ID: 934574480

View in Genome Browser
Species Human (GRCh38)
Location 2:95391518-95391540
Sequence CAGTAGAAGAGGGAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934574480_934574487 1 Left 934574480 2:95391518-95391540 CCAGCCTCCTCCCTCTTCTACTG No data
Right 934574487 2:95391542-95391564 CAGTAGCCCCCAGTCTCACTGGG No data
934574480_934574488 2 Left 934574480 2:95391518-95391540 CCAGCCTCCTCCCTCTTCTACTG No data
Right 934574488 2:95391543-95391565 AGTAGCCCCCAGTCTCACTGGGG No data
934574480_934574489 3 Left 934574480 2:95391518-95391540 CCAGCCTCCTCCCTCTTCTACTG No data
Right 934574489 2:95391544-95391566 GTAGCCCCCAGTCTCACTGGGGG No data
934574480_934574486 0 Left 934574480 2:95391518-95391540 CCAGCCTCCTCCCTCTTCTACTG No data
Right 934574486 2:95391541-95391563 CCAGTAGCCCCCAGTCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934574480 Original CRISPR CAGTAGAAGAGGGAGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr