGCTGTGTCCAGATCGGG + Intronic
1134605722 16:15569667-15569689 AGGGGTGCTAAGTCCACTTCTGG + Intronic
1136720613 16:32316894-32316916 GGGTCTGCTAAGTCGGGTGGGGG + Intergenic
1136838993 16:33523176-33523198 GGGTCTGCTAAGTCGGGTGGGGG + Intergenic
1138207231 16:55133898-55133920 TGGGCTTCTGAGTCCAGTGTGGG - Intergenic
1141933508 16:87220586-87220608 GAGGCTTCTAAGTCATGTGCTGG - Intronic
1142112946 16:88341786-88341808 GGGGCTGCCATGCCCAGTGGGGG + Intergenic
1142265269 16:89061553-89061575 GGGGCAGCTGAGACCAGGGCGGG - Intergenic
1203005819 16_KI270728v1_random:200876-200898 GGGTCTGCTAAGTCGGGTGGGGG - Intergenic
1203137369 16_KI270728v1_random:1736996-1737018 GGGTCTGCTAAGTCGGGTGGGGG - Intergenic
1203149156 16_KI270728v1_random:1823463-1823485 GGGTCTGCTAAGTCGGGTGGGGG + Intergenic
1144039095 17:11392613-11392635 GTGGCTGCAAAGTCCAGGACTGG - Intronic
1144328671 17:14205610-14205632 GGGGCTGGTTATTCCTGTGCAGG - Intronic
1146055466 17:29578590-29578612 GGGACTGCTGAGGCCAGTGAGGG + Intronic
1150838040 17:68582394-68582416 GAGGCAGCTAAGTCAAGTGAGGG + Intronic
1150842083 17:68618053-68618075 GGGGGTGCTCAGTCCAGGGTTGG + Intergenic
1151705033 17:75762966-75762988 GGAGCTGCTGAGTGCAGGGCGGG + Intronic
1152468176 17:80477104-80477126 GGCGCCACTAAGTCCAGAGCGGG + Intronic
1154126175 18:11694381-11694403 TGGGGTGCTACGTCCTGTGCAGG - Intronic
1156449661 18:37259683-37259705 GGGGCAGCCAAGTCCTGTGCTGG + Intronic
1157577442 18:48752992-48753014 GGGGCTGCTTAGTCGAGCGATGG - Intronic
1158376871 18:56881159-56881181 GGGGCAGCTAAGTCTATTGAAGG - Intronic
1160222262 18:76985878-76985900 GGGGCTGATGAGGCCAGGGCAGG - Intronic
1160535145 18:79587580-79587602 GGGGCTGCAGAGGCCTGTGCGGG + Intergenic
1160558133 18:79739371-79739393 AGGGGTGCTAACTCCAGTCCTGG - Intronic
1164310393 19:24041235-24041257 GGGGCTCCCAAGTGCAGTGGGGG - Intronic
1164538365 19:29103768-29103790 GGGGTTGGGAAGTCAAGTGCTGG - Intergenic
1166789862 19:45392272-45392294 GGGGCTGCTGACACCAGTGCTGG - Exonic
1166999571 19:46737978-46738000 TGGGCTGCCAGGTCCCGTGCTGG - Intronic
1167331408 19:48858868-48858890 TGGGCTCCTGACTCCAGTGCTGG + Exonic
1167461074 19:49625052-49625074 GGGGCTGCCAAGTGCCGGGCTGG + Intronic
1167471695 19:49679303-49679325 GGGGCTCCTGAGTCCAAGGCAGG + Intronic
1167659865 19:50790334-50790356 GGGGGTGCTGAGTGCAGGGCTGG + Intergenic
924967996 2:95871-95893 AGGGCTGCTTGGTCCAGAGCTGG - Intergenic
925409073 2:3628419-3628441 GGTGCTGTTAAGACCAGTGCAGG - Intronic
927792448 2:26020819-26020841 TGGGATCCCAAGTCCAGTGCTGG - Intergenic
927982680 2:27384270-27384292 GTGACTGCTAAGCCCAGTTCAGG - Intronic
932563942 2:72894037-72894059 GGGGAGGCTGAGTCCAGGGCTGG - Intergenic
934568247 2:95352500-95352522 GGGGCTGCTAAGTCCAGTGCTGG - Intronic
945514727 2:210748985-210749007 GGGGCTGGTAGGTCCAGGACAGG + Intergenic
946448159 2:219757485-219757507 GGAGGTGCTAAGCCTAGTGCTGG + Intergenic
948178234 2:235960495-235960517 GGGTATGCTCGGTCCAGTGCAGG + Intronic
1171194561 20:23187111-23187133 GTGGCTGGCAGGTCCAGTGCAGG + Intergenic
1172186661 20:33035182-33035204 GGGACTGCTTAGGCCAGGGCTGG + Intronic
1176033861 20:63026943-63026965 GGGGCAGCTCAGCCGAGTGCAGG + Intergenic
1178286880 21:31333229-31333251 GGGGCTGCTGAGCCTAGTCCAGG + Intronic
1178528141 21:33350187-33350209 GGGGCTGTCCAGTGCAGTGCAGG + Intronic
1179335515 21:40448355-40448377 GGAGCTGCGATGTCCATTGCAGG - Intronic
1179614512 21:42573121-42573143 GGGGACACTAAGCCCAGTGCAGG - Intronic
1180552186 22:16549544-16549566 GGGTCTGCTAAGTCAGGTGGGGG - Intergenic
1180557708 22:16591380-16591402 GGGGCTGCGGAGTGCAGAGCAGG - Exonic
1180597424 22:16987933-16987955 GGGGCTACTATGGCCAGTGGGGG - Intronic
1181043351 22:20203291-20203313 GGGTCTGCTTTGTCCAGGGCTGG + Intergenic
1181332285 22:22102528-22102550 TCTGCTGCTAATTCCAGTGCAGG - Intergenic
1181466430 22:23113020-23113042 GGGGCTGCTATGCTCAGAGCAGG - Intronic
949873469 3:8608494-8608516 GAGGCTGCAGGGTCCAGTGCTGG + Intergenic
950154823 3:10713587-10713609 AGGGCTGCTAAGTCCAGGGGAGG + Intergenic
951453327 3:22864053-22864075 GGACCTGCTAAGTCCAGGGGAGG + Intergenic
955026569 3:55173293-55173315 GGTGCTGCTAAGTTGGGTGCAGG + Intergenic
955520228 3:59768472-59768494 GGGCCACCTAAGTCCAGTGCTGG - Intronic
955597449 3:60607000-60607022 GAGGCTGCTCATTCCATTGCTGG + Intronic
961375405 3:126462159-126462181 TGGGCTGCTGAGTTCACTGCTGG + Exonic
962847619 3:139285801-139285823 GTGGCTGCCAAGGACAGTGCAGG + Intronic
963436309 3:145271858-145271880 GAGACTGCTAATTCCAGTGAAGG - Intergenic
967905007 3:194492078-194492100 GGGTCCACAAAGTCCAGTGCAGG + Intronic
970009532 4:11443998-11444020 GGGGCTGCCAAGACCAGTGAAGG - Intergenic
970658826 4:18261672-18261694 TGGGCTGCTTAGTCCATTTCTGG + Intergenic
979246815 4:118516303-118516325 GTGGCTGCAAAGGCCAGTGTGGG + Intergenic
981560951 4:146048096-146048118 GGGCCTGCTGAGCCAAGTGCGGG + Intergenic
985399786 4:189583044-189583066 GAGGCTGCTGTGTCCAGTGAAGG + Intergenic
986724237 5:10582278-10582300 GGGGCTGCAAAGTACGGAGCTGG + Intronic
997467005 5:134094852-134094874 GGGGCTGCCAGGGCCACTGCTGG + Intergenic
999125640 5:149243961-149243983 GGGGCTGCATAGCCCAGGGCTGG + Intronic
999264132 5:150255486-150255508 GTAGCTGCTAAGTCCCCTGCAGG - Intronic
1000993574 5:167935789-167935811 GGGGATGCCAAATACAGTGCTGG - Intronic
1002018555 5:176346668-176346690 GGGGCCTCTTAGGCCAGTGCCGG - Exonic
1004034678 6:11912075-11912097 GGGGCTGCTAATTACCGAGCTGG - Intergenic
1005968323 6:30742698-30742720 GGGGGTGCTTAGTCCGTTGCGGG - Exonic
1006108531 6:31730461-31730483 GGGGCTGCTATGTTTCGTGCCGG - Intronic
1007321963 6:41034074-41034096 GGGGCTGGTAAGCCCTGTGGTGG - Exonic
1011249844 6:85359610-85359632 GGGGCTGCTAAGTCCCCTTCGGG + Intergenic
1011567664 6:88694922-88694944 GAGGCTGAGAAGTCCAGAGCAGG - Intronic
1016102773 6:140123185-140123207 GGATCAGATAAGTCCAGTGCTGG - Intergenic
1019572466 7:1719425-1719447 GGGGCTGCCTAGCCCAGAGCCGG - Intronic
1020109035 7:5437825-5437847 GGGGCCACTGAGTCCAGTGTGGG + Intronic
1026049177 7:66930525-66930547 TGGGCTGCTAAGTCCAAAGCTGG - Intronic
1031402250 7:121339284-121339306 GGTGCTGCTATGTCCGTTGCAGG + Exonic
1032237264 7:130136144-130136166 GGAGCTGCTGAGCCCTGTGCAGG + Intergenic
1033591048 7:142808843-142808865 GGGGGTTCTGAGCCCAGTGCTGG + Intergenic
1034619609 7:152446625-152446647 GGGGCTGCGGAGTGCAGAGCAGG + Intergenic
1034931492 7:155167199-155167221 GAGGCTGCTGGCTCCAGTGCAGG + Intergenic
1035624704 8:1062171-1062193 GGGGCTGCTTGGTGCAGAGCAGG - Intergenic
1037629195 8:20637645-20637667 GGGCCTGCTGAGGCCATTGCGGG - Intergenic
1038615148 8:29086979-29087001 GGTGCTGCTAAGTCCAGCACTGG + Intronic
1042480126 8:69293191-69293213 GGGGCCCCTTAGTCCAGTGAGGG - Intergenic
1045293232 8:100851553-100851575 GGGGCTGCTGTGGGCAGTGCAGG - Intergenic
1048906463 8:139093873-139093895 GGGGCTGCTAAGGACTCTGCTGG + Intergenic
1053076963 9:35141537-35141559 TGGGCTGCCAGGTCCAGGGCCGG + Intergenic
1058910885 9:109518841-109518863 AGGGCTGATAAGGTCAGTGCAGG + Intergenic
1059683233 9:116606518-116606540 CTGGCAGCCAAGTCCAGTGCTGG - Intronic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1060485283 9:124042452-124042474 GGGGCAGGTGGGTCCAGTGCTGG - Intergenic
1061003628 9:127916445-127916467 GGGGCTGCTGTCTCCAGGGCTGG + Exonic
1062142399 9:134966864-134966886 GTGGCTGCTAAATGCAGGGCAGG - Intergenic
1062424940 9:136501844-136501866 GGTGCTGCTGAGTCCACTGCCGG + Exonic
1187525103 X:20047202-20047224 CAGGGTGCTCAGTCCAGTGCAGG - Intronic
1195676276 X:107509398-107509420 GTGGCTGGCAAGTCCAGTGCTGG + Intergenic
1200134835 X:153869849-153869871 TGGACTGCCAAGTCCAGGGCAGG - Exonic
1200162418 X:154016355-154016377 GGGGCTGCAGAGTGCACTGCGGG - Intronic