ID: 934574251

View in Genome Browser
Species Human (GRCh38)
Location 2:95390524-95390546
Sequence TGGGCTGGCAGCAGTGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934574251_934574265 23 Left 934574251 2:95390524-95390546 CCAGAGGCACTGCTGCCAGCCCA No data
Right 934574265 2:95390570-95390592 AGCCCTCTGGCCCTCTCACCTGG No data
934574251_934574253 -10 Left 934574251 2:95390524-95390546 CCAGAGGCACTGCTGCCAGCCCA No data
Right 934574253 2:95390537-95390559 TGCCAGCCCAAAGTAGGTACTGG No data
934574251_934574254 -9 Left 934574251 2:95390524-95390546 CCAGAGGCACTGCTGCCAGCCCA No data
Right 934574254 2:95390538-95390560 GCCAGCCCAAAGTAGGTACTGGG No data
934574251_934574258 10 Left 934574251 2:95390524-95390546 CCAGAGGCACTGCTGCCAGCCCA No data
Right 934574258 2:95390557-95390579 TGGGCCCTCCCCCAGCCCTCTGG No data
934574251_934574266 24 Left 934574251 2:95390524-95390546 CCAGAGGCACTGCTGCCAGCCCA No data
Right 934574266 2:95390571-95390593 GCCCTCTGGCCCTCTCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934574251 Original CRISPR TGGGCTGGCAGCAGTGCCTC TGG (reversed) Intergenic
No off target data available for this crispr