ID: 934572844

View in Genome Browser
Species Human (GRCh38)
Location 2:95383321-95383343
Sequence AGTTCTCTGCAGGCTCTACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934572836_934572844 14 Left 934572836 2:95383284-95383306 CCTGTCAGAAGGTAGGTGGCACG 0: 1
1: 0
2: 1
3: 18
4: 172
Right 934572844 2:95383321-95383343 AGTTCTCTGCAGGCTCTACACGG 0: 1
1: 0
2: 0
3: 15
4: 196
934572833_934572844 22 Left 934572833 2:95383276-95383298 CCTGGAGGCCTGTCAGAAGGTAG 0: 1
1: 0
2: 0
3: 21
4: 166
Right 934572844 2:95383321-95383343 AGTTCTCTGCAGGCTCTACACGG 0: 1
1: 0
2: 0
3: 15
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934572844 Original CRISPR AGTTCTCTGCAGGCTCTACA CGG Intronic
900300876 1:1976499-1976521 AGGGTTCTGCAGGCTGTACAGGG - Intronic
902400553 1:16154823-16154845 AGGTTTCCGCAGGCTCCACAAGG - Intronic
905211046 1:36374380-36374402 CTTTCTCTGCAGGCTCTCCTGGG + Intronic
906121295 1:43393226-43393248 AGTTCTCTGAAGGCTCCACTGGG - Intronic
906460078 1:46030207-46030229 AGTTCTCTTCCTGCTCTCCAAGG + Exonic
906656972 1:47555483-47555505 CGGTCTCAGCAGGCTCCACAAGG - Intergenic
907865901 1:58398788-58398810 AGTTCTTTACTGGCTATACAGGG + Intronic
910705690 1:90127146-90127168 ACAGTTCTGCAGGCTCTACAGGG - Intergenic
916675359 1:167060688-167060710 AGTTCTCTCCTGCCTCCACAGGG - Intronic
918869150 1:189945079-189945101 ATTTCACTGAAGGCTTTACAAGG - Intergenic
919615510 1:199803562-199803584 AGTTCTCAGCATGCCCTTCAGGG + Intergenic
924533305 1:244911997-244912019 AGTTCTCTGCAGACCCACCACGG - Intergenic
1062873147 10:924167-924189 AGCTCTCTGCAGCCTCGACCTGG - Intronic
1063217552 10:3938080-3938102 ACTTCTCTGCAGGCGCTAAGGGG + Intergenic
1063954182 10:11250875-11250897 TGGCCTCTGCAGGCTCTCCATGG + Intronic
1064488747 10:15827043-15827065 AGCTCACTGCAGCCTCTAAATGG - Intronic
1067753629 10:48987453-48987475 AGTTCTCTGCAGGCCCCAGAGGG - Intergenic
1068337739 10:55659447-55659469 GTTCCTCTGCAGGCTCTAAAAGG + Intergenic
1069186956 10:65435683-65435705 ATCTCTCTGCAGTCTCTACCAGG + Intergenic
1072797672 10:98368380-98368402 AGCCATCTGCACGCTCTACAGGG + Intergenic
1074800118 10:116991372-116991394 ATGGCTCTGCAGGCTCTACAAGG + Intronic
1075869941 10:125764521-125764543 AGCTCCCTGCAGGCCCTCCATGG + Intergenic
1076206944 10:128611246-128611268 AGCTCACTGCAGGCTCTAACTGG + Intergenic
1077097824 11:806561-806583 AGATCCCTCCAGGCCCTACATGG - Intronic
1077968813 11:7165939-7165961 AGCTCTCTGCAATCTCTAAAGGG + Intergenic
1079301056 11:19279190-19279212 ACTTCTCTGCTGGCCCTACTTGG + Intergenic
1080267038 11:30412555-30412577 AGTTCTCCACAGGCTTTACTTGG - Intronic
1081659080 11:44876987-44877009 CGTCCGCTGCAGGCTCTGCAGGG - Intronic
1081759686 11:45568596-45568618 AGGTTCCTGTAGGCTCTACATGG - Intergenic
1083556992 11:63637545-63637567 GATTCTCTGCAGCTTCTACAAGG + Intronic
1084486895 11:69453444-69453466 AGTTCCCTGCAGGGTCTCCCGGG - Intergenic
1084643876 11:70443115-70443137 AGGGTTCTGCAGGCTGTACAGGG + Intergenic
1084860345 11:72013997-72014019 AGTGCTCTGGAGACTCTGCAGGG - Exonic
1087823240 11:102734941-102734963 AGTTGTTTGGAGGCACTACATGG - Intergenic
1087954318 11:104266128-104266150 AGTTCTGTGAAGACTCTAAATGG - Intergenic
1088823776 11:113476846-113476868 ATTTGCCTGCAGGCTCTATAGGG + Intergenic
1089649654 11:119904456-119904478 ACTTCTCTGCAGTCTATACTGGG + Intergenic
1090359047 11:126160211-126160233 CTTTCTCTGCAGGCCCTGCACGG + Intergenic
1090913767 11:131144523-131144545 AGCTCTGTCCAGGCTCAACAGGG - Intergenic
1090959081 11:131539777-131539799 AGTGCACTGCAGGCTCTGCCTGG - Intronic
1092458219 12:8663816-8663838 AGTTCACTGCAGGCTTGACCTGG + Intergenic
1094051845 12:26228613-26228635 AGTTCTCTGCTGGCTGTACTGGG + Intronic
1098221075 12:68270496-68270518 AGTCATCTGCAGGCTTGACAGGG + Intergenic
1101137009 12:101754134-101754156 AGTTCTCTGAAGGCCATGCATGG + Intronic
1102927002 12:116833920-116833942 CGTTCTCTACAGCCTCTGCAAGG + Exonic
1103802453 12:123547987-123548009 AGCTCTCTGCAGCCTCAACCTGG + Intergenic
1104702983 12:130921357-130921379 ACAGCTCTGCAGGCTCTACAGGG + Intergenic
1106790520 13:33151276-33151298 ATGGCTCTGCAGGCTGTACAAGG + Intronic
1107388510 13:39939328-39939350 ATTTCTCTGCAGTGACTACATGG + Intergenic
1109827693 13:67744028-67744050 AGCTCACTGCAGCCTCTACCTGG + Intergenic
1110335213 13:74321997-74322019 TGTCCTCTTCAGGCTCTCCATGG + Intergenic
1110443986 13:75556196-75556218 ACTTCACTGCAGGCTCAATATGG - Intronic
1112073781 13:95885315-95885337 AGTTCTCTCAAGGCTCAACAAGG + Intronic
1112599442 13:100840615-100840637 TCCTCTCTGCAGGCTCTAGAAGG - Intergenic
1113579194 13:111416955-111416977 AGTTCCCTGCAGGCTCAGGAAGG + Intergenic
1119164585 14:72481445-72481467 AGATCTCTGCAGGCTGCCCAAGG + Intronic
1119624652 14:76162173-76162195 AGTTCTCTCAAGGCTCGACTAGG + Intronic
1121571610 14:94950865-94950887 AGATCTCTGTTGGCTCTGCAAGG + Intergenic
1122121549 14:99556340-99556362 AGTTCACTGCAACCTCAACAGGG - Intronic
1122660418 14:103291108-103291130 AATTCTCTTAAGGCTCTACCAGG + Intergenic
1124920670 15:34023107-34023129 AGTTCACTGCAGCCTCTGCCTGG - Intronic
1132838321 16:1965774-1965796 AGTGCTCTGCTGGCTCCACCTGG - Intergenic
1134454331 16:14383202-14383224 AGCTCACTGCAGCCTCTACCTGG - Intergenic
1136996830 16:35196315-35196337 AGTCCTCTGAAGCCTCTAGAAGG + Intergenic
1138924648 16:61576395-61576417 AGTTCTCTGAAGGTTAGACATGG + Intergenic
1139726050 16:68899562-68899584 AGATCTGTACTGGCTCTACATGG - Intronic
1140801683 16:78494248-78494270 TGTTCTCTGCAGGAACTAGACGG - Intronic
1141239775 16:82254759-82254781 ACTTCTTTGGAGTCTCTACAAGG + Intergenic
1142920734 17:3183010-3183032 AGTTCTCAGCAGCCTCAGCAGGG - Intergenic
1144780608 17:17806618-17806640 AGTTGGCTGCAGGCTCTGCTGGG + Intronic
1147261321 17:39211049-39211071 GCTTCTCTCCAGGCTCTGCAGGG - Exonic
1148920597 17:51029048-51029070 AGTTCCCTAAAGGCTCTAAAGGG - Intronic
1149005644 17:51802522-51802544 TGTACTCTGCAGGCTCTGCTTGG + Intronic
1150864949 17:68839886-68839908 ATTCCTCTTCAGGCTCTTCAGGG - Intergenic
1151232664 17:72695864-72695886 TGCTCTCTGCAGGCTCTGGAAGG - Intronic
1151746717 17:76015454-76015476 GGTTCTGTGCAGCCTCTACGGGG - Exonic
1154247611 18:12713630-12713652 TGTTCTCTGCAGACTCTACTTGG + Intronic
1156116989 18:33797559-33797581 AGACCTCTGCAGACTCTACTTGG + Intergenic
1156520578 18:37719515-37719537 AGTTCCCTGCAGGTTGAACATGG + Intergenic
1156968668 18:43128430-43128452 AGTTCTCTTCAGGCTCTGGAAGG + Intergenic
1161470054 19:4452689-4452711 AGTTCTGAGCAGGCCCCACAGGG - Intronic
1162588973 19:11578502-11578524 AGCTGTCTGCAGGCCCTCCACGG + Intronic
1163741296 19:19014724-19014746 AGTTCACTGCAGCCTCAACCTGG - Intronic
1164431674 19:28194252-28194274 AGATCTTTGCAGTCTCTCCAGGG - Intergenic
1164811276 19:31158441-31158463 AGTTCAATGCAGGCTTTACTGGG + Intergenic
1165712370 19:38021143-38021165 GGCTCTCTGCAGACTCTCCAGGG + Intronic
1166262586 19:41651392-41651414 AGGTATCTGCAGGCTCTATTAGG - Intronic
1166793874 19:45414610-45414632 ACTTCTCACCAGGCTCAACAAGG - Intronic
925064940 2:922359-922381 ACTCCTCTGCTGGCCCTACAGGG - Intergenic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925224542 2:2171957-2171979 ATTTCTCAGCATGCTCTATAAGG - Intronic
925282520 2:2694751-2694773 AGTTCGTTGCAGGATCTAGACGG + Intergenic
929305186 2:40353403-40353425 TGTTCTCCGCAGGCTCTCCAAGG + Intronic
929563879 2:42972843-42972865 AGTTATCTGAAGGCTCGACTGGG + Intergenic
929868656 2:45739456-45739478 AGTCCTCTGCAGGCTGTAAAAGG - Intronic
929959051 2:46482708-46482730 GGTTCTCTGCAGGCTCAGTATGG - Intronic
931086508 2:58836976-58836998 AGTTATCTGGTGGCTCAACAAGG - Intergenic
931962942 2:67502051-67502073 TATTCTCTGCAGGTTCTAGATGG - Intergenic
933371320 2:81419082-81419104 GCTGCTCTGCAGGCTTTACAGGG - Intergenic
933878605 2:86645561-86645583 ATTTCTTTCCAGGCTCTGCATGG + Intronic
934572844 2:95383321-95383343 AGTTCTCTGCAGGCTCTACACGG + Intronic
937850269 2:126626255-126626277 AATTCTCTGCAGACACTACCGGG + Intergenic
939201184 2:139036888-139036910 AGTACTCTCAAGACTCTACAAGG + Intergenic
940193795 2:151070484-151070506 AGTTCCCAACAGCCTCTACATGG + Intergenic
940371278 2:152903752-152903774 AGTCATCTGCAGGCTCAACTGGG - Intergenic
940374880 2:152946446-152946468 TGGGCTCTGCAGGCTGTACAAGG - Intergenic
942363368 2:175196400-175196422 AGTTCTGTGGAGCCTCTAGAAGG + Intergenic
943798574 2:192029277-192029299 AGTTCTCTCAAGGCTCAGCAGGG - Intronic
946305978 2:218857321-218857343 AATGCTCTGCAGGCACTACTGGG + Intergenic
946558869 2:220890406-220890428 AGTTCACTGCAGCCTCAACCTGG + Intergenic
947646731 2:231747675-231747697 AGTTCTTTCCATGGTCTACAAGG + Intronic
1169388915 20:5173717-5173739 GGCTCTCTGCAGGCTCTTCCAGG - Intronic
1169751318 20:8997527-8997549 AGAGTTCTGCAGGCTATACAAGG - Intergenic
1169957343 20:11119268-11119290 AGTCCTCTGCAGATTCTTCAAGG - Intergenic
1170367965 20:15618061-15618083 AGTTCTCTGATGTCTCTAGAAGG + Intronic
1171187089 20:23130236-23130258 AGCTCTCAGCAGCCTCAACAGGG - Intergenic
1171396410 20:24836727-24836749 ACATTTCTGCAGGCTGTACAGGG + Intergenic
1171488194 20:25498636-25498658 AGTCCCCTGCAGGCCCTTCATGG + Intronic
1172580141 20:36041005-36041027 AGCTCTCTGATGGCTCAACATGG + Intergenic
1172893738 20:38285063-38285085 AGTCATCTGAAGGCTCAACAGGG + Intronic
1174588321 20:51625538-51625560 AGGTCTGTGCAGTGTCTACATGG - Intronic
1175382530 20:58573664-58573686 TGGTCACTGCAGGCTCCACATGG - Intergenic
1178750760 21:35300709-35300731 AGTTCTCTGAAGGCTCAGCTAGG - Intronic
1179036132 21:37760082-37760104 AGTTATCTGAAGGCTCGACTGGG - Intronic
1180324355 22:11355663-11355685 TGTTCTCTGCAGACTCTGCGAGG - Intergenic
1180903960 22:19395364-19395386 AGTACTCTTCAGCCTCTACTGGG - Intronic
1183647811 22:39136589-39136611 AGTCATCTGCAGGCTCGACCAGG - Intronic
1184893705 22:47394737-47394759 CGCTCTCTGCAGGCTCTAGGGGG - Intergenic
950496740 3:13338333-13338355 AGTTCTGATCAGACTCTACAGGG - Intronic
950961158 3:17109350-17109372 AGTTCCTTGCAGGTTCTGCAGGG - Intergenic
952729799 3:36626811-36626833 AGTGCTCAGCTGGCTCTAAAGGG + Intergenic
953171240 3:40509759-40509781 TGGTCTCTTCAGACTCTACAAGG + Intronic
953880016 3:46686671-46686693 GGGTCTCTGCTGGCTCTACCAGG + Intronic
953914036 3:46906610-46906632 AGTTCTCTGGAGGTTCAAGAGGG + Intergenic
954134113 3:48574296-48574318 TATTCTCTGCAGGGTCTACCAGG - Exonic
955506939 3:59641839-59641861 CTTTCTCTGCAGGCTCCACATGG + Intergenic
958472549 3:94539227-94539249 CATTCTCTACAAGCTCTACAAGG - Intergenic
961990809 3:131188779-131188801 ACTTCACTGTAGGCTCTATAGGG - Intronic
962404861 3:135092227-135092249 AGGTCTCTGCAGCATCAACAAGG - Intronic
964639694 3:158895383-158895405 AGGTCTCTGCAGATTATACATGG + Intergenic
967028138 3:185582367-185582389 AGTTCTCTGAATGCTTTAAAAGG + Intergenic
967155762 3:186690488-186690510 AGTTCCCTGCTCACTCTACAAGG + Intergenic
967157047 3:186702647-186702669 AGTTCCCTGCTCACTCTACAGGG + Intergenic
974014966 4:56640765-56640787 AGTTATCTGAAGGCTCAACAGGG + Intergenic
976771332 4:88656321-88656343 ACAGTTCTGCAGGCTCTACAGGG + Intronic
978227944 4:106361166-106361188 TGTTCTAGGCATGCTCTACATGG + Intergenic
979677932 4:123430039-123430061 ACAGTTCTGCAGGCTCTACAGGG + Intergenic
979997607 4:127450902-127450924 TATTCTCTGCAGGCACTGCATGG - Intergenic
984118842 4:175716239-175716261 ATTTCTCTGCAAGCTGGACATGG - Intronic
984287270 4:177747210-177747232 ACTTCTCTGCCGCCTCTTCATGG + Intronic
984469835 4:180154539-180154561 AGTGCACTGCAGTCTCTGCAGGG - Intergenic
984501374 4:180563616-180563638 ATTTGAGTGCAGGCTCTACAGGG + Intergenic
984702726 4:182828470-182828492 ACTTCTCTGAAGACTCTACAGGG - Intergenic
989363518 5:40630267-40630289 AGGTCTCTGCAGGGAGTACAGGG + Intergenic
990772935 5:59270431-59270453 TGTTCTCTGCAAGCTCTGTAAGG - Intronic
995871573 5:116748963-116748985 AGATTTCTGCAGGCACTACTGGG - Intergenic
997379158 5:133423024-133423046 AGTGCTGTGCAGGCTCTGAACGG + Intronic
1001954640 5:175840685-175840707 AGTTCTTTGCAGGATTGACAGGG + Intronic
1003293776 6:4805758-4805780 TGTTCTCTCCAGGCTCTAAGTGG + Intronic
1005410413 6:25539346-25539368 AGTTCTCTGCATACACTAAATGG - Intronic
1005786289 6:29248938-29248960 AGTTCTGGGCTGGCTCTGCATGG - Intergenic
1006520987 6:34571123-34571145 AGAACTCGGCAGGCTATACAAGG - Intergenic
1007429878 6:41770682-41770704 AGCTCTCTGCAGGTTGGACATGG + Exonic
1008518480 6:52340648-52340670 AGTGGGCTGCAGGCTCTAGAGGG - Intergenic
1010302542 6:74279018-74279040 AGTTATCTGAAGGCTTGACAGGG + Intergenic
1014849563 6:126324872-126324894 AGATCTATGCAGGCTGTAAAAGG + Intergenic
1016744092 6:147559502-147559524 ACTTTTCTGCAGCTTCTACACGG - Intronic
1016828385 6:148409031-148409053 CTTTCTCTGCAGGCTCTTCTTGG + Intronic
1016953995 6:149608770-149608792 AGTTCTCCACACGCTCTCCAGGG - Intronic
1017932670 6:158972407-158972429 AGTTCTCTGCCAGCTCTGTAGGG - Intergenic
1019323972 7:428973-428995 CGGTGTCTGCAGGATCTACAAGG + Intergenic
1020074994 7:5252042-5252064 AGTTCACTGCAAGCTCTCCTGGG + Intergenic
1022852029 7:34273602-34273624 AGTTCTCTGCAGATTCTATATGG + Intergenic
1024631994 7:51256606-51256628 AGTGCTCTGGAGGCCCTACTAGG - Intronic
1026586754 7:71661764-71661786 AGTCCTCCCCAGACTCTACAGGG + Intronic
1028096947 7:86772621-86772643 AGCTGTCTGCAGTCTCTCCACGG + Intronic
1028413689 7:90558038-90558060 TGCTGTCTTCAGGCTCTACATGG - Intronic
1028752261 7:94394533-94394555 AGTGCTCTGCAGCCCCGACATGG - Intergenic
1032153592 7:129450760-129450782 CCTTCTCTGCAGCCTATACAGGG + Intronic
1032195492 7:129786100-129786122 AGTTCTCTGGAGGCTTTCCTGGG + Intergenic
1033498950 7:141928212-141928234 ACTTCTGTGCAGGTTCTAAAAGG - Exonic
1034850279 7:154486926-154486948 AAGTCTCTGCAGGCTCCACTGGG + Intronic
1035076042 7:156178343-156178365 ACATCTCTGCAGCCTCTGCAAGG + Intergenic
1037368421 8:18147328-18147350 AGCTCTCTTCAAGCTGTACAGGG - Intergenic
1038087749 8:24218598-24218620 AGTTCTCTGCCTGCTTTCCATGG + Intergenic
1038709538 8:29928912-29928934 AGTTTTCAGCAGCCTCTGCATGG - Intergenic
1038744235 8:30242704-30242726 AGTTATCTGCAGGCTTCACTGGG - Intergenic
1039614522 8:38944531-38944553 AGTGTTCTGCAGGCTCTATGGGG + Intronic
1040871761 8:52107054-52107076 ACAGCTCTGCAGGCTGTACATGG + Intergenic
1041509640 8:58641590-58641612 AGTACTATGCAGGTTCAACAAGG - Intronic
1041619116 8:59944567-59944589 AGTTCTCTCAAGGCTCAAGATGG - Intergenic
1041680652 8:60586223-60586245 AGTTCACTGCAGCCTCAACTGGG - Intronic
1042176846 8:66045768-66045790 AGGGCTCTGCAGGCTCCCCAGGG + Intronic
1042180731 8:66085070-66085092 TGTTCTCTGTATCCTCTACATGG + Intronic
1043325207 8:79041956-79041978 TGTGCTATGCAGGCTTTACATGG - Intergenic
1047178588 8:122566078-122566100 AGTTGTCTGAAGGCTCAATAGGG + Intergenic
1048419718 8:134265693-134265715 ACATCTCTGCAGGGTCCACAAGG - Intergenic
1049765872 8:144354958-144354980 AGTTCTGGGCAGGTTCTAGAAGG + Intronic
1050703439 9:8367136-8367158 AGTTCTCTGTATGCTTTAAAAGG + Intronic
1052002131 9:23296991-23297013 AGTTCTCTGGTGGCTCTCAATGG - Intergenic
1056942777 9:90969427-90969449 TGCTCACTGCAGGCTCTTCAGGG - Intergenic
1060541507 9:124433662-124433684 AGGTCTTTGCAAGCTCTCCAGGG + Intergenic
1061087698 9:128408959-128408981 ACTTCTCTCCAGGCTCTGCCAGG - Intergenic
1187758129 X:22548243-22548265 AGTTCTCTGGAGGCACTAATTGG - Intergenic
1188422486 X:30007199-30007221 AGTTGTCTGCAGGATCAATATGG + Intergenic
1188987193 X:36778488-36778510 AGGACTCTGCAGGTTGTACATGG - Intergenic
1189301081 X:39952840-39952862 TGTACTCTGCAGTCTCTTCAGGG - Intergenic
1190693158 X:52929044-52929066 AGTGGTCTGGAGGCTCTTCAAGG + Intronic
1195687509 X:107600238-107600260 AGTTCTTTTCCAGCTCTACACGG - Intronic
1195815808 X:108885976-108885998 ATAGTTCTGCAGGCTCTACAAGG - Intergenic
1197706096 X:129635599-129635621 TGTGCTCTGCGGGCTCTACATGG - Intergenic
1200755123 Y:6983984-6984006 AGTTCTCAGCATCCTCTGCAAGG + Intronic