ID: 934574038

View in Genome Browser
Species Human (GRCh38)
Location 2:95389390-95389412
Sequence GGCCCGAGGAAGCTCCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934574035_934574038 -10 Left 934574035 2:95389377-95389399 CCTTCAGTCCTTCGGCCCGAGGA No data
Right 934574038 2:95389390-95389412 GGCCCGAGGAAGCTCCTTGGAGG No data
934574024_934574038 29 Left 934574024 2:95389338-95389360 CCGCCAGGGGGCGACTGGGCCCC No data
Right 934574038 2:95389390-95389412 GGCCCGAGGAAGCTCCTTGGAGG No data
934574031_934574038 -1 Left 934574031 2:95389368-95389390 CCTCCAGCTCCTTCAGTCCTTCG No data
Right 934574038 2:95389390-95389412 GGCCCGAGGAAGCTCCTTGGAGG No data
934574029_934574038 8 Left 934574029 2:95389359-95389381 CCACCGCGGCCTCCAGCTCCTTC No data
Right 934574038 2:95389390-95389412 GGCCCGAGGAAGCTCCTTGGAGG No data
934574025_934574038 26 Left 934574025 2:95389341-95389363 CCAGGGGGCGACTGGGCCCCACC No data
Right 934574038 2:95389390-95389412 GGCCCGAGGAAGCTCCTTGGAGG No data
934574033_934574038 -4 Left 934574033 2:95389371-95389393 CCAGCTCCTTCAGTCCTTCGGCC No data
Right 934574038 2:95389390-95389412 GGCCCGAGGAAGCTCCTTGGAGG No data
934574028_934574038 9 Left 934574028 2:95389358-95389380 CCCACCGCGGCCTCCAGCTCCTT No data
Right 934574038 2:95389390-95389412 GGCCCGAGGAAGCTCCTTGGAGG No data
934574027_934574038 10 Left 934574027 2:95389357-95389379 CCCCACCGCGGCCTCCAGCTCCT No data
Right 934574038 2:95389390-95389412 GGCCCGAGGAAGCTCCTTGGAGG No data
934574030_934574038 5 Left 934574030 2:95389362-95389384 CCGCGGCCTCCAGCTCCTTCAGT No data
Right 934574038 2:95389390-95389412 GGCCCGAGGAAGCTCCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934574038 Original CRISPR GGCCCGAGGAAGCTCCTTGG AGG Intergenic
No off target data available for this crispr