ID: 934575966

View in Genome Browser
Species Human (GRCh38)
Location 2:95401859-95401881
Sequence AGGTGTCTGGGTGGGTGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1138
Summary {0: 1, 1: 4, 2: 5, 3: 103, 4: 1025}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934575966_934575979 24 Left 934575966 2:95401859-95401881 CCGCACCACCCACCCAGACACCT 0: 1
1: 4
2: 5
3: 103
4: 1025
Right 934575979 2:95401906-95401928 AAACTTCTCAAATAGAAGTCGGG 0: 3
1: 0
2: 0
3: 19
4: 288
934575966_934575978 23 Left 934575966 2:95401859-95401881 CCGCACCACCCACCCAGACACCT 0: 1
1: 4
2: 5
3: 103
4: 1025
Right 934575978 2:95401905-95401927 AAAACTTCTCAAATAGAAGTCGG 0: 3
1: 0
2: 1
3: 35
4: 363
934575966_934575974 -7 Left 934575966 2:95401859-95401881 CCGCACCACCCACCCAGACACCT 0: 1
1: 4
2: 5
3: 103
4: 1025
Right 934575974 2:95401875-95401897 GACACCTTTCCTCAGACGGGTGG 0: 1
1: 0
2: 1
3: 8
4: 68
934575966_934575980 30 Left 934575966 2:95401859-95401881 CCGCACCACCCACCCAGACACCT 0: 1
1: 4
2: 5
3: 103
4: 1025
Right 934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG 0: 1
1: 2
2: 0
3: 2
4: 93
934575966_934575973 -10 Left 934575966 2:95401859-95401881 CCGCACCACCCACCCAGACACCT 0: 1
1: 4
2: 5
3: 103
4: 1025
Right 934575973 2:95401872-95401894 CCAGACACCTTTCCTCAGACGGG 0: 1
1: 0
2: 4
3: 15
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934575966 Original CRISPR AGGTGTCTGGGTGGGTGGTG CGG (reversed) Intergenic
900095193 1:937397-937419 AGGTGACTGGGTGGGGGGGGGGG - Intronic
900143796 1:1149544-1149566 AGGTGGCTGAGTGGCTGGGGTGG + Intergenic
900238908 1:1605533-1605555 AGGTGTGAGGTGGGGTGGTGAGG + Intergenic
900304938 1:2001085-2001107 AGGTGCCTGGCTGGGTGAGGAGG + Intronic
900367278 1:2316338-2316360 AGGAGGCTGGGGGGCTGGTGTGG + Intergenic
900575835 1:3382099-3382121 AGCAGTCAGGGTGGGAGGTGAGG + Intronic
900581084 1:3409771-3409793 TTGTGTGTGGGTGTGTGGTGTGG + Intronic
900581091 1:3409825-3409847 TTGTGTGTGGGTGTGTGGTGTGG + Intronic
900613740 1:3555154-3555176 GGGTGGGTGGGTGGGTGGTGGGG - Intronic
900881792 1:5386861-5386883 TGGTGTCTGTGCGTGTGGTGTGG + Intergenic
900920965 1:5670067-5670089 AGGGGGTTGGGTGGGGGGTGAGG + Intergenic
900953465 1:5872899-5872921 TGGTGTGTGAGTGTGTGGTGTGG - Intronic
900998633 1:6136330-6136352 GGGTGTTGGGGTGGGTGGCGTGG - Intronic
901625441 1:10622105-10622127 AGGGGTGGAGGTGGGTGGTGGGG - Intronic
901755549 1:11439499-11439521 AGGTGTGTGTGTGTGTGGGGCGG + Intergenic
901961588 1:12830629-12830651 AGCTATTTGGGTGGCTGGTGTGG - Intronic
901968194 1:12885470-12885492 AGCTATTTGGGTGGCTGGTGTGG - Intronic
901976274 1:12946794-12946816 AGCTATTTGGGTGGCTGGTGTGG - Intronic
901983600 1:13055741-13055763 AGCTATTTGGGTGGCTGGTGTGG - Intronic
901985402 1:13071610-13071632 AGCTATTTGGGTGGCTGGTGTGG + Intronic
901996407 1:13155157-13155179 AGCTATTTGGGTGGCTGGTGTGG - Intergenic
901998225 1:13171080-13171102 AGCTATTTGGGTGGCTGGTGTGG + Intergenic
901998488 1:13173183-13173205 AGCTATTTGGGTGGCTGGTGTGG + Intergenic
902008898 1:13254976-13254998 AGCTATTTGGGTGGCTGGTGTGG + Intronic
902016980 1:13316310-13316332 AGCTATTTGGGTGGCTGGTGTGG + Intronic
902148085 1:14420473-14420495 AGGAGTGTGGGTGCATGGTGCGG - Intergenic
902397979 1:16142824-16142846 AGGTGGATGGCTGGGTGGAGGGG + Intronic
902398036 1:16143023-16143045 AGGTGGGTGGTTGGGTGGAGGGG + Intronic
902507383 1:16947000-16947022 AGCTGTGTGTGGGGGTGGTGTGG + Intronic
902579364 1:17398659-17398681 GGGTGGGTGGGTGGGTGGGGGGG - Intronic
902816312 1:18918584-18918606 AGGTGTCAGCAGGGGTGGTGCGG + Intronic
902964237 1:19986823-19986845 AGGTTTCTGGCTGGGTGCAGTGG + Intergenic
903009295 1:20318830-20318852 AAGAGTCGGGGTGGGGGGTGTGG + Intronic
903060374 1:20664689-20664711 AGGGGCCTGGGTGGGTGGGATGG + Exonic
903243802 1:22001455-22001477 AGGTGGCTGGACAGGTGGTGTGG - Intergenic
903338689 1:22641447-22641469 GAGTGTATGTGTGGGTGGTGGGG - Intergenic
903487955 1:23705620-23705642 ATGTGACTGGCTGGGTGTTGTGG + Intergenic
903634773 1:24804446-24804468 GTGTGGGTGGGTGGGTGGTGGGG + Intronic
903707567 1:25298025-25298047 AGGTGGATGGGTGGGTGGAGGGG - Intronic
903719674 1:25395329-25395351 AGGTGGATGGGTGGGTGGAGGGG + Intronic
903758902 1:25684178-25684200 AGGTGGCTGGGGGGCTGGCGGGG - Intronic
903892434 1:26578602-26578624 TGGTGGATGGGTGGGTGGGGTGG + Intergenic
904382397 1:30120138-30120160 AATTGTCTGTGTGGCTGGTGGGG - Intergenic
904419817 1:30384379-30384401 AGGTGCCAGGCGGGGTGGTGTGG + Intergenic
904441509 1:30534846-30534868 AATTGTCTGTGTGGCTGGTGGGG - Intergenic
905139321 1:35829022-35829044 AGGTGTGTGTGTGGGGGGGGGGG - Intronic
905304783 1:37009975-37009997 AGGTGTCTGTGTTGGTGCCGAGG - Intronic
905488286 1:38323245-38323267 GGGTGACTGGGTGGGTGGTAGGG + Intergenic
905751031 1:40464133-40464155 AAGGGTCTGGGTCGGGGGTGGGG - Intergenic
905971667 1:42146511-42146533 AGGTGTGTGTGTGTGTGGTGGGG - Intergenic
906290972 1:44618999-44619021 ATGTCTCTGGGTTGGTGATGGGG + Intronic
906322833 1:44827439-44827461 GGGTGCCTGGGTGGCCGGTGGGG + Exonic
906684071 1:47751719-47751741 AAGTGGCTGGGTGGGTGGGGAGG + Intergenic
907304582 1:53506621-53506643 AGGTGTCTGTGTAGATGGAGGGG + Exonic
907350199 1:53823190-53823212 AGGTGTTTTGCTGGGTGGTGTGG - Intronic
907485752 1:54776938-54776960 AGATGGCAGGGTGGGGGGTGGGG + Intergenic
908120743 1:60983879-60983901 AAGTGTGTGAGTGTGTGGTGTGG - Intronic
908432353 1:64071566-64071588 GTGTGTCTGTGTGGGTGGTGGGG - Intronic
908975743 1:69895598-69895620 ATTTGTCTGGGTGGGGAGTGGGG - Intronic
909546682 1:76855892-76855914 AGTAGGCAGGGTGGGTGGTGCGG + Intergenic
909667777 1:78154618-78154640 TGGTGTCCTTGTGGGTGGTGGGG + Intergenic
910170383 1:84370816-84370838 AGCTGTGGGAGTGGGTGGTGGGG + Intronic
910415892 1:86997740-86997762 AAGTGACTGTGTGGGTGGGGAGG + Intronic
911484100 1:98483913-98483935 AGGTGTCTAGGTAGGTGGAGAGG + Intergenic
911854404 1:102858790-102858812 TGGTGTGTGTGTGGCTGGTGAGG - Intergenic
912028178 1:105205164-105205186 AGCTATCAGGGTGGGTGGTGGGG - Intergenic
912208085 1:107530371-107530393 ATGTGTCTGGGGTGGTGGCGGGG - Intergenic
912302620 1:108533855-108533877 TGGGGTTTGGGTGGGTGGTGGGG - Intergenic
913158154 1:116120657-116120679 AGGTGCCAGGCTGGGTGCTGGGG - Intronic
913439205 1:118879302-118879324 AGGTGTCCCGGTGCGAGGTGGGG - Intergenic
914574211 1:148950745-148950767 AGGTGTTTGGGGCGGTGGGGGGG - Intronic
914680890 1:149937551-149937573 TGGTGTCTGGGTTGGAGGGGTGG - Intergenic
915288639 1:154868502-154868524 AAATGTCTGGGTGGGGGGTGGGG - Intronic
915562129 1:156693462-156693484 AGGAGACTGGGTGGGAGGAGAGG - Intergenic
915636988 1:157194375-157194397 GGGTGTCTGGGTTGCTGGTTAGG + Intergenic
915759379 1:158295433-158295455 AAATGTCTGTGTGGGTCGTGGGG - Intergenic
915943509 1:160134068-160134090 AGATGTGTGTGTGGGGGGTGGGG - Intronic
916830293 1:168484053-168484075 AAATTTCTGGGTGGGTGGGGAGG + Intergenic
916986906 1:170201486-170201508 AGGTGTATGGGTGGGTGGCAGGG + Intergenic
917029055 1:170669654-170669676 AGGGGTCTGCGATGGTGGTGTGG - Intronic
918043855 1:180929348-180929370 CGGTGTCTGTGTGTTTGGTGGGG + Intronic
918243625 1:182640920-182640942 AGGGGTGTGGGTGGGGGGTCAGG - Intergenic
918563563 1:185898545-185898567 AGGTGTCTTGGTAGATGGTCAGG + Intronic
918900548 1:190411042-190411064 AGGAGTCTGGGTATGTGGTAAGG - Intronic
920066717 1:203274285-203274307 AGGTGGCTGGGGGTGGGGTGGGG + Intergenic
920068728 1:203287499-203287521 AGAGGTCTGGGTGGGGGGTTGGG + Intergenic
920175449 1:204098679-204098701 AGGTGTGGGGTTAGGTGGTGGGG + Intronic
920215765 1:204360493-204360515 AGGAGCCTGGCTGGTTGGTGTGG - Intronic
920242850 1:204566210-204566232 AGCTCTCTTGGTGGCTGGTGGGG - Intergenic
920329032 1:205191585-205191607 AGGGGGATGGGTGGTTGGTGTGG + Intronic
920535543 1:206734346-206734368 AGGGGTTTTGTTGGGTGGTGAGG + Intergenic
920829838 1:209454106-209454128 GGGTGTGTGTGTGTGTGGTGTGG - Intergenic
920858006 1:209678817-209678839 TGGTGTCTGGGTGAGGGGAGGGG + Intergenic
920879183 1:209864376-209864398 TGGTGTGTGTGTGGGTGGTGGGG + Intergenic
921168721 1:212526529-212526551 AGGGGTCAAGGTGGGTGGTAAGG + Intergenic
921598635 1:217082661-217082683 AGGTGTGTGTGTGTGGGGTGGGG - Intronic
921878316 1:220224971-220224993 AGGGATCTGGCTGGGTGGTGTGG - Intronic
921986815 1:221321457-221321479 AAGTGTGTGCTTGGGTGGTGAGG - Intergenic
922231081 1:223687042-223687064 AGATTTCTGGGTGTTTGGTGAGG - Intergenic
922321845 1:224495466-224495488 AGGTGTCAGGCTAGGTGCTGGGG + Intronic
922567913 1:226612894-226612916 ATGTGTCTCGGTGGGGGGTGGGG + Intergenic
922777599 1:228223415-228223437 AGCTGTGTGGGTGTGGGGTGTGG + Intronic
923563200 1:235057359-235057381 AGGAGTCTGGGTGGTTAGTTAGG - Intergenic
923838327 1:237640012-237640034 TGGTGTGTGTGTGTGTGGTGGGG - Intronic
924003575 1:239581448-239581470 GTGTGTGTGGGTGGGTGGGGGGG + Intronic
924233989 1:241985408-241985430 AGTGGGCGGGGTGGGTGGTGGGG - Intergenic
924640051 1:245825116-245825138 ACGTGTCTGGGTGGCTGTTATGG - Intronic
1062795980 10:345559-345581 GTGTGTCTGGGTTGGGGGTGTGG - Intronic
1062843124 10:686459-686481 AGGAGGCTGTGTGGGTGGGGAGG - Intronic
1063021879 10:2137140-2137162 AGGGGGCTGGCTGGGTGGGGAGG - Intergenic
1063056743 10:2513262-2513284 AGGTGTGGAGGTGGCTGGTGTGG + Intergenic
1063139378 10:3242981-3243003 AGCTGCCGGGGTGGGGGGTGGGG + Intergenic
1063150976 10:3336008-3336030 AGGTGTCTGTGTGTGTGCTGGGG + Intergenic
1063745476 10:8874998-8875020 TGGTGTGTGTGTGTGTGGTGTGG + Intergenic
1064326311 10:14354610-14354632 AGGGGGCTGGGGGGATGGTGGGG - Intronic
1064817958 10:19288421-19288443 AGGAGGCTGGGAGGGAGGTGGGG - Intronic
1064940592 10:20730862-20730884 AGGTCTCTGTGTGAGTGTTGGGG - Intergenic
1064979876 10:21155418-21155440 AGGTTAGTGGGAGGGTGGTGAGG - Intronic
1067163563 10:43846935-43846957 GGCTGGGTGGGTGGGTGGTGAGG + Intergenic
1067840243 10:49670067-49670089 GGGAGTGTGGGGGGGTGGTGAGG - Intergenic
1068220043 10:54032518-54032540 ATGTGTTTGGGTGGTTGGGGTGG - Intronic
1068985139 10:63101294-63101316 AAGTGACTGGGTGAGTGGTTTGG - Intergenic
1069579319 10:69554617-69554639 GGGAGTCTGGGGGGGGGGTGGGG + Intergenic
1069839004 10:71327704-71327726 AAGTGTGGGGGTGGGGGGTGGGG - Intronic
1069893661 10:71667264-71667286 AGGTGTCTAGGGAGGGGGTGTGG + Intronic
1070080319 10:73179674-73179696 AGGTTTCTGGCTGGGTGCAGTGG - Intronic
1070278457 10:75030460-75030482 AGGAGTCAGGTTGGGGGGTGGGG - Exonic
1070304925 10:75234376-75234398 AGGTGTCTGGGCGGGAGGCGGGG + Intronic
1070548129 10:77469011-77469033 AGTGGTCGGGGAGGGTGGTGGGG - Intronic
1070655424 10:78267832-78267854 ATGTGTCTGTGTGAGTGGAGTGG + Intergenic
1070663034 10:78321322-78321344 TGGTGGCTGGGTGGGGAGTGGGG + Intergenic
1070664511 10:78333711-78333733 AGGTCTCCGTGTGTGTGGTGGGG + Intergenic
1070701181 10:78602712-78602734 AGGTGTCTGGGCTGGGGATGAGG - Intergenic
1071800529 10:89054806-89054828 AGAAGTTGGGGTGGGTGGTGGGG + Intergenic
1071885764 10:89949034-89949056 AGGGGCCTGGGTGGGAGGTGGGG + Intergenic
1072336763 10:94403979-94404001 AGGTTGTTGGGGGGGTGGTGAGG + Intronic
1072610415 10:97014055-97014077 GGGCGTCTGTGTGGATGGTGTGG - Exonic
1073048628 10:100654243-100654265 AGGCGTCTGGGTGGGAGCCGCGG - Intergenic
1073186361 10:101617588-101617610 ATGTGCGTGGGTGGGTGCTGGGG - Intronic
1073433350 10:103501011-103501033 AGGTGTCTTGGTGAGTGGGCTGG + Intronic
1073449827 10:103602733-103602755 TGGTGGCTGGGAGGGTGATGAGG + Exonic
1074178842 10:111038918-111038940 AGGTGTCTGGGTGGGTTCCTGGG - Intergenic
1074649660 10:115506173-115506195 GGGTGTCAGGGGTGGTGGTGGGG + Intronic
1074755088 10:116618530-116618552 AGGTTTCTGGCTGGGTGTGGTGG - Intergenic
1074869177 10:117563735-117563757 AGGTGTGTGTGTGTGTGTTGGGG + Intergenic
1075872762 10:125782644-125782666 GGGTGTTTGGGTGAGAGGTGAGG + Intergenic
1075894681 10:125984570-125984592 AGATGTCAGGGAGGGTGTTGGGG + Intronic
1075959551 10:126556728-126556750 GGGTGTCTGGGTGGCTGCTATGG - Intronic
1076566783 10:131404404-131404426 GGGTGTCTAGGTGGGTGGGAGGG - Intergenic
1076725140 10:132409624-132409646 GGGTGGGTGGGTGGGTGGTGAGG - Intronic
1076759179 10:132591948-132591970 AGGTGTCAGCGTGTGTGGGGTGG + Intronic
1076829385 10:132986346-132986368 GCGGCTCTGGGTGGGTGGTGGGG + Intergenic
1076879829 10:133234730-133234752 AGGTGTCGGGGAGGGGGGCGTGG + Intergenic
1076896929 10:133317598-133317620 CTGTGTCTGGGGGGGAGGTGTGG - Intronic
1076897002 10:133317842-133317864 CTGTGTCTGGGGGGGAGGTGTGG - Intronic
1076897011 10:133317876-133317898 CTGTGTCTGGGGGGGGGGTGTGG - Intronic
1076897041 10:133317975-133317997 CTGTGTCTGGGGGGGAGGTGTGG - Intronic
1076897119 10:133318272-133318294 CTGTGTCTGGGGGGGGGGTGTGG - Intronic
1076897130 10:133318306-133318328 CTGTGTCTGGGGGGGAGGTGTGG - Intronic
1077239531 11:1503287-1503309 AGGTGACAGTGTGCGTGGTGTGG - Intergenic
1077269060 11:1666548-1666570 GGGCCCCTGGGTGGGTGGTGGGG - Intergenic
1077271488 11:1684167-1684189 GGGCCCCTGGGTGGGTGGTGGGG + Intergenic
1077344274 11:2039189-2039211 TGGAGTCTGGGAGGGTGGGGTGG + Intergenic
1077357678 11:2126271-2126293 AGATGACTGGGTGGGTGGATGGG + Intergenic
1077364138 11:2154760-2154782 GGGTGGCTCGGTGGGTGGTGAGG - Intronic
1077539293 11:3139122-3139144 TGGTGTGTGGGTGGGCAGTGGGG - Intronic
1077541459 11:3148367-3148389 AGGAGTCAGGGAGGGTGGAGAGG + Intronic
1077544711 11:3164416-3164438 AGCGGTCTGGGTGGGGGTTGGGG + Intronic
1077694656 11:4383439-4383461 ACGTGTCTGTGTGTGTGTTGGGG + Intergenic
1077871836 11:6269565-6269587 AGGCATCTGGCTGGGTAGTGAGG + Intronic
1078007091 11:7540243-7540265 AGGGGTGTGGGGGGGCGGTGAGG + Intronic
1078537254 11:12185103-12185125 AGGTGGGTGGGTGGGTGGGTGGG + Intronic
1078703694 11:13717167-13717189 AGGGATCTGGGGCGGTGGTGGGG - Intronic
1079908815 11:26284024-26284046 GGGTGTGTAGGTGGGTGGTATGG + Intergenic
1079979315 11:27132340-27132362 AGGTTTCTGGGTGGGTTCTTTGG - Intergenic
1080515264 11:33014556-33014578 GGGTTTGTGGGTGGGAGGTGGGG - Intergenic
1080759423 11:35233774-35233796 AGCTTTCTGGGTGCCTGGTGGGG - Intergenic
1081408166 11:42722374-42722396 ATGTGTGTGTGTGTGTGGTGGGG - Intergenic
1081582055 11:44359306-44359328 AGGGGTCGGGGTGGGCGGCGGGG + Intergenic
1081797589 11:45832078-45832100 GGGTGTCTGTGTGGGTGGGTGGG - Intergenic
1081814689 11:45931957-45931979 AGGCTTGTGGGTGGGTGGAGTGG + Intronic
1082028026 11:47586859-47586881 AGGCTTCAGGGTGGGTGGAGAGG + Intronic
1082795643 11:57376408-57376430 AGGGGTAGGGGTGGGAGGTGGGG - Intergenic
1082806930 11:57457736-57457758 AGGTGTGTTGGTGTGTGGAGGGG - Intergenic
1083293645 11:61703537-61703559 GGGTGCCTGGGAGGCTGGTGAGG + Intronic
1083328671 11:61886594-61886616 TTGTGTCTGGGTGGGAGCTGGGG - Intronic
1083409393 11:62481477-62481499 AGGTTTGAGGGTGGGAGGTGTGG - Intronic
1083616923 11:64030897-64030919 AGGAAGGTGGGTGGGTGGTGGGG + Intronic
1083621398 11:64051144-64051166 AGGTGGCTAGGTGAGTGGTCAGG - Intronic
1083710944 11:64548016-64548038 GGGTGTCTGGTGGGGTAGTGAGG - Intergenic
1083804925 11:65067801-65067823 AGGGAAGTGGGTGGGTGGTGTGG + Intronic
1083804958 11:65067912-65067934 ATGTTTCTGGGTGTGGGGTGGGG + Intronic
1084031677 11:66484886-66484908 AGGTGGCTGAGAGGGTGCTGGGG + Intronic
1084671956 11:70612136-70612158 AGGGGTCTGTGCTGGTGGTGGGG + Intronic
1084770534 11:71340256-71340278 AGGCTTCTGGGTGGGGTGTGGGG + Intergenic
1085303719 11:75473508-75473530 AGGTGTCTATGTGGGGAGTGAGG - Intronic
1085464233 11:76713346-76713368 GGATGAATGGGTGGGTGGTGAGG + Intergenic
1085521733 11:77143063-77143085 AGATGTGTGTGTGTGTGGTGGGG + Intronic
1085785133 11:79441528-79441550 AAGTGTTGGGGTGGGGGGTGTGG - Intergenic
1086921604 11:92594038-92594060 ATGTGTCATGGTGGGAGGTGTGG + Intronic
1087025888 11:93649550-93649572 AGGTGTATGTGTGGGTGGGTGGG + Intergenic
1087187369 11:95215250-95215272 AGGTCTAGGGGTGGGGGGTGGGG + Intronic
1087227511 11:95618534-95618556 AGTTGTGTGGGTGGGTCCTGAGG - Intergenic
1088254708 11:107892305-107892327 AGGGGTGGGGGTGGGGGGTGTGG - Intronic
1088430003 11:109748531-109748553 GCCTGTCTGGGTGGGTAGTGGGG + Intergenic
1088598089 11:111454813-111454835 AAGTGTCTGGGTTGGGGGTTGGG + Intronic
1088619214 11:111664689-111664711 AGGTGTGTGTGTGGGGGGGGTGG - Intronic
1088672206 11:112153170-112153192 AGGTTCCCGGGTTGGTGGTGGGG - Intronic
1088914801 11:114219407-114219429 AGGGGTCTGAGTGGGTGGCTGGG + Intronic
1089925737 11:122255560-122255582 AGGTGTTTGGGTCAGTGGGGTGG + Intergenic
1090103101 11:123822649-123822671 AGGTGTGGGGGTGGGGGTTGAGG + Intergenic
1090262452 11:125331327-125331349 AGGGGTTAGGGTGGGTGGGGAGG - Intronic
1090413906 11:126527749-126527771 GGGAGTTGGGGTGGGTGGTGCGG + Intronic
1090657009 11:128854040-128854062 AGGTGGATGGGTGGGTGGGTGGG - Intronic
1090801362 11:130174500-130174522 AGGTGTGTGGGTGTGGGGTGGGG + Intronic
1091216727 11:133906873-133906895 AGGTGTTGGGGTGGGAGGTGGGG - Intergenic
1091220632 11:133928163-133928185 AGATGCCTGGGTGGGAGGTCTGG - Intronic
1091289667 11:134430939-134430961 TGGTGTTTGGGTGGGACGTGTGG - Intergenic
1202827260 11_KI270721v1_random:94378-94400 TGGAGTCTGGGAGGGTGGGGTGG + Intergenic
1091657309 12:2354983-2355005 ATGGGTCTGGGTGTGGGGTGGGG + Intronic
1091754360 12:3041901-3041923 AGGTGTCTTGGAGTGTGGTTAGG + Intergenic
1091773607 12:3169811-3169833 AGGTGTCAGGGTGGGCAGGGTGG + Intronic
1091776795 12:3189939-3189961 AGGTGTCTGGATGGGTGGCAGGG - Intronic
1091823756 12:3494112-3494134 ACGTGTGTCAGTGGGTGGTGGGG + Intronic
1091835496 12:3582893-3582915 AGGTGATTGGGAGGGCGGTGGGG + Intronic
1092097048 12:5851398-5851420 AGGTGTCTGGCTGGGTGTGGTGG + Intronic
1093081901 12:14821994-14822016 AGGTGTGTGTGGGGGTGGGGTGG + Intronic
1093872382 12:24307523-24307545 GGGTGAGTGGGTGGGTGGGGGGG - Intergenic
1094155218 12:27332010-27332032 ATGTGTCTTGGTGTGTGTTGAGG + Intergenic
1094783328 12:33818219-33818241 AGGTGGGTAGGTGGGTGGTGGGG + Intergenic
1094794846 12:33959849-33959871 ATGTGTGTGTGTGTGTGGTGGGG - Intergenic
1095733942 12:45535967-45535989 GGGTGGCTGGGTGGGTGGATAGG - Intergenic
1095958726 12:47820447-47820469 ATGTGTGTGTGTGTGTGGTGGGG - Intronic
1096524578 12:52202850-52202872 GGGTGTCTGGGTGCCTGGTGTGG + Intergenic
1096796695 12:54082417-54082439 GGCTGTGTGGGTGGGGGGTGAGG + Intergenic
1096871553 12:54595711-54595733 AGGTGTGTTGGTGAGGGGTGGGG + Intergenic
1097147180 12:56949795-56949817 TGGTGTCTTGGTGTGGGGTGGGG + Intergenic
1097165861 12:57086528-57086550 AGGTGTGTGTGTGGGGGGGGGGG - Intronic
1097191881 12:57223316-57223338 TGGTGTCTGTGTGACTGGTGTGG - Intronic
1097258500 12:57698792-57698814 ATGAGTCTGGGTGGTTGGTAGGG + Intronic
1097262576 12:57727813-57727835 AGGTGTCTGAGAAGGAGGTGGGG - Intronic
1097516412 12:60613640-60613662 AGGTGGCTGAGAGGGGGGTGTGG - Intergenic
1098026904 12:66213452-66213474 TGGTGTCTGGGTGTTTGGTAAGG + Intronic
1098268886 12:68751106-68751128 AGGTGTATTGGTGGGGGATGAGG + Intronic
1099303746 12:80929565-80929587 AGGTGTCTGTGAGAGTTGTGGGG + Intronic
1100089459 12:90953336-90953358 ATGACTATGGGTGGGTGGTGGGG - Exonic
1100207551 12:92367155-92367177 GGGTGGGTGGGTGGGTGGTTGGG + Intergenic
1100549959 12:95638222-95638244 AGGAGTCTGGGAGGGTGGACAGG + Intergenic
1100615224 12:96226216-96226238 AGGAGTCCAGGTGGCTGGTGTGG + Intronic
1100643151 12:96502074-96502096 AAATGTCTGTGTGGGTGGAGTGG + Intronic
1100870343 12:98904240-98904262 AGGTGACTGAGTGGAGGGTGAGG + Intronic
1101539665 12:105653548-105653570 AGTTGCCTGGCTGGGTGGTCAGG + Intergenic
1101757944 12:107635857-107635879 GTGTGTGTGGGTGGGTGGGGGGG - Intronic
1102009201 12:109607609-109607631 AGGTGTGTGTGTGTGTGGCGGGG - Intergenic
1102019911 12:109675199-109675221 TTGTGTCTGTGTGTGTGGTGGGG - Intergenic
1102517923 12:113462847-113462869 CGGTGGCTGGGTGGGTGGGTGGG + Exonic
1102549236 12:113679081-113679103 AGAGGTCTGGGTGGCTGCTGGGG + Intergenic
1102640163 12:114360370-114360392 AGATGTATGGGTGGGTGGGTGGG + Intronic
1102681604 12:114694308-114694330 TGGTGTGTGTGTGGGGGGTGGGG - Intergenic
1102686565 12:114729362-114729384 TGGTGGCAGGGTGTGTGGTGTGG + Intergenic
1102707011 12:114890503-114890525 ATGTGTGTGGGTGGGCAGTGGGG + Intergenic
1103143510 12:118573337-118573359 TGGTGTCTGGTTGTCTGGTGAGG + Intergenic
1103194115 12:119027207-119027229 AGGAGTCTGGTTGGGTGGGTGGG - Intronic
1103477076 12:121226726-121226748 AGGTGTGTGTGTGGGTGTTACGG + Intronic
1103553313 12:121751265-121751287 AGGTGTCGGTGTGGGGTGTGGGG - Intronic
1103629521 12:122248328-122248350 AGGTGTAGGGGTCTGTGGTGAGG + Intronic
1103657301 12:122483057-122483079 ATGTGCCTGGGTGGGTGGAAAGG - Intronic
1103852288 12:123941013-123941035 AGGTGGGTGGGTGGGTGGGCAGG + Intronic
1103876424 12:124131004-124131026 AGGTTTCTGAGGGGGCGGTGTGG - Intronic
1103908336 12:124338893-124338915 GGGTGGATGGGTGGGTGGTAGGG - Intronic
1103908361 12:124338971-124338993 GGGTGGATGGGTGGGTGGTAGGG - Intronic
1104750445 12:131234982-131235004 AAGTGGCTGAGGGGGTGGTGGGG + Intergenic
1104782275 12:131429480-131429502 AAGTGGCTGAGGGGGTGGTGGGG - Intergenic
1104904900 12:132207907-132207929 AGGAGTCGTGGTGGGGGGTGGGG - Intronic
1104925905 12:132313809-132313831 GGGTGGCTGGGTGGGTGGATGGG - Intronic
1104971002 12:132530702-132530724 AGATGGCGGGGTGGGGGGTGGGG + Intronic
1105611321 13:21971935-21971957 ATGTGTGTGGGTGTGTCGTGAGG + Intergenic
1105749439 13:23408605-23408627 AGTTGTGTGTGAGGGTGGTGGGG - Intronic
1105971040 13:25429490-25429512 GGATGGCTGGGTGGGTGGAGTGG + Intronic
1106134365 13:26962929-26962951 AAGAGCCTGGGTGGGGGGTGTGG + Intergenic
1106784527 13:33093400-33093422 TGGTGACGGGGTGGGTGATGAGG + Intergenic
1106956209 13:34942177-34942199 GGGTGTCGGGGTGGGTGGGTGGG + Intergenic
1108084063 13:46766709-46766731 AGGTTGCCGGGGGGGTGGTGGGG - Intergenic
1108096684 13:46909101-46909123 AGGAGGGTGGGAGGGTGGTGAGG - Intergenic
1108440808 13:50451000-50451022 AGGTGTCTTGGTGGGTGGTGGGG + Intronic
1108763663 13:53600709-53600731 AGTTGTCTTGCTGGTTGGTGGGG - Intergenic
1108848245 13:54700227-54700249 AGGTGTGTGTGTGTGTGGAGGGG + Intergenic
1109024842 13:57143609-57143631 AGGTGTTGGGGTGGGGGGGGGGG + Exonic
1109025829 13:57150179-57150201 AGGTGTTGGGGTGGGGGGGGGGG + Exonic
1109026819 13:57156752-57156774 AGGTGTTGGGGTGGGGGGGGGGG + Exonic
1109027811 13:57163323-57163345 AGGTGTTGGGGTGGGGGGGGGGG + Exonic
1109028797 13:57169888-57169910 AGGTGTTGGGGTGGGGGGGGGGG + Exonic
1109117136 13:58402581-58402603 AGGAGGGTGGGAGGGTGGTGAGG - Intergenic
1110408621 13:75179117-75179139 ATGTGTGTGTGTGGGTGGGGGGG + Intergenic
1110463225 13:75770323-75770345 GGGGATGTGGGTGGGTGGTGTGG + Intronic
1110635050 13:77757575-77757597 GGAAGTCTGGGAGGGTGGTGAGG - Intronic
1110847867 13:80209946-80209968 ATGTGTGTGTGTTGGTGGTGGGG - Intergenic
1110922675 13:81108520-81108542 ATGGGTATGGGTGGGGGGTGGGG - Intergenic
1111854615 13:93622007-93622029 GGGTGTCTGGGTGGCAGCTGGGG - Intronic
1111946066 13:94667269-94667291 ATGTCTCTGAGTGGGTGGAGAGG + Intergenic
1111981861 13:95025189-95025211 GGGTGTGGGGGTGTGTGGTGTGG - Intronic
1111981927 13:95025405-95025427 GTGTGTATGGGTGTGTGGTGGGG - Intronic
1112004838 13:95245315-95245337 AGGTGTCTGGTTAGGTGTAGTGG - Intronic
1112173416 13:96996261-96996283 AGTTCTGTGGATGGGTGGTGGGG + Intergenic
1112280302 13:98056838-98056860 AGTGGTCTTGTTGGGTGGTGGGG + Intergenic
1112531912 13:100212860-100212882 AGGAGTGGGGGTGGGTGATGTGG - Intronic
1112602378 13:100869141-100869163 AGGTGTCTGCTTTGGTGATGGGG + Intergenic
1112883373 13:104136828-104136850 ATGTGTCTGGGCCGGTGGTGGGG + Intergenic
1113200892 13:107866979-107867001 AGGTGACAGGGTGGCTGGCGCGG + Intergenic
1113265926 13:108617949-108617971 AGGTGCTTGGGTGTTTGGTGAGG - Intronic
1113668059 13:112154544-112154566 AGGTGAATTGGTGCGTGGTGGGG - Intergenic
1113900643 13:113794930-113794952 AGGCGCCTGGGTGGGTCTTGCGG + Intronic
1113976941 13:114234903-114234925 CGGGGCCTGGGTGGGGGGTGCGG + Exonic
1115472583 14:33783580-33783602 AGTTTTTTGGGGGGGTGGTGTGG + Intronic
1115798869 14:36969777-36969799 AAGTGTCTGGCTGGGTGCAGCGG - Intronic
1116604447 14:46971552-46971574 AGGTGTATGGGTGGGAGGAGGGG + Intronic
1116643401 14:47495267-47495289 AGGTAGGTGGGTGGGTGGTTGGG + Intronic
1116716472 14:48432244-48432266 AAGTGTCTGTGGGGGTCGTGGGG - Intergenic
1117213679 14:53527777-53527799 AGGTGTATGTGTGTGTGGAGTGG - Intergenic
1117420806 14:55543153-55543175 AGGTGTCTGGGCGGAGGGGGAGG - Intergenic
1118454117 14:65929662-65929684 AGGAGTCTGGGTGACTGTTGAGG + Intergenic
1118764236 14:68899427-68899449 AGGTGTGTGTCTGGGGGGTGTGG - Intronic
1118845609 14:69545720-69545742 AGGTGGGGGGGTGGGTGGGGCGG + Intergenic
1119104420 14:71910711-71910733 AGGTGACTTCGTGGGTGGTGAGG + Intergenic
1119128517 14:72150738-72150760 AGGTGACTGGGTGGTAGGGGTGG - Intronic
1119136868 14:72229282-72229304 ATGTGTGTGGGAGGGTGGTAGGG - Intronic
1119544456 14:75461534-75461556 AGCTGACCGGGTGGGTGGGGAGG + Intronic
1119616022 14:76099591-76099613 AGGTGGCTGGGTGGGAGGCAAGG + Intergenic
1119616660 14:76103306-76103328 AGGAGGCTGGGTGGGGGGCGGGG - Intergenic
1119642937 14:76328534-76328556 AGGTGTGTGGGGCGGGGGTGGGG - Intronic
1119643764 14:76334196-76334218 AGGGGCCTGGGTGGGTGGCGAGG + Intronic
1119711800 14:76827958-76827980 AAGTGTTTGGGTGGGTTTTGGGG - Intronic
1119724530 14:76914068-76914090 GGGTGTGGGGGTGGGTGGTAAGG - Intergenic
1120169755 14:81236456-81236478 AGGAGTGTGGGTGCCTGGTGCGG + Intergenic
1120490707 14:85175332-85175354 AGGGGTGTGTGTGGGGGGTGGGG - Intergenic
1121453516 14:94024286-94024308 AGGTGTCTGGGTGGAGGGATCGG - Intergenic
1121627583 14:95397607-95397629 AGGTCTCTGTGTGTGTGGTGTGG + Intergenic
1121824409 14:96998910-96998932 TGGTGTGTGGGTGGGTGGGTGGG + Intergenic
1122137684 14:99644456-99644478 ATGTGTGTGGGGGGGTGGGGCGG + Intergenic
1122256640 14:100482954-100482976 ATGTTTCTGGCTGGGTGGCGTGG + Intronic
1122474561 14:101997958-101997980 CTGTGCCTGGGAGGGTGGTGTGG + Intronic
1122606124 14:102948394-102948416 AGGTGACGGGGAGGGTGGGGTGG + Intronic
1122625004 14:103080257-103080279 AGGTGGCTGGCTGATTGGTGGGG + Intergenic
1122690720 14:103531004-103531026 GGGTGTCTGGGTGGGAGGGGTGG + Intronic
1122737205 14:103849609-103849631 AGGTGGCAGGCTGGGTGGAGAGG - Intergenic
1122741869 14:103876043-103876065 AGGTGGATGGGTGGGTGGATGGG + Intergenic
1122923604 14:104890056-104890078 AGGTTGCTGGGTGGGTGGATGGG + Intronic
1123724468 15:23088301-23088323 AGCTGTCTGGCTGGGTGCAGTGG - Intergenic
1124005975 15:25795808-25795830 AGGTGTCTGGGTCGTGGGGGTGG + Intronic
1124244612 15:28058496-28058518 GGGTGGCAGGGTGGGTGGTGGGG - Intronic
1124364621 15:29063073-29063095 CAGTGTCTGTATGGGTGGTGCGG + Intronic
1124364637 15:29063148-29063170 CAGTGTCTGTATGGGTGGTGCGG + Intronic
1124364682 15:29063371-29063393 CAGTGTCTGTATGGGTGGTGCGG + Intronic
1124364715 15:29063520-29063542 CAGTGTCTGTATGGGTGGTGCGG + Intronic
1124364731 15:29063594-29063616 CAGTGTCTGTATGGGTGGTGCGG + Intronic
1124555767 15:30724406-30724428 GGGTGGCTGGGTGGGTGGGTGGG + Intronic
1124998617 15:34748176-34748198 CGGTGTGTGTGTTGGTGGTGGGG - Intergenic
1125100156 15:35902964-35902986 AGGTATGTGGGCTGGTGGTGTGG + Intergenic
1125115458 15:36086248-36086270 ACATTCCTGGGTGGGTGGTGTGG - Intergenic
1125314653 15:38418221-38418243 TAGTGTGTGTGTGGGTGGTGGGG + Intergenic
1125714579 15:41812126-41812148 AGGTGAGTGGCTGGGTGGGGTGG + Exonic
1125730995 15:41892856-41892878 AGGGGTCTGGGATGGTGCTGGGG - Intronic
1126582955 15:50257897-50257919 GGGTGTGTGGGTGGGTGGGCGGG - Intronic
1127250857 15:57236210-57236232 AGGTGTCCGGCTGGGAAGTGGGG - Intronic
1128129159 15:65214389-65214411 AGGTGACTGGGAGGCTGGGGAGG - Intergenic
1128150827 15:65362553-65362575 AGGGGTGAGGGTGGGTGGGGGGG + Intronic
1128498195 15:68210206-68210228 AGGTGTCTGAGGTGGGGGTGGGG - Intronic
1128604718 15:69028118-69028140 CTGTGTCTGGGGTGGTGGTGGGG - Intronic
1128717654 15:69920388-69920410 ATGTGTGTGAGTGTGTGGTGTGG - Intergenic
1128798296 15:70480371-70480393 AGGTCTGGGGGTGGGGGGTGAGG - Intergenic
1128922088 15:71620303-71620325 AGTTGTCTGGCTGGGTGTGGGGG + Intronic
1129067341 15:72916651-72916673 GGTTGCCTGGGAGGGTGGTGAGG + Intergenic
1129329494 15:74819855-74819877 AGGTAGACGGGTGGGTGGTGAGG - Intronic
1129334770 15:74845321-74845343 AGGGATCTGGGTGGGGGGTCAGG - Intronic
1129615828 15:77098194-77098216 ATGTGTCGGGGGGGGGGGTGGGG + Intergenic
1129878651 15:78993283-78993305 TGGTGTCTGTGTGTGTGGTCTGG + Intronic
1129935111 15:79440670-79440692 ACGTGCCTGCCTGGGTGGTGGGG - Intronic
1130303517 15:82698302-82698324 AGGTGTGTAGGTGAGTTGTGTGG - Intronic
1130821953 15:87505164-87505186 AGATGGGTGGGTGGGTGGGGGGG + Intergenic
1130908735 15:88256935-88256957 GGGTGGGTGGGTGGGTGGGGAGG - Intergenic
1130923257 15:88366601-88366623 AGGAGTCTGGGTGGGGGTGGGGG - Intergenic
1130946443 15:88553008-88553030 GGGTGGCTGGCTGGGTGGGGGGG + Intergenic
1131271061 15:90947946-90947968 AGGGGTCTGGGTGGGGGTTGGGG + Intronic
1131545491 15:93312637-93312659 TGGTCTCTGAGTGGGTGGTGGGG + Intergenic
1132411092 15:101578728-101578750 GGGCGTCTGTGTGGCTGGTGTGG - Intergenic
1132561401 16:596127-596149 AGGTCTCTCGCAGGGTGGTGTGG + Intronic
1132606995 16:797750-797772 AGGTGTGTGTGGGGGTGTTGTGG + Exonic
1132616189 16:842157-842179 AGGAGGCTGAGGGGGTGGTGGGG + Intergenic
1132711785 16:1272102-1272124 AGGTGCTGGGGTGGGTGCTGCGG - Intergenic
1132727693 16:1345889-1345911 AGGTGTGTGGGTGGGCCCTGGGG + Exonic
1132775510 16:1591547-1591569 AGGTGTGTGGGTTGCTGGCGTGG - Intronic
1132854946 16:2040516-2040538 AGTTGGATGTGTGGGTGGTGGGG + Intronic
1132907307 16:2289401-2289423 AGGTGGGTGGGCGGGTGGCGGGG - Intronic
1132998567 16:2837387-2837409 GTGTGTCTGGGTGTGTGGGGAGG - Intronic
1133040527 16:3058099-3058121 GGGTGTGTGGCTGGGTGGGGAGG - Intronic
1133069388 16:3235563-3235585 GGGTGGCGGGGTGGGGGGTGGGG - Intronic
1133069434 16:3235650-3235672 GGGTGGCGGGGTGGGGGGTGGGG - Intronic
1133282797 16:4676649-4676671 AGGTGGCTGGTTTGGTGGTTTGG + Intronic
1133613001 16:7450739-7450761 AGGTTGCTGAGTGGGTGTTGAGG + Intronic
1133633651 16:7645932-7645954 AGGTGGGTGGGTGGTGGGTGGGG - Intronic
1133908170 16:10040254-10040276 ATGTATCTGTGTGTGTGGTGTGG - Intronic
1134027535 16:10965813-10965835 AGATGACTCTGTGGGTGGTGGGG - Intronic
1134065491 16:11225632-11225654 AGGTCTCAGGCTGGATGGTGGGG - Intergenic
1134203307 16:12216713-12216735 AGATGTAGGGGTGGGTGGGGTGG - Intronic
1134224369 16:12380292-12380314 AGGTGGGTGGTTGGGTGTTGGGG - Intronic
1134224816 16:12381690-12381712 CGATGGGTGGGTGGGTGGTGGGG - Intronic
1134683396 16:16142066-16142088 TGGAGTCGGGGTGGGTGGGGAGG - Exonic
1135739191 16:24958754-24958776 ATGTGTCTGTGTGTGTTGTGGGG - Intronic
1135998057 16:27268454-27268476 AGATGTCTGCGTGTGTGTTGCGG + Intronic
1136178929 16:28537921-28537943 AGGTGTGTGATTGGGTGGGGAGG - Intronic
1136630386 16:31486369-31486391 AGAGGTCTGGAAGGGTGGTGTGG + Intronic
1136774947 16:32866941-32866963 GGGTTTCTGGGGGGGAGGTGAGG + Intergenic
1136895671 16:33994571-33994593 GGGTTTCTGGGGGGGAGGTGAGG - Intergenic
1137311637 16:47266503-47266525 AGCTGTCTGGCTGGGTGCAGTGG - Intronic
1137601590 16:49760018-49760040 GGGTGGATGGGTGGGTGGGGTGG + Intronic
1137601615 16:49760131-49760153 GGGTGGATGGGTGGGTGGGGTGG + Intronic
1137637755 16:50002027-50002049 AGGTGTTTGGGTCGTTGGGGTGG - Intergenic
1137744220 16:50809154-50809176 AGGTGTTTGGGAGTGTGGAGTGG + Intergenic
1138085094 16:54126329-54126351 AGCTGTCTGTGTGTGTAGTGGGG - Intergenic
1138198016 16:55068496-55068518 AGGTATCTGTGTGGGGGGGGGGG - Intergenic
1138347987 16:56331621-56331643 AGTTGCCTGGGTGGGTGGGCAGG - Intronic
1138608995 16:58108120-58108142 ATGTGCCTGGGTGGTGGGTGGGG + Intergenic
1139251654 16:65502295-65502317 GGGTGTCTGTGTGGGTGGACAGG - Intergenic
1139623563 16:68166351-68166373 GGGTGGCTGGGTGGCTGGAGTGG + Intronic
1139795763 16:69481838-69481860 TGGTGTGTGGGTGGGTGATGGGG + Intergenic
1140143884 16:72286659-72286681 AGATGGCTGGCTGGGTGGTTGGG - Intergenic
1140286735 16:73609954-73609976 GTGTGTGTGGGTGGGTGGTGGGG + Intergenic
1140295617 16:73706796-73706818 AGGGTTCTGGGTGGAGGGTGGGG - Intergenic
1141109325 16:81259049-81259071 AGGTGTCTGGGTGATGGGGGTGG - Intronic
1141266633 16:82503541-82503563 TTGTGTGTGGGTGGGTGGGGAGG - Intergenic
1141601156 16:85127159-85127181 ATGTGTGTGGGTGGGTGGAAGGG - Intergenic
1141620749 16:85235561-85235583 ATGTGTGTGTGTGGGTGGGGGGG + Intergenic
1141640926 16:85340807-85340829 AGGTGGCTGGGAGGGTGGGACGG + Intergenic
1141700745 16:85640966-85640988 AGGGGTCGGGATAGGTGGTGGGG - Intronic
1141858867 16:86703224-86703246 GGGTGTGTGGGTGTGTGGGGTGG - Intergenic
1141993183 16:87621756-87621778 TGGGGTTTGGGTGGGTGGTGGGG + Intronic
1142070872 16:88090796-88090818 GGGGGTCGGGGGGGGTGGTGGGG + Intronic
1142127728 16:88418539-88418561 AGGTGGCCGGGGGGGCGGTGGGG - Intergenic
1203077365 16_KI270728v1_random:1129050-1129072 GGGTTTCTGGGGGGGAGGTGAGG + Intergenic
1142518363 17:448014-448036 AGGTGTTTGTGTGTGTGTTGGGG + Intergenic
1142518402 17:489061-489083 AGGTGTGTGTGTGTGTGTTGGGG + Intergenic
1143034630 17:3987304-3987326 TTGTGTCTGGGAGGGTGGGGAGG - Intergenic
1143095232 17:4475332-4475354 TGGTGTCTGGAGGGATGGTGGGG + Intronic
1143097528 17:4486332-4486354 ACGTGTCTGCGTGTGTGGGGTGG + Intronic
1143107200 17:4535778-4535800 AGTGGTCTGGGTTGGAGGTGTGG + Intronic
1143590704 17:7884768-7884790 CGGTGGGTGGGGGGGTGGTGGGG + Intronic
1143597816 17:7925856-7925878 AGGTGTATGGGGTGGGGGTGGGG - Intronic
1143651689 17:8267307-8267329 AGGTGTCTGGGGAGTTGGGGTGG + Intronic
1144425037 17:15133650-15133672 AGGGGTGTGGGGGTGTGGTGGGG - Intergenic
1144967555 17:19087590-19087612 AGGGGTGGGGGTGGGGGGTGAGG + Intergenic
1144980364 17:19164475-19164497 AGGGGTGGGGGTGGGGGGTGAGG - Intergenic
1144987858 17:19213757-19213779 AGGGGTGGGGGTGGGGGGTGAGG + Intergenic
1145747294 17:27329710-27329732 ACATGTCTGGGTGCGTGCTGTGG - Intergenic
1146183311 17:30710208-30710230 AGGTGTCTGGGTGTGAGCGGAGG + Intergenic
1146383710 17:32350431-32350453 AGGCGTCTGCGTGGGTGGCCTGG + Intronic
1146684576 17:34832680-34832702 AGGGCACTGGGTGGGTGGTGGGG + Intergenic
1147496942 17:40925672-40925694 AGGTGTCTTGGTAGCTGCTGAGG + Intronic
1147617435 17:41837874-41837896 GGGTGTCGGGGAGGGTTGTGGGG - Exonic
1147682432 17:42259423-42259445 GGGTGTCTGGGTGTGTCTTGGGG + Intronic
1147971742 17:44221900-44221922 GGGTGTCGGGGTGGGAGTTGCGG + Intergenic
1148053369 17:44779888-44779910 AGGGGTTTGGGTGGGGGCTGTGG + Exonic
1148160901 17:45449649-45449671 AGGTGGCTAGGTGGATGGTTAGG - Intronic
1148160955 17:45449881-45449903 AGGTGGCTAGGTGGATGGTTAGG - Intronic
1148161024 17:45450176-45450198 AGGTGGCTAGGTGGATGGTTAGG - Intronic
1148161039 17:45450228-45450250 AGGTGGCTAGGTGGATGGTTAGG - Intronic
1148481857 17:47965111-47965133 AGGTGAATGGATGGGTGGTTTGG + Intergenic
1148586268 17:48783124-48783146 AGGTGTGTGTGTGGGAGGTGGGG + Intronic
1148970777 17:51479416-51479438 AGGGGTGGGGGTGGGGGGTGGGG - Intergenic
1149608233 17:57939926-57939948 GGGTGTGTGGGGGTGTGGTGGGG - Intronic
1149665493 17:58362482-58362504 GTGTGTGTGGGTGGGTGGTTAGG - Intronic
1149667736 17:58377663-58377685 GGGTGGGTGGGTGGGTGGGGAGG - Intronic
1150392175 17:64796455-64796477 AGGTGGCTAGGTGGATGGTTAGG - Intergenic
1150392212 17:64796607-64796629 AGGTGGCTAGGTGGATGGTTAGG - Intergenic
1150392237 17:64796719-64796741 AGGTGGCTAGGTGGATGGTTAGG - Intergenic
1150392258 17:64796814-64796836 AGGTGGCTAGGTGGATGGTTAGG - Intergenic
1150392271 17:64796866-64796888 AGGTGGCTAGGTGGATGGTTAGG - Intergenic
1151110058 17:71665809-71665831 CTGTGTTTGGGTGGTTGGTGGGG - Intergenic
1151298939 17:73207295-73207317 GGGTGGCTCGGTGGGAGGTGGGG - Intronic
1151351310 17:73533684-73533706 ATTTGTCTGGGGGGGTGGGGGGG - Intronic
1151550594 17:74820475-74820497 AGGTGGCTGGCAGGATGGTGTGG - Intronic
1151600001 17:75100274-75100296 AGGTGTCTCGGGAGGTGGCGGGG - Exonic
1151975856 17:77483241-77483263 AGGTGTCGGGCTGGCAGGTGTGG - Intronic
1152097139 17:78278829-78278851 AGGTGTCTGGGCTGGTGGCCAGG - Intergenic
1152141709 17:78540783-78540805 GGGTGGATGGGTGGGTGGGGTGG + Intronic
1152141726 17:78540849-78540871 AGGTGGATGGGTGGGTGGATGGG + Intronic
1152141771 17:78540965-78540987 GGGTGGATGGGTGGGTGGCGTGG + Intronic
1152393403 17:80016606-80016628 GGGTGGGTGGGTGGGTGGAGGGG + Intronic
1152473449 17:80503113-80503135 AGGTGGATGGGTGGGTGGGTAGG + Intergenic
1152667228 17:81578122-81578144 AGGTGTCAGGAGGGGTGGTCTGG - Intronic
1152831126 17:82497496-82497518 CGGGGTCTGGGTGGGTGGGAGGG - Intergenic
1152876528 17:82789636-82789658 AGGTGACTGCGTGGGCAGTGAGG - Intronic
1153152540 18:2111483-2111505 GGGTGGCTGGGTGGCTAGTGGGG - Intergenic
1153808791 18:8733793-8733815 AGCTGGCTGGGTCAGTGGTGGGG + Intronic
1153956951 18:10104666-10104688 AGGTGAGAGGGTGGGAGGTGGGG - Intergenic
1154098142 18:11440030-11440052 GGGTGTATGGGTGGAAGGTGGGG + Intergenic
1155299807 18:24418931-24418953 AGGTGGCTGGGTGGGCGTGGTGG - Intergenic
1155635073 18:27943003-27943025 AGAAGTGTGGGTGTGTGGTGGGG - Intergenic
1156592791 18:38510459-38510481 AGGTTTCTAGGTGGGTGGGATGG - Intergenic
1157100016 18:44720903-44720925 AGGGGTTGGGGTGGGGGGTGGGG - Intronic
1157248027 18:46071213-46071235 AGCTACCTGGGTGGGTGGTGGGG + Intronic
1157385834 18:47259618-47259640 AGCAGTTTGGGGGGGTGGTGGGG + Intergenic
1157534429 18:48448053-48448075 GTGTGTGGGGGTGGGTGGTGTGG - Intergenic
1158736060 18:60081265-60081287 GGATGTGTGGGTGAGTGGTGGGG + Intergenic
1159603859 18:70454495-70454517 GGCTGGCTGGGTTGGTGGTGGGG + Intergenic
1159863940 18:73682669-73682691 AGTTTTGTGGGTGGGTGGTGGGG - Intergenic
1159889191 18:73938697-73938719 AGGGGTGAGGGTGGATGGTGGGG + Intergenic
1159951423 18:74486879-74486901 GGGTGGGTGGGTGGGTGGGGTGG + Intergenic
1160137592 18:76285853-76285875 GGGAGTCTGGGTGGGTGCAGTGG - Intergenic
1160200007 18:76788560-76788582 AGGAGTATGGGTGCATGGTGTGG - Intergenic
1160380481 18:78451049-78451071 AGCTGACTGGGTGGGTGGGGTGG - Intergenic
1160393046 18:78549696-78549718 AGGTGTGTGAGTGTGTGTTGTGG - Intergenic
1160511731 18:79456714-79456736 TGGAGTCCAGGTGGGTGGTGGGG + Intronic
1160622873 18:80182940-80182962 GGGCGTCTGGCTGCGTGGTGTGG - Intronic
1160692653 19:466956-466978 AGATGGATGGGTGGGTGGTTGGG + Intronic
1160692708 19:467138-467160 AGATGGATGGGTGGGTGGTTGGG + Intronic
1160731535 19:643631-643653 AGGTGCCTGGGCTGGTGGCGAGG + Exonic
1160765446 19:805611-805633 AGCTGCCTGGGAAGGTGGTGTGG - Intronic
1161049639 19:2156331-2156353 ATGTGGCTGGGTGGATGGGGAGG - Intronic
1161090375 19:2357202-2357224 AGGTGTGTGGATGGGTGGGTGGG - Intergenic
1161246368 19:3254627-3254649 AGATGTGTGGGTGGGTGGGTAGG - Intronic
1161259388 19:3328415-3328437 GGGTGACTTTGTGGGTGGTGGGG - Intergenic
1161427344 19:4210776-4210798 AGTTGGCCGGGGGGGTGGTGGGG - Intronic
1161494441 19:4579892-4579914 AGGTTGTGGGGTGGGTGGTGGGG - Intergenic
1161565461 19:4999716-4999738 AGGTGGGTGGGTGGGTGGACAGG - Intronic
1161565556 19:5000073-5000095 AGGTGGGTGGGTGGGTGGACAGG - Intronic
1161633135 19:5369424-5369446 AGGTGGGTGGGTGAGTGGTTGGG - Intergenic
1161679663 19:5673578-5673600 GGGTGGTTGGGTGGGTGGTTAGG - Intergenic
1161887720 19:7009949-7009971 ATGTGTATGTGTGTGTGGTGGGG + Intergenic
1161993625 19:7699160-7699182 AGGTGTAAGGGTGGGCGTTGGGG - Intronic
1162207813 19:9069291-9069313 GGGTGGGTGGGTGGGGGGTGAGG + Intergenic
1162387126 19:10366396-10366418 AGGTGTCTGGGAATGGGGTGGGG - Exonic
1162501308 19:11055539-11055561 AGGTGGCTGTTGGGGTGGTGGGG + Intronic
1162971541 19:14183853-14183875 GGGTGTAAGGGTGGGGGGTGTGG - Intronic
1162975478 19:14205546-14205568 AGGTGTCTGGGTGTGAGCGGAGG - Intronic
1163114410 19:15180547-15180569 GGGTGTGTGGCTGAGTGGTGTGG - Intronic
1163124791 19:15239030-15239052 GGGTGTCTGGGTGGGGCATGGGG - Intronic
1163241559 19:16067027-16067049 AAGTGTGTGTGTGGGCGGTGGGG + Intronic
1163558763 19:18007038-18007060 AGGTGTGTGGGTGGAGGGGGCGG - Intronic
1163571309 19:18083934-18083956 GGGTGAATGGGTGGATGGTGAGG - Intronic
1163675404 19:18653365-18653387 GGATGGGTGGGTGGGTGGTGGGG - Intronic
1163675560 19:18653815-18653837 GGGTGTGTGGGTGGGTGGGTAGG - Intronic
1163719956 19:18894245-18894267 CGGTGGGTGGGTGGGTGGCGGGG + Intronic
1163747299 19:19056008-19056030 CGGTGTGCGGGTGGGTGATGGGG + Intronic
1164449219 19:28345544-28345566 AGGAGTCTGGGAGGCTGGAGAGG - Intergenic
1164534792 19:29077013-29077035 ATGTGTCTGAGTGTGTGGTGGGG - Intergenic
1165038577 19:33052779-33052801 AGGTGTCAGGGCTGGAGGTGAGG + Intronic
1165070110 19:33250827-33250849 TGGTGTCTGTGTGTGGGGTGTGG - Intergenic
1165149805 19:33753834-33753856 TGGTGGGTGGGTGGTTGGTGGGG - Intronic
1165317005 19:35062187-35062209 TGGTGGCAGGGTGGGAGGTGGGG + Intronic
1165445640 19:35855628-35855650 AGGTGCGGGGGTGGGTAGTGTGG - Intronic
1165473577 19:36017030-36017052 AGGGGTCTGGATGGGTATTGAGG - Intronic
1166022614 19:40046093-40046115 GGGTGTGTGGGTGAGGGGTGGGG + Intronic
1166183509 19:41124629-41124651 AGGTGTGTGCGTGTGTGGGGAGG - Intronic
1166226156 19:41396830-41396852 GGGTGTGTGTGTGGGGGGTGGGG + Intronic
1166339867 19:42131058-42131080 AGGTGTCGGGGTGGGATGGGGGG - Intronic
1167030919 19:46959685-46959707 AGGTTTTTGGGTGGGTGCAGTGG - Intronic
1167033512 19:46979001-46979023 ACGTGTGTGTGTGTGTGGTGGGG + Intronic
1167072635 19:47229837-47229859 AGGTGTCTGTGTGAGTTGTCAGG - Intronic
1167230387 19:48279431-48279453 GGGTGTCTGTGTGGGGGGCGGGG + Intronic
1167254420 19:48418702-48418724 CTGTGACTGGGTGGATGGTGGGG + Intronic
1167285397 19:48596276-48596298 AGGCTCCTGGGTGGATGGTGGGG + Intronic
1167330460 19:48852640-48852662 CCGTGTCTGGCTGGGTGCTGTGG - Intronic
1167491003 19:49792591-49792613 AAGGGACTGGGTGGTTGGTGAGG - Intronic
1167565679 19:50255182-50255204 AGATGTGTGGGTGGGTGGAGGGG - Intronic
1168264867 19:55217170-55217192 CGGTGCCAGGGTGGCTGGTGCGG + Intergenic
1168322521 19:55518538-55518560 TGGGGTATGGGTGGGTGGAGGGG - Exonic
925157448 2:1658557-1658579 AGGTGTCGGGGAGGATAGTGGGG - Intronic
925413111 2:3651298-3651320 GGGTGGGTGGGTGGGTGGGGGGG + Intergenic
925505347 2:4556275-4556297 AGGTGTGTGTGGGGGTGGGGTGG + Intergenic
925978397 2:9156811-9156833 TGGTGTATGGGTGGGTGGATGGG + Intergenic
926641703 2:15244602-15244624 GGGTGTCGGGGTGGGTGTGGGGG + Intronic
927099204 2:19775071-19775093 AGGTGTCTGGATGTGTGAAGGGG - Intergenic
927155439 2:20218512-20218534 GTGTGTCTGTGTGTGTGGTGGGG - Intronic
927197158 2:20555907-20555929 AAGGGTCTGGATGGGTGGTCAGG - Intergenic
927514776 2:23665834-23665856 AGGTGTCTGGGTTATGGGTGCGG - Intronic
927890866 2:26748060-26748082 AGGTGTGGGGGTGTTTGGTGGGG - Intergenic
928717500 2:34078566-34078588 AGGAGTCAGGGTGGGGCGTGAGG + Intergenic
929587876 2:43127381-43127403 AGGCGGCTGGATGGATGGTGAGG + Intergenic
930001171 2:46862464-46862486 AGCTGTCTGGCTTGGAGGTGGGG + Intergenic
930003673 2:46879507-46879529 AGGTGGGTGGGTGGGTGGATGGG + Intergenic
930641615 2:53859611-53859633 CGGTGGGTGGGTGGGTGGGGGGG + Intronic
930886566 2:56333192-56333214 AGGAGTGTGGGTTGGAGGTGTGG + Intronic
930894649 2:56431280-56431302 AGGTGTGTGGGGGGGGTGTGTGG - Intergenic
930929452 2:56862572-56862594 AAATGTCTGTGTGGGTGGTGGGG + Intergenic
931277483 2:60756486-60756508 AGATGTCTGCGTAAGTGGTGGGG + Exonic
931867880 2:66432144-66432166 AGATGCGTGGGTGGGAGGTGGGG - Intergenic
931913802 2:66931196-66931218 AAGATTCTGGGTGGGTGGCGAGG - Intergenic
931966913 2:67544952-67544974 AGCTGATTTGGTGGGTGGTGGGG - Intergenic
932104667 2:68931797-68931819 AGGTCTCAGGGTGGTGGGTGGGG - Intergenic
932234322 2:70108920-70108942 TTGTGTGTGGGTGTGTGGTGGGG + Intergenic
932709113 2:74048854-74048876 AGGTGGCTTGGTGGGTGAGGAGG + Intronic
932804141 2:74768606-74768628 AGGTGTCGGGGGTGGTGGGGGGG + Intergenic
933708612 2:85309207-85309229 GGGTTTCTGGTTTGGTGGTGAGG - Exonic
933780513 2:85797428-85797450 AGGTGCCAGGGCAGGTGGTGCGG - Intergenic
933815991 2:86069289-86069311 AGACCTTTGGGTGGGTGGTGAGG + Intronic
934475171 2:94588668-94588690 AGGTGAGTGGGTGGGTGGGGAGG - Intronic
934526516 2:95055598-95055620 GGGTGTGAGGGTGGGGGGTGAGG - Intergenic
934575966 2:95401859-95401881 AGGTGTCTGGGTGGGTGGTGCGG - Intergenic
934638138 2:96009716-96009738 AGGTATCTGGGTGGGTGGTGCGG - Intergenic
934676289 2:96252161-96252183 AGATGCCTGCATGGGTGGTGAGG - Exonic
934795514 2:97095694-97095716 AGGTATCTGGGTGGGTGGTGCGG + Intergenic
935388648 2:102527239-102527261 AGGTGTCAGTATGGGTAGTGTGG - Intronic
936029516 2:109059819-109059841 AGGGGTTTTGGTGGGTGGGGGGG + Intergenic
936039992 2:109142458-109142480 GGGTGCCTGTGTGGGTGCTGGGG - Intronic
936049447 2:109212087-109212109 TGGTGAATGGGTGGTTGGTGCGG + Intronic
936705216 2:115064552-115064574 GTGTGTAGGGGTGGGTGGTGGGG - Intronic
937027441 2:118711252-118711274 AGGTTGGTGGGGGGGTGGTGGGG - Intergenic
937076167 2:119108452-119108474 AAGTGCCTGTGTGGGTGTTGGGG + Intergenic
937180074 2:119987215-119987237 AGGTGGCTGGGTAGGTGGGTGGG - Intergenic
937235468 2:120429425-120429447 AGGGGTCTAGGTTTGTGGTGTGG + Intergenic
937273931 2:120672361-120672383 AGGTGTGTGTGTGTGTGGAGGGG - Intergenic
937326173 2:120990543-120990565 AGGAGTTTCGGGGGGTGGTGAGG - Exonic
937382883 2:121397038-121397060 AGGTTTGTGGGTGGGTGGCACGG + Intronic
937428591 2:121819627-121819649 AGGAGGCTGGGAGGGGGGTGAGG - Intergenic
937981523 2:127619004-127619026 TGGTGGCTGGTTGGGTTGTGGGG + Intronic
937981585 2:127619202-127619224 TGGTGGCTGGCTGGGTGGTGGGG + Intronic
937981610 2:127619271-127619293 TGGTGGCTGGCTGGGTGGTGGGG + Intronic
938042353 2:128086134-128086156 AGGTGTATGGGTCTGGGGTGGGG - Intergenic
938079060 2:128359593-128359615 AGGTGTTTGGGTCAGTGGGGTGG + Intergenic
938188792 2:129255899-129255921 AGGTATCTTGGTGGGTGGGTGGG - Intergenic
938248066 2:129794290-129794312 AGGGATTTGGGTGGGTGTTGGGG + Intergenic
938287596 2:130130278-130130300 AAGTGTTTGGGTAGATGGTGGGG + Intergenic
938427998 2:131208581-131208603 AAGTGTTTGGGTAGATGGTGGGG - Intronic
939608177 2:144277836-144277858 ATGGGATTGGGTGGGTGGTGAGG - Intronic
940021727 2:149163036-149163058 AGGGGTCTCTGTGGGGGGTGGGG + Intronic
940366236 2:152851882-152851904 AGCTACCTGGGTAGGTGGTGGGG + Intergenic
940682774 2:156807192-156807214 AGATGACTGGGTGGGTCATGAGG - Intergenic
940762163 2:157750217-157750239 AGGCTTCTGGGTGGCTTGTGTGG - Intronic
940825175 2:158403378-158403400 AGGTGTCTGTATGTATGGTGTGG - Intronic
941012805 2:160320518-160320540 AGGTGTCTGGGTTGTGGGGGTGG + Intronic
942325527 2:174773190-174773212 AAGTGTCTGGGTGTCTGGAGAGG + Intergenic
942488462 2:176465238-176465260 AGGTTCCTGGATGGATGGTGGGG + Intergenic
942837057 2:180313374-180313396 ATGTGTGTGAGTGTGTGGTGTGG - Intergenic
943082789 2:183276585-183276607 AGGTGTGTGGGTGGGCGGGTGGG - Intergenic
943361631 2:186925694-186925716 AAGTGTGGGGGTGGGGGGTGGGG + Intergenic
943504384 2:188734919-188734941 ATTTGTCAGGGTGGGTGGTCGGG + Exonic
944187720 2:196967872-196967894 AGGTGTCTGGGTCATTGGGGTGG + Intronic
944634039 2:201657149-201657171 AGTGGTCTGGGTGGGAGATGAGG + Intronic
944875573 2:203961338-203961360 AGGTTTCTGTGTGTGGGGTGGGG + Exonic
945133056 2:206595472-206595494 AGGGGTGTGGGGGTGTGGTGGGG + Intronic
945336744 2:208600994-208601016 AGGTGGTGGGGTTGGTGGTGGGG + Intronic
946144414 2:217718131-217718153 ATGTGTGTGTGTGTGTGGTGGGG - Intronic
946145300 2:217726010-217726032 AGGTGTGGGGGAGGGTGGAGTGG - Intronic
946164949 2:217858211-217858233 GGGTATCTGGGTTGGTGGGGGGG - Intronic
946195917 2:218033052-218033074 AGCTGGCTGTGTGGGAGGTGGGG + Intergenic
946200359 2:218067870-218067892 AGCTGGCTGTGTGGGAGGTGGGG + Intronic
946201353 2:218072625-218072647 GGGTGTCTGGAGGGGTGCTGTGG - Intronic
946278368 2:218647752-218647774 AGGGGTCTGGGTGAGTGGGCAGG - Intronic
946336431 2:219040333-219040355 AAGGGTGTTGGTGGGTGGTGGGG - Intronic
946385995 2:219384877-219384899 AGGGGGCTGGGTTGGTGCTGAGG + Intronic
946789633 2:223286953-223286975 AGGTTTTTGCGTGGGTGGAGGGG + Intergenic
946890051 2:224265772-224265794 AGATGGCTGGGTGGTGGGTGAGG + Intergenic
947624779 2:231612771-231612793 AGGTTGTTGGGGGGGTGGTGGGG - Intergenic
947745102 2:232503324-232503346 AGGGGTCTGGGCGGGCGGCGTGG + Intergenic
947994406 2:234515165-234515187 TGGTGTATGTGTGGGTGCTGTGG + Intergenic
948400668 2:237682681-237682703 AGGTCACTGGGTGGGAAGTGGGG - Intronic
948470556 2:238174894-238174916 AGGTGACTGGGTGTCTGGTGTGG + Intronic
948476796 2:238225822-238225844 AGGTGGCTGCGTGGGGGCTGTGG + Intronic
948495465 2:238345868-238345890 AGGCGTCGGGGAGGATGGTGTGG + Intronic
948536642 2:238651991-238652013 AGGTGTCTGGGTCGTGGGAGTGG - Intergenic
948543985 2:238712473-238712495 AGGTGTTTGGGTGATGGGTGAGG - Intergenic
948609788 2:239159530-239159552 GGGTGTGTGTGTGGGAGGTGGGG - Intronic
948671774 2:239573343-239573365 AGGTGTCTGGGTGATTGGATGGG - Intergenic
948992158 2:241560690-241560712 AGGTCTCTGGGTGGGAGCTAGGG + Intronic
1168854877 20:1001626-1001648 AGGAGTCAGGGTGAGTGATGAGG + Intronic
1169028251 20:2387605-2387627 AGCTGTCTGGGCTGGTGCTGTGG - Intronic
1169607907 20:7343557-7343579 GAGTGTGTGGGTGGGAGGTGGGG + Intergenic
1170549399 20:17463661-17463683 ATGTGTGTGTGTGGGGGGTGGGG - Intronic
1170883398 20:20317424-20317446 AGCTGTCTGGGTGTGTGCTGGGG - Intronic
1172033157 20:31995578-31995600 AGGTGTTTGGGTGGGAGATGGGG - Intronic
1172425258 20:34851541-34851563 GGGTGCCTGGATGGGTGGGGTGG + Intronic
1172492549 20:35351918-35351940 AGGTGTATGGTTGGATGCTGTGG + Intronic
1172587381 20:36093894-36093916 AGGGCTCTGGGTGGGTGGGAAGG + Intronic
1172622986 20:36331795-36331817 AGGTGTCTGCTGGGGTGGTCAGG + Intronic
1172803925 20:37597990-37598012 AGGTGGGTGGGTGTTTGGTGGGG + Intergenic
1172865345 20:38092081-38092103 AGGTGACTTGGTGGGTGGGGTGG + Exonic
1172899060 20:38320877-38320899 AGGTGGATGGGTGGGTGGGTGGG + Intronic
1172930651 20:38584078-38584100 AGGAGTGTTGGGGGGTGGTGGGG - Intronic
1172975383 20:38902381-38902403 AGGTGTGTAGGTGGATGGTAAGG + Intronic
1173350155 20:42237512-42237534 AGGTGCTTTGGTGGATGGTGGGG - Intronic
1173354039 20:42270278-42270300 GGGTGGGTGGGTGGGTGGGGTGG + Intronic
1173384082 20:42572389-42572411 AGGGTTCTTGGTGGGTGGTGAGG - Intronic
1173578980 20:44132869-44132891 AGGTGTGGAGGGGGGTGGTGGGG - Intronic
1173582746 20:44159167-44159189 AGGTGGGTGTGTGGGTGGAGGGG + Intronic
1173617321 20:44411524-44411546 AGGGGTGTGGGCGGGTGGGGTGG + Intronic
1173753986 20:45498663-45498685 AGGTGCCTGGGTTGGTTGAGTGG + Intergenic
1173826235 20:46049475-46049497 AGATGAATGGATGGGTGGTGAGG + Intronic
1174541583 20:51293718-51293740 GGGTGGGTGGGTGGGTGGAGGGG - Intergenic
1175150731 20:56931931-56931953 AGTTCCCTTGGTGGGTGGTGGGG - Intergenic
1175387908 20:58608907-58608929 GGAGGTCTGGGTGTGTGGTGGGG + Intergenic
1175429686 20:58892200-58892222 AGGGGTTTGGGTGCGTGTTGGGG + Intronic
1175612932 20:60366789-60366811 AGGTTTGTGTGTGTGTGGTGTGG + Intergenic
1175691179 20:61067098-61067120 TGGGGGCTGGGTGGGTGGGGAGG + Intergenic
1175888213 20:62303982-62304004 AGGTGCCTGGGTTGGAGGTGTGG + Intronic
1175900492 20:62358099-62358121 GGGGGTCTAGGTGGGTGCTGGGG + Intronic
1175901230 20:62360596-62360618 AGGTGGGTGGGTGGGTGGATGGG + Intronic
1176099733 20:63359469-63359491 AGGGGTCTGGGTGGGCAGAGGGG - Intronic
1176105439 20:63383762-63383784 AGGTGCCTGGGTGGTTGGTGGGG - Intergenic
1176189665 20:63802564-63802586 CGGTTTCTGGGAGGGTGCTGGGG - Intronic
1178794880 21:35734664-35734686 GGGTGTGTGGGTGGGAGGCGGGG + Intronic
1179173321 21:38989890-38989912 AGGTTTCTGTGTGAGGGGTGGGG - Intergenic
1179431023 21:41321297-41321319 TGGTGTCTGTGTGGGCGCTGTGG + Intronic
1179522686 21:41955363-41955385 TGGTGTGTGTGTGTGTGGTGTGG + Intergenic
1179824954 21:43958885-43958907 TGGTGTGTGTGTGGGTGGTGGGG + Intronic
1179978158 21:44882449-44882471 AGGGGTCTGGGCAGGTGATGGGG + Intergenic
1180188157 21:46150629-46150651 CTGTGCCTGGGTGGGTGCTGTGG + Intronic
1180731316 22:17984544-17984566 AAGTGACTGGGTGGGGCGTGGGG - Intronic
1180959667 22:19756894-19756916 AGGAGTGTGGGCGGGTGGCGGGG + Intronic
1181025049 22:20123220-20123242 TGGTGTCTGGGGGGCGGGTGTGG + Intronic
1181796786 22:25317365-25317387 AGAGGTCTGGGTGGGGGCTGGGG + Intergenic
1182270105 22:29148037-29148059 AGGTGTCTGGGATGGTGCTCCGG + Intronic
1182367084 22:29786511-29786533 AGGTCTCTGGCTGGGTGCGGTGG + Intergenic
1182546958 22:31082061-31082083 CGGTGCATGGGTGGGGGGTGAGG - Intronic
1182713654 22:32338478-32338500 TGGAGACAGGGTGGGTGGTGGGG - Intergenic
1183423697 22:37726244-37726266 AGGTCACTGGGTGGGTGGCGGGG - Exonic
1183589803 22:38773470-38773492 GGGTGTGTGGGTGGGTGGATGGG - Intronic
1183596987 22:38818736-38818758 GGGGGTCAGGGTGGGAGGTGGGG + Exonic
1183627150 22:39011420-39011442 AGGAGGCTGCGTGGGTGGTAGGG - Intergenic
1183958014 22:41394020-41394042 AGGTGTCTGGGTGTGTGGCGTGG + Intronic
1184038192 22:41928474-41928496 AGGGGTCTGGGTGGCATGTGTGG - Intergenic
1184140187 22:42573907-42573929 AGGGGAGGGGGTGGGTGGTGAGG - Intronic
1184172652 22:42768940-42768962 GGGTGGGTGGGTGGGTGGTGGGG + Intergenic
1184192101 22:42901726-42901748 GGGGGTCAGGGTGGGGGGTGAGG + Intronic
1184239677 22:43205581-43205603 TGGTGAGTGGGTGTGTGGTGTGG - Intronic
1184733337 22:46383053-46383075 AGGTGTCTGGGTCATGGGTGTGG + Intronic
1184788973 22:46687574-46687596 AGGTGGGTGGGTGGGTGGAGTGG - Intronic
1184868586 22:47218937-47218959 AGGTGTCATGGAGGGAGGTGTGG + Intergenic
1185212704 22:49580348-49580370 GTGTGTGTGGGTGTGTGGTGTGG - Intronic
1185275782 22:49949737-49949759 GGGTGTCAGGGTGGGAAGTGAGG - Intergenic
1185334146 22:50264042-50264064 GGGTGGGTGGGTGGGTGGTTTGG - Exonic
1185339043 22:50283519-50283541 GGGTGACTGGGTGGGTGGGGAGG - Intronic
949099653 3:128650-128672 AGGTGACAAGGTGGATGGTGAGG + Intergenic
950117351 3:10460038-10460060 AGGTCACTGGCTGGTTGGTGAGG + Intronic
950204786 3:11071204-11071226 AGGAGTGTGGGCGCGTGGTGCGG - Intergenic
950532215 3:13558792-13558814 AGGTGGGTGGGTGGGTGGGTGGG - Intronic
950898249 3:16473256-16473278 AGGTGACTGGGTGTGCTGTGGGG + Intronic
950932992 3:16809578-16809600 AGGTATAGGGGTGGGTGGAGCGG + Intronic
951695874 3:25445235-25445257 AGGTGTTTGGCTGGGCGGGGTGG - Intronic
952428731 3:33201627-33201649 GGGTGTGTGGGTGGCAGGTGAGG + Intronic
953026597 3:39148665-39148687 GAGTGACTGGGTGGGTGGTGGGG - Intronic
953365165 3:42338047-42338069 TGGTGTTTGGGTGGGTAGAGTGG - Intergenic
953546163 3:43864910-43864932 TGGAGTCTGGGTCAGTGGTGTGG - Intergenic
953684342 3:45064613-45064635 AGGTGTCCGTGGGGGAGGTGGGG + Intergenic
954287254 3:49627731-49627753 AGGTGTCTGGGTGGGTGATGGGG + Intronic
954391856 3:50271733-50271755 AGGAGACTGGGTGGCTGGAGGGG + Intronic
954456316 3:50601546-50601568 AGGTGCCTGGTTGGGAGCTGTGG - Intergenic
954580895 3:51702440-51702462 TGGGGGCTGAGTGGGTGGTGGGG + Intronic
954868135 3:53747049-53747071 CGGTGTCTGGGTGGCTGCTCTGG + Intronic
954888937 3:53905012-53905034 AGGGATCTGGGTGTGTGTTGGGG - Intergenic
955072873 3:55586130-55586152 AGGTGACTGGCGGGGTGGGGAGG + Intronic
955187482 3:56729026-56729048 AAGTGTCTGGATGGATGGAGAGG - Exonic
955611712 3:60764408-60764430 AGGTGGATGGGTAGGTGGGGAGG + Intronic
955804789 3:62722816-62722838 GTGTGTCTGTGTGCGTGGTGGGG + Intronic
956609268 3:71105745-71105767 GTGTGTCTGTGTGTGTGGTGGGG - Intronic
956934254 3:74081902-74081924 AAGGGTCAGAGTGGGTGGTGGGG + Intergenic
957998801 3:87726511-87726533 AGGTGGCTGGGAGGGTTGTCAGG + Intergenic
959419148 3:106111361-106111383 AGGCGGCTGGCTGGGTGGGGGGG + Intergenic
960820019 3:121720307-121720329 AGCTGTCTGGGGAGGTGGTGTGG - Intronic
960995873 3:123339711-123339733 AGGGGTTTGGGTGGGTGGGAGGG - Intronic
961655187 3:128437926-128437948 AGGGGAAAGGGTGGGTGGTGAGG + Intergenic
961669233 3:128517038-128517060 AGGTGTTGGGGTGGGGGGCGGGG - Intergenic
961790167 3:129370096-129370118 TGGTGTGTGGGTGTGTGGTATGG + Intergenic
961821385 3:129577399-129577421 AGGGGGCTGGGTGGGTGGGCAGG - Intronic
962342328 3:134596054-134596076 TGGTCTCTGGGTGGGTGGGTGGG + Intergenic
962357669 3:134708826-134708848 ATGTGTCTGTGTGTGTTGTGGGG + Intronic
962571675 3:136719665-136719687 AGGTGGGTGGGTGGGTGGGTGGG + Intronic
962616477 3:137131609-137131631 GGGTGTCAGGCTGGGTGCTGAGG - Intergenic
962781726 3:138725008-138725030 AGGTGTGGGGGTAGGGGGTGTGG + Intronic
963727358 3:148937385-148937407 AGGGATCTGGGTGGGTGGAGTGG - Intergenic
963851905 3:150217653-150217675 AGGTGTTTGGGGAGGTGGGGAGG + Intergenic
964343753 3:155735207-155735229 ATGTGACTGGGTGGCGGGTGGGG + Intronic
964376416 3:156052346-156052368 AGGTGTGCAGGTGCGTGGTGTGG + Intronic
964517833 3:157531910-157531932 GGCTGTTTGGGTGGGTGGTGTGG - Intronic
964634412 3:158844162-158844184 TGATGACTGTGTGGGTGGTGAGG + Intergenic
965578755 3:170245135-170245157 AGTTGTAGGGGTGGGTGGTTGGG + Intronic
965683371 3:171275087-171275109 TGGTGTCTGGGTTGATGGAGAGG - Intronic
965770360 3:172175380-172175402 AGGCGGATGGGCGGGTGGTGGGG + Intronic
966355256 3:179072332-179072354 AGGTGTGTGTGTGGGTGGGTGGG - Intergenic
967058470 3:185850646-185850668 TGGTGTATGGGTAGGGGGTGAGG - Intergenic
967911267 3:194544499-194544521 AGGTGTTTGGGTGATTGGGGAGG + Intergenic
968051884 3:195660153-195660175 AGCTGTGTGTGTGTGTGGTGGGG + Intergenic
968194505 3:196695339-196695361 GGGTGTGTGGGTGTGTGGTGTGG - Intronic
968349245 3:198038981-198039003 AGGTGGCTGGGTTGCTGATGAGG - Exonic
968480149 4:829611-829633 AAGGTTCTGGGTGGGTGCTGTGG - Intergenic
968616771 4:1580870-1580892 CGGTGCCTGGGTGGGAGGCGGGG - Intergenic
968616816 4:1580979-1581001 CGGTGCCTGGGTGGGAGGCGGGG - Intergenic
968616861 4:1581088-1581110 CGGTGCCTGGGTGGGAGGCGGGG - Intergenic
968616906 4:1581197-1581219 CGGTGCCTGGGTGGGAGGCGGGG - Intergenic
968919918 4:3517155-3517177 GGGTTTGGGGGTGGGTGGTGAGG + Intronic
968946123 4:3665444-3665466 GGGTGTATGGATGGGTGGTTGGG - Intergenic
969341683 4:6545950-6545972 AGTTCCCTGGGTGGGGGGTGGGG + Intronic
969421737 4:7101690-7101712 GGGTGGGTGGGTGGGTGGGGGGG + Intergenic
969494103 4:7516043-7516065 TGGTGTCTGGGTGGGCACTGTGG + Intronic
969683037 4:8653642-8653664 TGGGGTCTGGGCAGGTGGTGGGG + Intergenic
969702214 4:8773868-8773890 AGGACGCTGGGAGGGTGGTGTGG - Intergenic
969836974 4:9850243-9850265 AAGTGTCTGTGGGGGTTGTGGGG - Intronic
971173916 4:24262398-24262420 AGGTGTGGGGCTGGGGGGTGAGG + Intergenic
971348875 4:25838647-25838669 AGGGGCCAGGGTGGGTGGCGGGG - Intronic
971791172 4:31171592-31171614 CCGTGTGTGGGTGGGTGGAGGGG - Intergenic
971949595 4:33327723-33327745 GGGTGGCGGGGTGGGGGGTGTGG - Intergenic
972588964 4:40465977-40465999 AGTTGACTGGCTGGGTGCTGTGG + Intronic
973155241 4:46943629-46943651 AGGTGGCTGAGAGGGTGGTTTGG - Intronic
973710162 4:53621936-53621958 AGGTGGTGGGGTGGGTAGTGGGG - Intronic
975347244 4:73306217-73306239 AGGTGTTTGGCTGGGTGTGGTGG + Intergenic
975870226 4:78772038-78772060 GTGTGTCTGGGTGGGTGGGTGGG - Intergenic
976204250 4:82609524-82609546 AAGTGTATGTGTGGGTGGAGGGG - Intergenic
976484069 4:85580118-85580140 ATGTGTTTGTGTGTGTGGTGGGG + Intronic
977561480 4:98537657-98537679 AGCTCTCTGGGAGGGCGGTGAGG - Intronic
977952345 4:102987097-102987119 AGGTGTGTGTGTTGGGGGTGGGG + Intronic
978030831 4:103938642-103938664 AGTTGTCTGTGTGAGGGGTGGGG + Intergenic
978795623 4:112705454-112705476 AGGTGGGTGGGTGGGTGGGTGGG + Intergenic
979025412 4:115566962-115566984 AGGTGTCTGGCTGGGCGCGGTGG - Intergenic
980644885 4:135630976-135630998 ATGTGTGTGTGTGTGTGGTGGGG - Intergenic
981423447 4:144577582-144577604 AAGTTACTGGGTGGCTGGTGAGG - Intergenic
981466211 4:145075729-145075751 AGATGCCTGGGGGGGTTGTGGGG - Intronic
981527023 4:145716661-145716683 ATGTGTCTATGTGTGTGGTGGGG + Intronic
981761518 4:148200345-148200367 AGGGGGCTGTGTGGGGGGTGGGG - Intronic
983531043 4:168810078-168810100 TGGTGTCTCGGTGGCTGCTGAGG + Intronic
983871414 4:172828473-172828495 CTGTGTCTGGGTATGTGGTGTGG - Intronic
984442149 4:179786037-179786059 AGGTTTCTGGGTCTGTGGTTTGG + Intergenic
984727750 4:183037692-183037714 AGGTGCCTGGGTGCGCGCTGGGG - Intergenic
985309667 4:188583564-188583586 AAGTCTCTGGGTGGAAGGTGAGG - Intergenic
985560821 5:584947-584969 GGGTGGCTGGGTGGGTGGGCAGG + Intergenic
985560851 5:585051-585073 AGATGGATGGGTGGGTGGTTGGG + Intergenic
985632492 5:1021363-1021385 GGGTGGGTGGGTGGGTGGAGGGG - Intronic
985782076 5:1876658-1876680 AGGGCTCGGGGTGGGGGGTGGGG + Intergenic
985874620 5:2585470-2585492 AGGTGAATGGGTGGGTGGATAGG + Intergenic
985882945 5:2654340-2654362 AGGTGTGTAGGTGAGGGGTGAGG + Intergenic
986169673 5:5305389-5305411 ATGTGTGTGTGTGTGTGGTGTGG - Intronic
986332831 5:6730188-6730210 AGGTGCCTTTGTGGGTGCTGGGG - Intronic
986486757 5:8245657-8245679 GGGTGTGGGGGTGGGTGGTGTGG - Intergenic
987890732 5:23874178-23874200 ATTTGTCTGGGTGGGTGTGGTGG + Intergenic
988254986 5:28809430-28809452 AGGTCTCAGGGCGGGCGGTGGGG + Intergenic
988534214 5:32051820-32051842 AGTTGTCTGGGTTTGTGGTTTGG + Intronic
988776890 5:34485157-34485179 AGGGGTGGGGGTGGGAGGTGAGG - Intergenic
989956914 5:50369814-50369836 AGGAGTGTGGGTGCATGGTGTGG + Intergenic
990248171 5:53884366-53884388 GGATGGGTGGGTGGGTGGTGGGG - Intronic
990461053 5:56031463-56031485 GAGTGTGTGGGTGGGTGGTGAGG + Intergenic
991394678 5:66191757-66191779 AGGTATTTGGGTGGATGGTGGGG + Intergenic
991543022 5:67750806-67750828 AGCTGTCTGGGGAGGTGGTGGGG - Intergenic
992135290 5:73738073-73738095 TGCTGTCGGGGTGGGTGCTGAGG + Intronic
992171301 5:74104580-74104602 AGGTGTGTGTGTGTGTTGTGGGG - Intergenic
992210523 5:74475132-74475154 GGGTGTGTGGGTGGGGGATGGGG + Intergenic
992852494 5:80824446-80824468 AGATTTCTGGGAGGGAGGTGGGG - Intronic
992862584 5:80927361-80927383 GTGTGTGTGGGTGGGTGGGGTGG - Intergenic
993441687 5:87964380-87964402 ATGTGTGTGGGAGGGTGTTGAGG - Intergenic
993962781 5:94320479-94320501 AGGGGTGTGGGGTGGTGGTGAGG - Intronic
994050069 5:95352608-95352630 GGGTTGCGGGGTGGGTGGTGAGG - Intergenic
994113436 5:96034769-96034791 AGGGGTCGGGGTGGTTGGAGTGG - Intergenic
994474996 5:100256529-100256551 GGGTGGGTGGGTGGTTGGTGGGG - Intergenic
995283706 5:110363142-110363164 AGGAGCAAGGGTGGGTGGTGGGG + Intronic
996467606 5:123821703-123821725 TGGAGTCTGGGGGTGTGGTGGGG - Intergenic
996508850 5:124296885-124296907 AAGTGTTAGGGTGGTTGGTGGGG - Intergenic
996783274 5:127211967-127211989 AGGTGTCTAGGGGAGTGCTGGGG + Intergenic
996948123 5:129094576-129094598 CGGCGTAAGGGTGGGTGGTGGGG - Intergenic
997027383 5:130081313-130081335 AGGTGTGTGTGTTGGTGGGGTGG + Intronic
997085475 5:130792555-130792577 AAGGGGCTGGGTGGGTGGAGTGG + Intergenic
997980788 5:138466303-138466325 AGCTGCGTGGGTGGGTGGAGGGG + Intronic
997999304 5:138611245-138611267 GTGTGTATGGGTGGGTGTTGGGG + Intronic
998228506 5:140344844-140344866 AGCCGTGTGGGTGGGGGGTGGGG + Intronic
998372962 5:141672832-141672854 AGGGGTCGGGGTGGTTGGGGGGG + Exonic
998887005 5:146705437-146705459 ATGAATCTGGGTGGGTGGTGGGG + Intronic
999179025 5:149655723-149655745 TGGTGTGTGTGTGTGTGGTGTGG - Intergenic
999179027 5:149655743-149655765 TGGTGTGTGTGTGTGTGGTGTGG - Intergenic
1000303537 5:159975869-159975891 AGCAGTCTGGGTGGCTGGAGAGG - Intergenic
1000351076 5:160353483-160353505 GTGTGTGTGAGTGGGTGGTGGGG - Intronic
1000369108 5:160517950-160517972 GTGTGTCTGTGTGTGTGGTGGGG + Intergenic
1000805557 5:165786273-165786295 AAGTGACTAGGTGGTTGGTGTGG - Intergenic
1001490988 5:172155107-172155129 GGGTGGCTGGGTGGGTGGGTGGG + Intronic
1001641543 5:173247347-173247369 AGATGTGTGGGTGGGAGATGAGG + Intergenic
1001699442 5:173696094-173696116 AGGTGACCAGGTGTGTGGTGGGG + Intergenic
1001772856 5:174308954-174308976 AGGTGTCTGCCAGGGTGATGGGG - Intergenic
1002172945 5:177385563-177385585 AGGGGTGTGTGTGTGTGGTGAGG + Intronic
1002346052 5:178547941-178547963 AGGTGTGTGGGTGTGTGTGGGGG - Intronic
1002370210 5:178746091-178746113 AGGTGTCTAGGGGAGTGTTGGGG - Intergenic
1002401003 5:178991589-178991611 GGGTGTGTGGGTGGGTGGGACGG - Intronic
1002526448 5:179818408-179818430 AAGTGTCCGCGTGGGTGCTGGGG - Intronic
1002685475 5:181005900-181005922 CTGTGTCTGGGTCTGTGGTGTGG - Exonic
1003285997 6:4734400-4734422 AGGTGGCTGGCTGTCTGGTGGGG - Intronic
1003603310 6:7538659-7538681 ATGTGTGTGGGTGTGTGTTGAGG + Intergenic
1004682410 6:17909246-17909268 AGGTTTTTGGCTGGGTGCTGTGG + Intronic
1004854027 6:19731263-19731285 AGGGGGCTGTGGGGGTGGTGGGG - Intergenic
1005582633 6:27249070-27249092 GAGTGTATGGGTGGGGGGTGGGG - Intronic
1005914376 6:30339994-30340016 AGGAGTTTGGGTTGGGGGTGAGG + Intronic
1005919740 6:30390155-30390177 GTGTGTCTGTGTGTGTGGTGGGG + Intergenic
1005972053 6:30769235-30769257 AAGTGGCAGAGTGGGTGGTGGGG + Intergenic
1006269698 6:32954414-32954436 GGGTGGCTGGGTGGGTGGTCAGG + Intronic
1006337218 6:33427004-33427026 GGGTGGGTGGGTGGGTGGTCAGG + Intronic
1006522799 6:34581743-34581765 AGTTGTCAGGGTGGGTTGGGAGG - Intergenic
1006715806 6:36119609-36119631 AGGGGTCTGGGGTGGTGGTGGGG - Intergenic
1007077227 6:39075492-39075514 AGGTCTCTGAGTGGGAGATGGGG + Intronic
1007136948 6:39531685-39531707 TGGTGTCTGGGTGGCTGGTGAGG - Intronic
1007325743 6:41058273-41058295 GTGTGTGTGGGTGTGTGGTGGGG - Intronic
1007420511 6:41716471-41716493 CTGTGAGTGGGTGGGTGGTGGGG - Intronic
1007481557 6:42153727-42153749 AGGTGTCTGGGTGTGGGTTTGGG - Intergenic
1007582292 6:42966717-42966739 ATGTAGATGGGTGGGTGGTGAGG - Intronic
1007769568 6:44182065-44182087 ATGTGTGTGTGTGTGTGGTGTGG - Intronic
1007769570 6:44182110-44182132 ATGTGTGTGTGTGTGTGGTGTGG - Intronic
1007769576 6:44182247-44182269 ATGTGTGTGTGTGTGTGGTGTGG - Intronic
1007815017 6:44515884-44515906 AGGGGTTGGGGTGGGAGGTGAGG - Intergenic
1008218245 6:48822523-48822545 AGACTTCTGGGTGGGTGGGGAGG + Intergenic
1008670379 6:53762127-53762149 AGGAGGTTGGGTGGGGGGTGAGG - Intergenic
1009529587 6:64794851-64794873 CTGTGTGTGGGTGGTTGGTGGGG - Intronic
1010385887 6:75279113-75279135 AGGTGTGTGGGGGGGTGGGCAGG + Intronic
1010641621 6:78335745-78335767 AGGCATGTGGGTGGGTGATGGGG - Intergenic
1010791668 6:80072136-80072158 TTGTGTGTGGGTGGGTGGAGCGG - Intergenic
1010900721 6:81424042-81424064 AGGTGTGTGGGGAGGTGTTGGGG + Intergenic
1011124241 6:83989064-83989086 ATGTGTGTGTGTGTGTGGTGAGG - Intergenic
1011202699 6:84854965-84854987 AGGGGTCTTGGTGGGTGGTGAGG - Intergenic
1011842247 6:91516274-91516296 AGGTGTATGTGTGTGTGTTGAGG + Intergenic
1011851764 6:91638276-91638298 AGGCATCTGAGGGGGTGGTGTGG - Intergenic
1012598922 6:101070637-101070659 AGGAGTGTGGGTGCATGGTGTGG + Intergenic
1013597181 6:111670761-111670783 TGGTGGGTGGGTGGGTGGTGGGG + Intronic
1014574521 6:123053731-123053753 ATGTGTCTGTGTGGGGGGCGTGG + Intronic
1015620219 6:135124141-135124163 AGGTTTCTGGGTGGGTGACAGGG - Intergenic
1016428324 6:143957289-143957311 AGGAGTCTGGTGGGGGGGTGAGG + Intronic
1016900666 6:149097533-149097555 AGGTGTGTGGGTGGGTTCTCAGG - Intergenic
1017048883 6:150372250-150372272 GTGTGTGTGGGTGGGTTGTGGGG + Intronic
1017048922 6:150372433-150372455 ATGTGTGTGTGTGGGTGGGGTGG + Intronic
1017048940 6:150372496-150372518 ATGTGTGTGGGGGGGTGGGGTGG + Intronic
1017048950 6:150372559-150372581 ATGTGTGTGTGTGGGCGGTGTGG + Intronic
1017288072 6:152701564-152701586 GGGTGTGTGGATGGGTGGAGGGG + Intronic
1017637838 6:156460386-156460408 AGGTGGCTGTGTGGCAGGTGGGG - Intergenic
1018027249 6:159816148-159816170 AGGGGTGTGGGGGGGTGGGGAGG - Intronic
1018538973 6:164856259-164856281 AGGTGTGTGGGTGGGTGGACGGG + Intergenic
1018718185 6:166551730-166551752 AGGTGCCTGGTGGGCTGGTGAGG - Intronic
1018871930 6:167790273-167790295 AGGGGTATGGGTGGATGGTGGGG - Intronic
1018871939 6:167790293-167790315 AGGGGTATGGGTGGATGGTGAGG - Intronic
1018871946 6:167790313-167790335 AGGGGTATGGGTGGATGGTGAGG - Intronic
1018925835 6:168206422-168206444 AGATGCCTGGGAGGGTGGCGTGG + Intergenic
1018978997 6:168588003-168588025 TGGTGTCGGGGTGAGGGGTGAGG + Intronic
1019165375 6:170094788-170094810 AGGTGTCTGGCTGGCTGGCAGGG - Intergenic
1019300229 7:299368-299390 AGGTGACTGGGAGGGTGCAGCGG - Intergenic
1019481483 7:1268913-1268935 AGGTGTCAGGGAGGGAAGTGGGG - Intergenic
1019541957 7:1555610-1555632 TGGTGTCCGTGTGGGGGGTGCGG - Intronic
1019556507 7:1634102-1634124 AGGTGCCTGGGTGGGTGCTCAGG + Intergenic
1019615130 7:1955978-1956000 AGGTGGGTGGGGGGGTGGGGTGG + Intronic
1019951689 7:4378330-4378352 AGGAGCCTGGCTGGGTGGTCTGG + Intergenic
1019956602 7:4419943-4419965 ATGTCACTGGGTGGGTGCTGTGG - Intergenic
1020021399 7:4871666-4871688 GTGTGTGTGGGAGGGTGGTGTGG - Intronic
1020110957 7:5447469-5447491 AGGTGGGTGGGTGGGTGGGTAGG + Intronic
1020917696 7:14216785-14216807 ATGTGTATGTGTGGGTGGGGAGG + Intronic
1020968429 7:14902536-14902558 TGGCTTCTGGGTGTGTGGTGCGG - Intronic
1021214690 7:17901325-17901347 TGGTGTCTCACTGGGTGGTGCGG + Intronic
1021359340 7:19692234-19692256 AGGAGTGTGGGTGTGCGGTGCGG - Intergenic
1021664551 7:22962769-22962791 TGGTGGCTGGGGCGGTGGTGGGG - Intronic
1021887440 7:25153417-25153439 AGGTGGGTGGGTGGGTGTGGTGG + Intronic
1022003336 7:26245895-26245917 AGGGGTCTGGGTGGATGGATTGG - Intergenic
1022248061 7:28580364-28580386 GGGTGTCTGTGTGTGTGGGGGGG + Intronic
1022292035 7:29014109-29014131 AGCTCTCTGGCTGGGAGGTGGGG + Intronic
1023312451 7:38902086-38902108 AGCTGTTTGGGTAGGTGGTTGGG - Intronic
1023340758 7:39216925-39216947 GGGTGTGTGTGTGGGTGGGGAGG - Intronic
1023761402 7:43468093-43468115 TGGTGTGTGTGTGTGTGGTGGGG - Intronic
1023837943 7:44079526-44079548 GGGTGAGTGGGTGGGTGGGGAGG - Intronic
1026665830 7:72338948-72338970 GGGGGGCTGGGTGGGGGGTGAGG - Intronic
1026845838 7:73698783-73698805 GGGTGTCTGGGAGTGGGGTGAGG + Intronic
1026904840 7:74056948-74056970 AGGTGTCTGGCAGGGTTGGGTGG + Intronic
1027263585 7:76481634-76481656 AGCTGAGTGGGTGGGAGGTGGGG + Intronic
1027314957 7:76979746-76979768 AGCTGAGTGGGTGGGAGGTGGGG + Intergenic
1027424870 7:78052235-78052257 AGGTGTTTGGGTCATTGGTGTGG + Intronic
1028033166 7:85944410-85944432 GGGTGTGTGTGTGTGTGGTGGGG - Intergenic
1028126840 7:87122809-87122831 AGGTGATGGGGTGGGTGGTTTGG - Intergenic
1029346350 7:99981302-99981324 TGGTGTCTGAGTGTGGGGTGAGG - Intergenic
1030083065 7:105793971-105793993 AGGTGGATGGATGGGTGGGGTGG - Intronic
1030457018 7:109788196-109788218 CGGTGTGTGGGTGGGTGGATGGG + Intergenic
1030670105 7:112326151-112326173 AGGGGTATGGGTGGGTTGGGAGG - Intronic
1031660387 7:124416937-124416959 ATGTGTATGGGTGGGGGGTGAGG - Intergenic
1032296728 7:130645557-130645579 ATGTGGCTGGGTGGGTGCCGGGG - Intronic
1033036274 7:137878905-137878927 GTGTGTGGGGGTGGGTGGTGGGG + Exonic
1033145785 7:138869144-138869166 AGGTGACAGAGTGGGAGGTGAGG + Intronic
1033161627 7:139001988-139002010 ACGACTCTGGGTGAGTGGTGGGG + Intergenic
1033243269 7:139698733-139698755 TGGTGGCGGGGTGGGTGGTAAGG - Intronic
1033422498 7:141216467-141216489 GTGTGTGTGGGTGTGTGGTGGGG + Intronic
1034353902 7:150435606-150435628 GGGTGTCTGGGGTGCTGGTGGGG + Intergenic
1034391698 7:150792241-150792263 CAGTGCCTGGGTGGGTGGAGAGG - Intronic
1034517051 7:151589274-151589296 ATGTCTCTGGGTGGGAGTTGGGG - Intronic
1034563732 7:151897352-151897374 AGGTGTCTGGATGGTGGGGGCGG - Intergenic
1034843618 7:154422656-154422678 AGGTGGATGGGTGGGTGGATGGG + Intronic
1035183969 7:157111492-157111514 AGGAGTCGGGGTGGGTGCTTTGG + Intergenic
1035516562 8:238511-238533 AGGTTTCTGGCTGGGTGCGGTGG + Intronic
1035563392 8:625473-625495 CGGGGTCTGGGTGCATGGTGAGG + Intronic
1035713933 8:1739483-1739505 AGGTGTCTGGGTCACTGGTGTGG + Intergenic
1035739160 8:1913129-1913151 AGTTGTGGGGGTGGGTGGGGAGG + Intronic
1036233475 8:7019239-7019261 TGCTGTCTGGGTGTGTGCTGCGG + Intergenic
1036796470 8:11759786-11759808 AGGGGTCTGGGCGTGTGGGGAGG - Exonic
1037092908 8:14945150-14945172 TTGTGTGTGGGTGGGTGGGGGGG + Intronic
1037816565 8:22115668-22115690 AGGTGTCTGGGATCGGGGTGGGG - Exonic
1039438950 8:37581411-37581433 TGGGGTCTGTGTGGGTGCTGGGG - Intergenic
1040471094 8:47736776-47736798 AGGTGTGTGTGTGGGGGGGGCGG - Intergenic
1040584591 8:48727172-48727194 AGGTGGATGGGTGGGTGGGTGGG - Intronic
1040907066 8:52480057-52480079 AGGTTTCTAGGTGAGTGGTTGGG - Intergenic
1041467121 8:58168007-58168029 ATGTGACTGGGTGGGGGGTGGGG - Intronic
1041887692 8:62830764-62830786 AGTTCTCTGCATGGGTGGTGGGG - Intronic
1042224795 8:66506910-66506932 AGGTGGGTGGGTGGGTGGGTGGG + Intronic
1042311343 8:67381887-67381909 GGGTGGCAGGGTGGGTGGTCAGG + Intergenic
1042527369 8:69777501-69777523 GTGTGTGTGGGTGGGGGGTGGGG + Intronic
1042559674 8:70063978-70064000 AAGTGTTTTGGTGGGTGGTGTGG - Intronic
1042649567 8:71024407-71024429 AGCTCTCTGGGTGGATGTTGGGG + Intergenic
1042677190 8:71334633-71334655 AGGTGTGTGTGTGTGTGGTGGGG - Intronic
1042823835 8:72960378-72960400 GGGTGTCTTGGTGAGGGGTGAGG - Intergenic
1043243464 8:77967149-77967171 CGGTGTGTGTGTGCGTGGTGTGG + Intergenic
1043645001 8:82506808-82506830 AGGTATCTGGCTGGGTGTGGTGG + Intergenic
1044452886 8:92359098-92359120 AAGTGGGAGGGTGGGTGGTGAGG - Intergenic
1044792600 8:95863361-95863383 AAGAGGCAGGGTGGGTGGTGAGG - Intergenic
1044992357 8:97807325-97807347 GGGAGCCTGGGAGGGTGGTGGGG + Intronic
1046184071 8:110690334-110690356 AGGTGTGAGGGTGGGAGGAGCGG - Intergenic
1047355704 8:124119598-124119620 AGGTGTCTGGGCGGCTGAGGGGG - Exonic
1047641776 8:126828433-126828455 AGGTGTCTGTGTGTGTTGGGGGG - Intergenic
1047785648 8:128151749-128151771 GGGTGGCTGGGTGGGTGGAAGGG + Intergenic
1048159806 8:132005539-132005561 TGGGGCCTGGGTGGGGGGTGTGG - Intronic
1048290270 8:133175931-133175953 AAGTGTCTGGGCTGGTGCTGAGG + Intergenic
1048292973 8:133194465-133194487 GGGTGTGTGTGTGTGTGGTGGGG + Intronic
1048321603 8:133404479-133404501 TGGTGTGTGTGTGTGTGGTGCGG - Intergenic
1048981376 8:139704650-139704672 GGGTGGCTAGGTGGGGGGTGGGG - Intergenic
1048988324 8:139747413-139747435 AGGTGTCAGAGTGGGTGTGGAGG + Intronic
1049041698 8:140116968-140116990 CTGTATCTGGGTGGTTGGTGTGG - Intronic
1049317205 8:141975583-141975605 AGGGGTTTGGGTGGGTGGGGGGG + Intergenic
1049323185 8:142008206-142008228 ATGTGTCTGTGTGGTGGGTGTGG - Intergenic
1049582354 8:143418420-143418442 AGATGAGTGGGTGGGTGGGGGGG - Intergenic
1049747651 8:144269823-144269845 TGGTGCCTGGGAGGGTGGCGGGG - Intronic
1049800125 8:144513805-144513827 AGGGGTCGGCGTGGGCGGTGGGG + Intronic
1049800135 8:144513835-144513857 AGGGGTCGGCGTGGGCGGTGGGG + Intronic
1050151337 9:2621974-2621996 AGGTGGCTGGGTGGGTGGGGAGG + Exonic
1050491328 9:6191050-6191072 AGCTGTGTGGGTGGCTGTTGTGG + Intergenic
1051648815 9:19299447-19299469 TGGTAACTGGGTGGATGGTGGGG + Intronic
1051750936 9:20340387-20340409 CCGTGTCTGGGTGGGTGGTCTGG - Intergenic
1052854882 9:33401094-33401116 AGGCGAGTGGGTGGGTGGGGAGG + Intronic
1053030899 9:34777229-34777251 AGTAGGCTGGGTGGGTGGGGAGG + Intergenic
1053463049 9:38285381-38285403 AGATGGCTGGGTGGCTGGAGGGG - Intergenic
1053682901 9:40497423-40497445 AGGCGAGTGGGTGGGTGGGGAGG + Intergenic
1054280813 9:63127505-63127527 AGGCGAGTGGGTGGGTGGGGAGG - Intergenic
1054296001 9:63332923-63332945 AGGTGAGTGGGTGGGTGGGGAGG + Intergenic
1054394017 9:64637418-64637440 AGGCGAGTGGGTGGGTGGGGAGG + Intergenic
1054428666 9:65142630-65142652 AGGCGAGTGGGTGGGTGGGGAGG + Intergenic
1054501713 9:65878912-65878934 AGGCGAGTGGGTGGGTGGGGAGG - Intronic
1055168312 9:73223633-73223655 TGGTGACTGTGTGGGTGGTCAGG - Intergenic
1055939524 9:81636438-81636460 AGGCTTCTGGGTGGGGGGTGGGG + Intronic
1056184270 9:84118199-84118221 ATGTGTCTGGCTGGGGGCTGTGG - Intergenic
1056241952 9:84656503-84656525 AAGATTCTTGGTGGGTGGTGAGG + Intergenic
1056303620 9:85268191-85268213 AGGGGTCAGGGTGGGAGGAGGGG - Intergenic
1056753987 9:89371169-89371191 AGGTGTGTGTGGGGGGGGTGTGG + Intronic
1056754118 9:89371752-89371774 TGGTGTGTGTGTGGGGGGTGTGG + Intronic
1057211683 9:93204037-93204059 TGGTGTGTGTGTGTGTGGTGGGG + Intronic
1057547132 9:96027159-96027181 TGGTGTGTGTGTGTGTGGTGTGG - Intergenic
1057547654 9:96030290-96030312 TGCTGGCTGGGTGGGTGGGGTGG - Intergenic
1057729446 9:97596161-97596183 AGGTGACTGGCTGGCTGGGGTGG - Intronic
1057794540 9:98146045-98146067 AGGTGCCTGGGAGAGTGGAGAGG - Intronic
1057836255 9:98447802-98447824 AGTTGGTAGGGTGGGTGGTGGGG + Intronic
1057942561 9:99297655-99297677 AGAAGTCTGGGTTGGGGGTGGGG + Intergenic
1057946913 9:99338134-99338156 AGGTCACTGGATGGATGGTGGGG + Intergenic
1058847211 9:108972838-108972860 AGATGTGTGTGTGGGTGGGGGGG + Intronic
1058896730 9:109406609-109406631 AGGTGTCCGCCTGGGTGGTGGGG + Exonic
1059308159 9:113370701-113370723 AGGTGACTGGGTGGATGTTGTGG + Exonic
1059383879 9:113949372-113949394 AGGGGTCTGGAGGGATGGTGGGG - Intronic
1059408433 9:114116824-114116846 AGGTGTGTGCATGGGAGGTGGGG - Intergenic
1059496829 9:114717134-114717156 AGAAGCCTGGGTGGGTGGGGGGG - Intergenic
1059922772 9:119177223-119177245 AGCTGTGTGGGTGGATGGTACGG - Intronic
1060015497 9:120083077-120083099 AGGTGGGGGGGTGGGTGGGGCGG - Intergenic
1060108103 9:120887165-120887187 AGGTTTCTGGCTGGGTGCGGTGG + Intronic
1060198163 9:121636459-121636481 TGGTGGCTGGGTGGGAGGAGAGG + Intronic
1060301092 9:122375095-122375117 AGGTGTCAGGGTGGGCGGAGAGG - Intronic
1060552508 9:124492325-124492347 AGGGGTCAGGATGGGAGGTGGGG - Intronic
1060602260 9:124886191-124886213 AGCTGTCTGGGCGGGAGGTAGGG + Intronic
1060708169 9:125827023-125827045 AGGGGTGTGGGTGGGAGGTGTGG - Intronic
1060769020 9:126317341-126317363 ATGTGTGTGGGTGGGTGGGGGGG + Intergenic
1060769933 9:126325921-126325943 GGGTGCCTGGCTGGGCGGTGTGG + Intergenic
1060792541 9:126496280-126496302 AGGTGTATGGATGGGTGGAAGGG - Intronic
1061081451 9:128373177-128373199 AGGTGGGTGGGTGGGTGGGTGGG - Intronic
1061651506 9:132054174-132054196 AGGTGTTTGGGTGAGCGGGGCGG + Intronic
1061667358 9:132168362-132168384 AGGTCTCTGGGTTTGTGGTGGGG + Intronic
1061715998 9:132519214-132519236 AGGTGAGTGGGTGGATGGTTGGG + Intronic
1061879455 9:133561452-133561474 AGGAGTTTGGGTGTCTGGTGAGG + Intronic
1062020689 9:134318086-134318108 AGCTGGCTGGGTGGGGGGTATGG - Intronic
1062112137 9:134787981-134788003 AGGTGGCTGGGTGAGTGGAGGGG + Intronic
1062112612 9:134790389-134790411 GGGTGGCTGGGTGGGTGGGTGGG - Intronic
1062130285 9:134888773-134888795 AGCCCCCTGGGTGGGTGGTGTGG - Intergenic
1062135993 9:134928867-134928889 AGGTCTCTGGGTGGGTGAAGGGG - Intergenic
1062180581 9:135189167-135189189 ATGTGGCTTGGTGGGGGGTGTGG - Intergenic
1062390157 9:136330605-136330627 GGGTGTCTGGCTGGGGGATGGGG + Intronic
1062483329 9:136762477-136762499 AGATGTCTGGGAGGTTGGGGTGG + Intronic
1062665400 9:137668402-137668424 AAATGGATGGGTGGGTGGTGAGG - Intronic
1203780694 EBV:99237-99259 AGGTGCCCGGGTGCGTGGTCGGG - Intergenic
1185624827 X:1474196-1474218 AGGTGGATGGGTGGGTGGATGGG + Intronic
1185736492 X:2500471-2500493 AGGTGTCAGGGTGCGCGGGGGGG + Intronic
1185867800 X:3639099-3639121 AGGTGTGTGGGTGGGTGGGTGGG + Intronic
1185967912 X:4628538-4628560 AGGTATTTGGGAGGGTGGTTAGG + Intergenic
1186180209 X:6966834-6966856 AGGTGGCTGGGTGGGTGCAGTGG - Intergenic
1186347351 X:8707762-8707784 AGGTGTCTGCCGGGGTGGGGAGG + Intronic
1186438517 X:9564792-9564814 AGGGATGTGGGTGGGTGTTGCGG + Intronic
1186508875 X:10115965-10115987 GGGTGGCTGGGTGGGTGGCTGGG - Intronic
1186539171 X:10382650-10382672 AGGTGTGTGTGTATGTGGTGGGG + Intergenic
1186540564 X:10395923-10395945 AGGTACGTGTGTGGGTGGTGGGG - Intergenic
1187032233 X:15499847-15499869 ATGTGTCTGTGTGGGGGGGGGGG - Intronic
1187146466 X:16641841-16641863 AAGTGTAGGGGTGGGAGGTGGGG + Intronic
1187533401 X:20116451-20116473 AGGTGCCTGAGGGGGTGCTGCGG - Intronic
1187754061 X:22500578-22500600 AGGTGTGTGTGTGTGTGGGGGGG + Intergenic
1188216430 X:27483638-27483660 GGGTGTCTGAGTGGAAGGTGTGG + Intergenic
1188371608 X:29376478-29376500 AGCTATCTGGGTGGCTAGTGAGG - Intronic
1188539515 X:31234103-31234125 AGGTGACTGGGTGGGAACTGGGG - Intronic
1189207835 X:39257031-39257053 AGGTGGCTGGGGGAGGGGTGGGG - Intergenic
1189267019 X:39725064-39725086 AGGTAACTGGGTGGGTGGCTGGG - Intergenic
1189365237 X:40383195-40383217 AGGTGTATTGGTGATTGGTGGGG + Intergenic
1189890117 X:45592131-45592153 AGGGGGATGGGTGGGGGGTGGGG - Intergenic
1190005714 X:46735900-46735922 AGGTGTCTGGGTGCGGGGAGAGG - Intronic
1190055930 X:47181156-47181178 AGGTGTGGGGGTGGGGGGTGGGG - Intronic
1190065977 X:47242052-47242074 TAGTGTCATGGTGGGTGGTGGGG - Intronic
1190701729 X:52994362-52994384 AGGTGTCTGAGTGGTTTGGGGGG - Intronic
1190737422 X:53264740-53264762 AGATGTCAAGGTGGGTGGGGAGG - Intronic
1190953864 X:55172121-55172143 GGGAGTCTGGGTGGGTGGGAAGG + Intronic
1192101769 X:68271910-68271932 ATGTGTCTGGGTGGGTGGCTGGG + Intronic
1192141856 X:68652852-68652874 GGGTGTGTGTGTGTGTGGTGTGG - Intronic
1192141953 X:68653607-68653629 GGGTGTGTGTGTGTGTGGTGGGG - Intronic
1192370624 X:70509856-70509878 AGATGGGTGGGAGGGTGGTGTGG + Intergenic
1192428541 X:71097365-71097387 AGGTGTTGGGGTGGGAGGTGGGG - Intronic
1192693505 X:73390692-73390714 AAGTTTCTGTGTGGGTTGTGGGG - Intergenic
1194809698 X:98375192-98375214 AGGGTTTTGGGTGGGGGGTGGGG + Intergenic
1195465127 X:105171709-105171731 GTGTGTGTGGGAGGGTGGTGGGG + Intronic
1195768860 X:108327313-108327335 AGGGGCCGGGGTGGGAGGTGTGG - Intronic
1195925559 X:110021330-110021352 TGCTGTCTGTGTGGCTGGTGGGG + Intronic
1195970396 X:110466906-110466928 AGGAGGCTGGGGAGGTGGTGGGG - Intergenic
1196059242 X:111389773-111389795 AGTTATGTGGGTGGATGGTGGGG - Intronic
1196709836 X:118751526-118751548 AGGTGGATGGGTGGATGGAGAGG + Intronic
1196807830 X:119604967-119604989 AGGTGTGTGTGTCTGTGGTGGGG - Intronic
1197121508 X:122898539-122898561 AGGTGTCTGGGTCACTGGGGAGG - Intergenic
1197411651 X:126123668-126123690 AGGTCCCTGAGTAGGTGGTGTGG + Intergenic
1197590335 X:128402189-128402211 GGGTAACTGGGTGGGAGGTGGGG - Intergenic
1197644794 X:129005728-129005750 ATGTGTGTGTGTGGGTGGGGCGG - Intergenic
1197796533 X:130304842-130304864 AGGTTTCTGGGCAGCTGGTGTGG + Intergenic
1199590143 X:149460157-149460179 AGGTGACTAGGTACGTGGTGGGG - Intergenic
1199699869 X:150367057-150367079 ATGTGTTGGGGTGGGGGGTGGGG + Intronic
1200126370 X:153816663-153816685 AGCTGCCTGGGTGGGTAGAGTGG + Intronic
1200442827 Y:3231785-3231807 AGCTACCAGGGTGGGTGGTGGGG + Intergenic
1200975455 Y:9207795-9207817 AGGTGTCAGGGTGGATTCTGAGG - Intergenic
1201421157 Y:13800462-13800484 ATATGTCTGGCTGGGTGGGGTGG - Intergenic
1202272550 Y:23085632-23085654 AGGAGTGTGGGTGCATGGTGAGG - Intergenic
1202293476 Y:23335050-23335072 AGGAGTGTGGGTGCATGGTGAGG + Intergenic
1202425547 Y:24719376-24719398 AGGAGTGTGGGTGCATGGTGAGG - Intergenic
1202445242 Y:24950709-24950731 AGGAGTGTGGGTGCATGGTGAGG + Intergenic