ID: 934575967

View in Genome Browser
Species Human (GRCh38)
Location 2:95401864-95401886
Sequence AGGAAAGGTGTCTGGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 874
Summary {0: 1, 1: 3, 2: 3, 3: 82, 4: 785}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934575967_934575980 25 Left 934575967 2:95401864-95401886 CCACCCACCCAGACACCTTTCCT 0: 1
1: 3
2: 3
3: 82
4: 785
Right 934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG 0: 1
1: 2
2: 0
3: 2
4: 93
934575967_934575979 19 Left 934575967 2:95401864-95401886 CCACCCACCCAGACACCTTTCCT 0: 1
1: 3
2: 3
3: 82
4: 785
Right 934575979 2:95401906-95401928 AAACTTCTCAAATAGAAGTCGGG 0: 3
1: 0
2: 0
3: 19
4: 288
934575967_934575978 18 Left 934575967 2:95401864-95401886 CCACCCACCCAGACACCTTTCCT 0: 1
1: 3
2: 3
3: 82
4: 785
Right 934575978 2:95401905-95401927 AAAACTTCTCAAATAGAAGTCGG 0: 3
1: 0
2: 1
3: 35
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934575967 Original CRISPR AGGAAAGGTGTCTGGGTGGG TGG (reversed) Intergenic
900095198 1:937402-937424 GGGGGAGGTGACTGGGTGGGGGG - Intronic
900138163 1:1127611-1127633 AGGACGGGGGTCTGGGTGGCCGG - Intergenic
900397246 1:2458144-2458166 AGGGAAGGTGGCCGGCTGGGTGG + Intronic
900423152 1:2564415-2564437 AGGAGAGGAGTTGGGGTGGGTGG - Intronic
900493542 1:2965476-2965498 TGGAAAGATGGGTGGGTGGGTGG - Intergenic
900509327 1:3051157-3051179 TGGATGGGTGGCTGGGTGGGTGG - Intergenic
900552096 1:3261937-3261959 AGGAAAGGAGACAGGGTGGGGGG - Intronic
900573498 1:3371559-3371581 AGGATGGGTGAGTGGGTGGGTGG - Intronic
900612123 1:3548650-3548672 AGGCCAGGTGGCTGGGAGGGCGG + Intronic
900869181 1:5289653-5289675 ATGAATGGTGGATGGGTGGGTGG + Intergenic
900926224 1:5707846-5707868 AGGACAGGTGGGTGGGTGGATGG + Intergenic
900929649 1:5728507-5728529 AGAACAGGTGTCTGAGTGGAGGG - Intergenic
901150006 1:7095054-7095076 AGGAAAGGGGGCTGGCTGGGTGG - Intronic
901154162 1:7124256-7124278 GGGACAGGTGTCTGGGAGGGAGG - Intronic
901159365 1:7163300-7163322 GGGAAAGGTCACTGGATGGGGGG + Intronic
901166165 1:7223078-7223100 AGGAAAGATGTATGAGGGGGTGG - Intronic
901190834 1:7408865-7408887 AAGGAAGGTGTGTGAGTGGGAGG - Intronic
901316707 1:8314810-8314832 GGGCCAGGTGGCTGGGTGGGGGG - Intergenic
901757206 1:11448662-11448684 GAGAAAGTGGTCTGGGTGGGGGG + Intergenic
902274776 1:15331457-15331479 TGGAAGGGTGAGTGGGTGGGTGG + Intronic
902362721 1:15950901-15950923 AGGACAGCTGTATGGCTGGGCGG - Intronic
902438979 1:16416897-16416919 AGGAAAGCTGTCTGGGACAGAGG - Intronic
902706292 1:18207468-18207490 AGGAAAGGCATCTGGGTATGTGG + Intronic
903009294 1:20318825-20318847 AGGGAAAGAGTCGGGGTGGGGGG + Intronic
903749508 1:25612101-25612123 AGGCAAAGTGCCTGGGTTGGAGG - Intergenic
903841510 1:26244985-26245007 AGGAAATATGTTTGAGTGGGTGG - Intronic
904364752 1:30003110-30003132 AGGGAGTCTGTCTGGGTGGGAGG - Intergenic
905139326 1:35829027-35829049 AAAAAAGGTGTGTGTGTGGGGGG - Intronic
905276112 1:36819328-36819350 AGGCAGGGAGTCTGGGTGGGAGG - Intronic
905885477 1:41489575-41489597 AGGAAAGGTGGATGGACGGGTGG - Intergenic
905885497 1:41489662-41489684 AGGAAAGGTGGATGGATGGGTGG - Intergenic
905885520 1:41489761-41489783 AGGAAAGGTGGATGGATGGATGG - Intergenic
905885543 1:41489860-41489882 AGGAAAGGTGGATGGATGGGTGG - Intergenic
905885565 1:41489959-41489981 AGGAAAGGTGGATGGATGGGTGG - Intergenic
905906637 1:41622786-41622808 AGGGAAGGTGGCTGGGAGGCTGG + Intronic
905927836 1:41764561-41764583 AGGATAAGAGTCTGGGTGGTTGG + Intronic
905974393 1:42164470-42164492 GGGAAAGGTGTGTGTGTGGCTGG + Intronic
906057607 1:42929085-42929107 AGGCAAGGCCTCTGGGTGGGTGG - Intronic
906102285 1:43271350-43271372 AGGAGAGGGGTCTGGGGGAGGGG - Intronic
906104143 1:43281783-43281805 ATGGAAGGTGTCTTGGAGGGGGG + Intergenic
906120641 1:43388265-43388287 AGGAAGGGCTTATGGGTGGGGGG - Intronic
906139616 1:43526139-43526161 AGGAGAGGTGTGTGGGTTTGCGG + Intronic
906433340 1:45774039-45774061 AGAAAATGTGGCTGGGTGTGGGG + Intergenic
906453330 1:45971468-45971490 TGGAAAGGTGTCTGTGTGATTGG + Intronic
906638267 1:47424876-47424898 AGGAAAGGGGGCTGGGCTGGAGG + Intergenic
906681259 1:47727092-47727114 AGGAAAGGCGCCTGGTTGGATGG + Intergenic
907137617 1:52154617-52154639 AGGCAAGGGGTATGGGTGGAGGG - Intronic
907191143 1:52650025-52650047 GGGAAAGGTCTCTGGCTGGGAGG - Intronic
907259038 1:53202782-53202804 AGGAAGTATGTCAGGGTGGGTGG - Intronic
907289026 1:53401028-53401050 AGGAGAGGAGCCTGGGTGAGGGG + Intergenic
907501749 1:54886503-54886525 GGGGAAGGTGTGTGGGTGGAGGG - Intronic
908489124 1:64625292-64625314 TGGAAAGGTGAGAGGGTGGGAGG + Intronic
908566400 1:65360904-65360926 ATGAAAGGTGTGTGGGTGAGAGG + Intronic
908785207 1:67728811-67728833 AGGAGGGGTTTCTGTGTGGGGGG - Intronic
908907447 1:69032397-69032419 GGGAAAGGTGTGTGGGTGGGAGG + Intergenic
911090649 1:94014388-94014410 AGGAAAGGAGGCAGGGTCGGGGG + Intronic
911200029 1:95034988-95035010 AGGGAATGTGTCGGGGTAGGTGG - Intronic
911559455 1:99386047-99386069 GGGAAGGGTGTCTGGTTTGGTGG + Intergenic
912499206 1:110110761-110110783 AGGAAAGGAGGTTAGGTGGGAGG + Intergenic
912688341 1:111784825-111784847 AGGGAAAGGGTCAGGGTGGGAGG + Intronic
915479141 1:156173290-156173312 ATGAAAGGTGAGTGGGTGGAGGG + Intronic
915522799 1:156457609-156457631 AGCAAAGGTGGCGGGGTGGAGGG + Intergenic
915548712 1:156619218-156619240 CGGAAAAGGGCCTGGGTGGGGGG - Intergenic
915858301 1:159414242-159414264 AGGAATGGTGTGTGGGTAGGAGG - Intergenic
916502801 1:165401161-165401183 AGGAAGGGGGTCAGGGTGGGAGG + Exonic
916844829 1:168639242-168639264 AGGAAGGGTGGGTGGGAGGGAGG - Intergenic
918037128 1:180884632-180884654 GGGAAGGGTTGCTGGGTGGGTGG + Exonic
918434487 1:184497274-184497296 AGGAATAATGTCTGGGTGAGTGG - Intronic
918651259 1:186966205-186966227 AGGAAAACTGTGTGTGTGGGTGG + Intronic
920072061 1:203309043-203309065 AGGAAAGGGGACTGGCTGTGGGG - Exonic
920675700 1:208037287-208037309 AGGCAGGGTGTCAGGATGGGAGG + Intronic
921053397 1:211526886-211526908 GGGCAAGGTGTCTGGGGGTGAGG - Intergenic
921347288 1:214199493-214199515 AAGTAAGGTGACTGGGTGGTGGG - Intergenic
922618916 1:226978934-226978956 GGGTAAGGTGTGTGGGTGTGTGG - Intronic
923133617 1:231098462-231098484 AACAAAGGTATCTGGGTGGTGGG - Intergenic
923711592 1:236391963-236391985 AGGAAAGATGTGTGTGTGGAAGG - Intronic
924220855 1:241873909-241873931 AGGAAAGGTGTAAAGATGGGGGG + Intronic
924763094 1:247007545-247007567 GTGAAAGGTTCCTGGGTGGGAGG - Intronic
1062854322 10:772218-772240 AGGGAAGGTGCCTGGGAGGTGGG + Intergenic
1062871147 10:905796-905818 AGGAAAGTTTTCTGGGAGGTTGG - Intronic
1062980416 10:1717864-1717886 AAGACTGGTGTCTGGGTGTGGGG - Intronic
1063024178 10:2161813-2161835 AGGAACAGGGTCAGGGTGGGGGG - Intergenic
1063214208 10:3909436-3909458 AGTAGAGATGTCTGGGAGGGAGG - Intergenic
1063682448 10:8202163-8202185 AGGAAAGGTGGGAGGGTGAGAGG - Intergenic
1064969469 10:21049654-21049676 AGGAACGGGGTCAGGGTGGGCGG - Intronic
1065787502 10:29230002-29230024 AGGAAAGGTGTGGATGTGGGTGG - Intergenic
1065814483 10:29471781-29471803 AGGAAAGGTGTCCTAGAGGGAGG - Intronic
1066233926 10:33467337-33467359 GGGAACGGTTTCTGGGTGGGTGG + Intergenic
1067281967 10:44879936-44879958 GGGAAGGGGTTCTGGGTGGGAGG - Intergenic
1067513081 10:46911505-46911527 AGGAAAGGTGGCTGGGGGCCAGG + Intronic
1067649172 10:48140337-48140359 AGGAAAGGTGGCTGGGGGCCAGG - Intergenic
1067701572 10:48576927-48576949 TGGGAAGGTGTGTGGTTGGGTGG - Intronic
1069587283 10:69616499-69616521 GGGACAAGTGTGTGGGTGGGAGG + Intergenic
1070123405 10:73600311-73600333 AAGAAAGGTGTAGGGGTGGAAGG + Intronic
1070524567 10:77284180-77284202 AGGAAAGGTGACTGGGTGATAGG + Intronic
1070706154 10:78640318-78640340 AGGAAAGGTGGCATGGTAGGGGG - Intergenic
1070993687 10:80755887-80755909 AGGAATGGGGCATGGGTGGGAGG - Intergenic
1071343215 10:84667076-84667098 GGGACAGGAGTCTAGGTGGGGGG + Intergenic
1071504279 10:86223283-86223305 AGGGAAGGTGTCTGGGCAGGGGG - Intronic
1072247423 10:93555626-93555648 AGGATAGGGGTGGGGGTGGGAGG - Intergenic
1072637118 10:97185412-97185434 CGGAATTGCGTCTGGGTGGGAGG + Intronic
1072654125 10:97318950-97318972 AGAAGGGGTGTGTGGGTGGGTGG + Intergenic
1072697853 10:97617336-97617358 AGGATAGGTGTCAGGTTGGAAGG + Intronic
1073034706 10:100555498-100555520 AGGAGAGGTGGCTGGGCGTGGGG - Exonic
1073060326 10:100729965-100729987 AAGAGTGGTGTCTGGGTGTGGGG - Intergenic
1073181503 10:101586290-101586312 AGGAAAGCTGTCTGGATGGAAGG - Intronic
1073185432 10:101612739-101612761 AGGAGGAGTGGCTGGGTGGGTGG - Intronic
1073433348 10:103501006-103501028 TAGAAAGGTGTCTTGGTGAGTGG + Intronic
1073709654 10:106022145-106022167 AGAAAAGGGGTGGGGGTGGGGGG + Intergenic
1074645179 10:115441850-115441872 AGGAAAGGTATCAGAGAGGGGGG - Intronic
1074757606 10:116636677-116636699 ATGAAAGGTGGATGGTTGGGTGG + Intronic
1074758086 10:116642475-116642497 AAGATAGGTGTCTGGGTGGATGG - Intronic
1075231711 10:120685498-120685520 AGGGAATGTGTCTGGGTGCCAGG + Intergenic
1075323510 10:121511429-121511451 GGGGAAGGTGTAGGGGTGGGTGG - Intronic
1075598728 10:123751470-123751492 AGGAGATGTGTCAGGGTGGCGGG - Intronic
1075907199 10:126091926-126091948 AGGAAGGGTGGATGGGTGGATGG + Intronic
1076136561 10:128049224-128049246 AGGAGAGGTGGGAGGGTGGGTGG + Intronic
1076246388 10:128950470-128950492 CGGAATGGTGTCTGAGTGAGTGG - Intergenic
1076548784 10:131264105-131264127 AGGAAAGGGGTGTGGGGGGAGGG - Intronic
1076566786 10:131404409-131404431 AAGAGGGGTGTCTAGGTGGGTGG - Intergenic
1077023624 11:430456-430478 AGGAAAGGGATGGGGGTGGGAGG + Intronic
1077357451 11:2125143-2125165 TGGATAGATGACTGGGTGGGTGG + Intergenic
1077357582 11:2125798-2125820 TGGATAGATGACTGGGTGGGTGG + Intergenic
1077357676 11:2126266-2126288 TGGATAGATGACTGGGTGGGTGG + Intergenic
1077370221 11:2178220-2178242 AGGAAGGGCATCCGGGTGGGCGG + Intergenic
1077376276 11:2206195-2206217 AGGAAAGGAGGCTGGGAGGTGGG - Intergenic
1077443121 11:2577911-2577933 AGGAAAGGGGCCTAGGGGGGTGG - Intronic
1077990501 11:7406317-7406339 AGGAAGGGTGTGTGGGTGGCAGG - Intronic
1078150836 11:8758449-8758471 AGCAAAGGGATCAGGGTGGGTGG - Intronic
1078315531 11:10290257-10290279 AGGGAAGGAGTCTGTGTGGTAGG + Intronic
1078537251 11:12185098-12185120 TGGATAGGTGGGTGGGTGGGTGG + Intronic
1078855261 11:15201562-15201584 AGGGAAGGGGTCAGGGTGGCGGG - Intronic
1078978903 11:16508673-16508695 AGGAATGATGTGTGGGTAGGAGG + Intronic
1079110150 11:17600857-17600879 AGGATGGGTGAGTGGGTGGGTGG - Intronic
1079604415 11:22346559-22346581 AGGAAAGGCCTTAGGGTGGGGGG + Intronic
1080386000 11:31811599-31811621 AGTGAAGGTTTCTGGGTTGGGGG + Intronic
1080556393 11:33421235-33421257 AAGAAAGGGGGATGGGTGGGTGG + Intergenic
1080591182 11:33724200-33724222 TGGAAAGGTGTCAGGCTGGCAGG + Intronic
1081346839 11:41997980-41998002 AGGGAAGATGTCAGGGTGGAGGG + Intergenic
1081465335 11:43311776-43311798 ATGGAAGGGGTGTGGGTGGGCGG - Intergenic
1082839008 11:57673209-57673231 AGCAGGGGTGTTTGGGTGGGTGG + Intronic
1083328631 11:61886400-61886422 GGGGAAGGGGCCTGGGTGGGCGG + Intronic
1083814983 11:65127730-65127752 AGGAAAGGGGCCTGGGGGGAGGG + Exonic
1083936139 11:65871149-65871171 AGGACAGCTGTGTGGGTGAGTGG - Exonic
1084699435 11:70776885-70776907 AGGATGGGTGAGTGGGTGGGTGG - Intronic
1084781815 11:71414840-71414862 TGGATAGGTGGATGGGTGGGTGG + Intergenic
1084848268 11:71917982-71918004 GGGGAAGGTTTCTGGCTGGGAGG - Intronic
1084904470 11:72335118-72335140 AGGAAAGTAGTGTGGGGGGGTGG + Intronic
1085339747 11:75723446-75723468 AGTAAAGGCGTGTGGGAGGGTGG - Intronic
1085643174 11:78206101-78206123 TGGAAAGGTGTCCGGGGTGGGGG + Intronic
1086510769 11:87555453-87555475 AGGAAAGGAAGCTGGGTAGGTGG + Intergenic
1087276655 11:96167559-96167581 AGCAAAGGTGCCTGGGAGAGGGG - Intronic
1087288992 11:96299442-96299464 AGGAAAGGTGAGTGTCTGGGAGG - Intronic
1088182096 11:107123931-107123953 AGGGAAGGTGTGAGGGAGGGAGG + Intergenic
1089200820 11:116723825-116723847 AGGAGAGGATGCTGGGTGGGAGG - Intergenic
1089610558 11:119666380-119666402 AGGAGAGAAGGCTGGGTGGGTGG + Intronic
1089682320 11:120125560-120125582 AGGAAGGGTGGGTGGGTGGGTGG + Intronic
1089920284 11:122203149-122203171 TGGGACGGTGCCTGGGTGGGAGG + Intergenic
1090965345 11:131593190-131593212 AGGAGAGGTGTAGGGATGGGTGG - Intronic
1091187339 11:133658398-133658420 TGGAAGGGTGGATGGGTGGGTGG + Intergenic
1091277647 11:134363141-134363163 AGGGGAGGGGTCTGGGTGGAGGG + Intronic
1091598374 12:1897219-1897241 GGGAAATGTGTGTGGGTGAGTGG + Intronic
1091637501 12:2208583-2208605 AGGAAGGATGTCTGGGTGGTGGG + Intronic
1091653906 12:2330271-2330293 AGGAAATGTATCGGTGTGGGAGG + Intronic
1091657362 12:2355355-2355377 AGGAAATGTGGGGGGGTGGGAGG - Intronic
1091710109 12:2733917-2733939 AGGCAAGGGGTCGGGGTGGGGGG - Intergenic
1091776797 12:3189944-3189966 GTGAGAGGTGTCTGGATGGGTGG - Intronic
1092177878 12:6423311-6423333 TGGAAAGGTGGGAGGGTGGGAGG - Intergenic
1093906307 12:24696121-24696143 GGGAAATGTGTGTGGGGGGGGGG + Intergenic
1095733943 12:45535972-45535994 TGGAAGGGTGGCTGGGTGGGTGG - Intergenic
1095921172 12:47532739-47532761 AAGAAAAGTGTTTGGGTGAGGGG + Intergenic
1096008660 12:48193966-48193988 GGGAATGGTGTGTGTGTGGGAGG + Intergenic
1096140068 12:49235377-49235399 CGGAAAGGTGTCGGGGTTGCAGG + Intronic
1096788120 12:54029416-54029438 AAGAAAGGTGTGTGGTGGGGGGG - Intronic
1096811589 12:54173767-54173789 AGGGGAGCTGTCTGGGTGGGGGG - Intronic
1096865319 12:54559252-54559274 AGAAAAGGGGTGGGGGTGGGTGG - Intronic
1097247996 12:57617133-57617155 AGGATATGTGGGTGGGTGGGAGG + Exonic
1097258498 12:57698787-57698809 AGGAGATGAGTCTGGGTGGTTGG + Intronic
1097874745 12:64632610-64632632 ATGGAAGGTGGCTGGGTGGGAGG + Intronic
1098031923 12:66264294-66264316 AGTAAAAGTGTCTGGGAGGGAGG - Intergenic
1100861179 12:98809070-98809092 AGCAAAGGTGTAGGGGTGTGTGG - Intronic
1101304283 12:103512299-103512321 GTGAAGGGTGTGTGGGTGGGTGG + Intergenic
1102235761 12:111293577-111293599 AGGGAAGGTGGGTGGGAGGGAGG + Intronic
1102640160 12:114360365-114360387 AGGATAGATGTATGGGTGGGTGG + Intronic
1102895610 12:116595810-116595832 AGGATAGGTGGCTGGGTGGGTGG + Intergenic
1102981332 12:117243768-117243790 TGGAAAGATGGATGGGTGGGTGG - Intronic
1103021798 12:117540223-117540245 AGGAGAGGTGTTGGGATGGGAGG - Intronic
1103245122 12:119450254-119450276 AGGAAGGGTGGGAGGGTGGGAGG + Intronic
1103463186 12:121121475-121121497 AGGAAAGATGCCAGCGTGGGTGG + Intergenic
1103483834 12:121269218-121269240 GAGACAGGTGTCTGTGTGGGTGG - Intronic
1103980982 12:124736766-124736788 TGGATAGGTGCGTGGGTGGGTGG - Intergenic
1104092525 12:125527684-125527706 TGGAAGGGTGGCTGGGTGGTTGG - Intronic
1104458342 12:128933689-128933711 GGGAAGGGTGTCTGAGAGGGTGG - Intronic
1104778409 12:131404653-131404675 ATGAATGATGTATGGGTGGGTGG - Intergenic
1105213977 13:18273838-18273860 AGGAAGGGGGTCTGGGTTTGAGG - Intergenic
1105476840 13:20735357-20735379 AGGAGTGTTGTCTGGATGGGGGG + Intronic
1105578610 13:21674339-21674361 GGGAAAGGAGTGGGGGTGGGGGG + Intronic
1106359763 13:29019852-29019874 AGGAAAGCTGTTTGGATGGTGGG + Intronic
1106419184 13:29571559-29571581 TGGAAAGGCCTCTGGGTGAGCGG - Intronic
1106437055 13:29732436-29732458 GGGAAAGGTGTCTAGCTGAGGGG + Intergenic
1106792935 13:33174501-33174523 AGGAAAGGTGGTTGGGTTAGGGG - Intronic
1106956206 13:34942172-34942194 ACGAGGGGTGTCGGGGTGGGTGG + Intergenic
1107199334 13:37695199-37695221 AGGAAGGGAGTGAGGGTGGGAGG - Intronic
1107458428 13:40577149-40577171 AGGAGGGGTGGGTGGGTGGGGGG - Intronic
1109024837 13:57143604-57143626 ACAAAAGGTGTTGGGGTGGGGGG + Exonic
1109025824 13:57150174-57150196 ACAAAAGGTGTTGGGGTGGGGGG + Exonic
1109026814 13:57156747-57156769 ACAAAAGGTGTTGGGGTGGGGGG + Exonic
1109027806 13:57163318-57163340 ACAAAAGGTGTTGGGGTGGGGGG + Exonic
1109028792 13:57169883-57169905 ACAAAAGGTGTTGGGGTGGGGGG + Exonic
1109775110 13:67030495-67030517 GGGAAAGGTGTGTGTGTTGGTGG - Intronic
1110088379 13:71411838-71411860 GGGAAGGGTGTATGGGTGGGAGG - Intergenic
1110649765 13:77929708-77929730 AGGAAAGGAGTCTGGGAAAGAGG + Intergenic
1111227874 13:85298822-85298844 GGAAAAAGTGTGTGGGTGGGAGG + Intergenic
1112883370 13:104136823-104136845 AGGAGATGTGTCTGGGCCGGTGG + Intergenic
1112885758 13:104168913-104168935 GGGAACGGTGTGTGGGTGGGAGG + Intergenic
1113741311 13:112714143-112714165 AGGAAAGGAAGCCGGGTGGGAGG - Intronic
1113857901 13:113458816-113458838 AGGGATGGTCTCTGGGTGGAAGG - Intronic
1114282518 14:21206417-21206439 AGAAACGGTGGCTGGGTGGCTGG - Intergenic
1114571276 14:23670738-23670760 TGGGAAGGTGTCTGGGAGGTGGG + Intergenic
1114759696 14:25299574-25299596 AGAAAAAGTGTGTGGGTGAGTGG - Intergenic
1116604444 14:46971547-46971569 TTGGAAGGTGTATGGGTGGGAGG + Intronic
1116625222 14:47254818-47254840 AGGAAAGAGGCTTGGGTGGGAGG + Intronic
1116950095 14:50871686-50871708 AGTAAGGGTGACAGGGTGGGGGG + Intronic
1117420809 14:55543158-55543180 TGGTAAGGTGTCTGGGCGGAGGG - Intergenic
1118598636 14:67455306-67455328 AGGAAAGGCCTTGGGGTGGGAGG - Intronic
1119439796 14:74620446-74620468 AGCCAAGGTGTTTGGGTGAGGGG - Intergenic
1119614022 14:76086506-76086528 AGGAAAGGCCTCTGGGTGTCTGG + Intergenic
1119886914 14:78151175-78151197 AGGAAAGGAGTCTGGATTAGAGG + Intergenic
1120008117 14:79382979-79383001 ATGAGAGGTGTGTGGGTGGGTGG + Intronic
1120642973 14:87037836-87037858 AGGAAGGGTCTCTGTGTGGATGG + Intergenic
1121002445 14:90461680-90461702 AGGTAAGGCGTCTGGGAAGGTGG + Intergenic
1121029937 14:90649736-90649758 TGGATAGGTGGATGGGTGGGTGG - Intronic
1121099782 14:91242511-91242533 TGGAAGGGTGGGTGGGTGGGTGG + Intronic
1121494964 14:94385801-94385823 AGGAAAGATGGATGGGTGTGGGG - Intronic
1121606691 14:95245825-95245847 TGGATAGGTGGGTGGGTGGGTGG + Intronic
1121908902 14:97771236-97771258 GGGAAAGGAGTATTGGTGGGGGG - Intergenic
1122128715 14:99592968-99592990 AGAAAGGGTGGCTGGGTGGGGGG + Intronic
1122258991 14:100501432-100501454 AGGTATGCTGTCTGGCTGGGGGG - Intronic
1122318516 14:100839661-100839683 AGGAAAGGTGGGAGTGTGGGGGG + Intergenic
1122328922 14:100899975-100899997 TGGGAAGATGTCTGGGAGGGAGG - Intergenic
1122398400 14:101451472-101451494 AGGAAAGGTGGCTGAGGGTGTGG - Intergenic
1122448836 14:101787374-101787396 AGGAAGGGAGGCTGGGTGGATGG + Intronic
1122692437 14:103537674-103537696 GGGCAGGGTTTCTGGGTGGGTGG + Intergenic
1122741671 14:103875223-103875245 TGGAAAGGTGGGTGGGTGGATGG + Intergenic
1122741867 14:103876038-103876060 TGGATAGGTGGATGGGTGGGTGG + Intergenic
1122923602 14:104890051-104890073 TGGATAGGTTGCTGGGTGGGTGG + Intronic
1123058809 14:105585265-105585287 AGGATAGATGGGTGGGTGGGTGG - Intergenic
1123065120 14:105615024-105615046 AGGACAGGTGTGGGGTTGGGAGG - Intergenic
1123069321 14:105634458-105634480 AGGACAGGTGTGGGGTTGGGAGG - Intergenic
1123088421 14:105730247-105730269 AGGACAGGTGTGGGGTTGGGAGG - Intergenic
1123094365 14:105759618-105759640 AGGACAGGTGTGGGGTTGGGAGG - Intergenic
1123633018 15:22275088-22275110 AGGATAGGTGGGTGGGTGGATGG - Intergenic
1123633035 15:22275142-22275164 AGGATAGGTGAGTGGGTGGGTGG - Intergenic
1124597323 15:31101972-31101994 GGGAAGGGCGGCTGGGTGGGAGG - Intronic
1124656806 15:31515753-31515775 TGGACAGTTGTGTGGGTGGGTGG - Intronic
1124656833 15:31515866-31515888 TGGACAGGTGTATGGGTGGGTGG - Intronic
1124656841 15:31515890-31515912 TGGACAGGTGGATGGGTGGGTGG - Intronic
1125176403 15:36827231-36827253 AGCAAAGTTGTCTGTATGGGAGG - Intergenic
1125320670 15:38484420-38484442 GGGAGAGGTGGCTGGGGGGGTGG + Exonic
1125387243 15:39151181-39151203 AGGAAAGGAGTCAGGCTGGTTGG - Intergenic
1125726854 15:41872525-41872547 AGGATTGGTGACTGGATGGGTGG - Intronic
1126305121 15:47246898-47246920 AGAAAACGGGTCTGGGTGTGTGG + Intronic
1126622793 15:50656728-50656750 AGAGAAGGTCTCTGGGTGGTAGG - Intronic
1126652245 15:50936527-50936549 AGGAAAGGGAACTGGGTGGTGGG - Intronic
1126668581 15:51095273-51095295 AGGGAAGGGGGCGGGGTGGGGGG + Intronic
1127937759 15:63659402-63659424 AAGAAAAGTAGCTGGGTGGGTGG - Intronic
1128056294 15:64702565-64702587 ATGAGAAGAGTCTGGGTGGGGGG + Intronic
1128148631 15:65347137-65347159 CGGAAGGGTGTCTGGTTAGGGGG + Intronic
1128157732 15:65402330-65402352 AGGTAAGGGGGCTGGCTGGGTGG - Exonic
1128361573 15:66965321-66965343 AGGCATGGTGTCAGGCTGGGAGG + Intergenic
1128362737 15:66973852-66973874 GGGAAAGGAGTCGGGGTGGGGGG + Intergenic
1128602423 15:69008801-69008823 TGTAAAGGTGTCTGAGAGGGAGG - Intronic
1128796144 15:70468218-70468240 AGGAAAGATGTCAGGGCGGCTGG - Intergenic
1129114075 15:73355205-73355227 ATGGAAGGTGTCTGGGTCAGGGG + Intronic
1129359214 15:75013945-75013967 GGGAAAGGTGTCTTCTTGGGGGG + Intronic
1129454580 15:75669931-75669953 ACCTCAGGTGTCTGGGTGGGAGG + Intergenic
1129689704 15:77706254-77706276 AGGACAGGTGCCGGGTTGGGTGG - Intronic
1130102398 15:80903883-80903905 AGGAAAGGTTTTTCTGTGGGTGG + Intronic
1130573414 15:85069490-85069512 AGGAAAGATGTCTGGGGTGGGGG - Intronic
1130902362 15:88216625-88216647 AGGAAGGATGGCTGGGTGGCAGG - Intronic
1131175923 15:90209787-90209809 AGGAAAGCCTTCTGGGTGGAGGG + Intronic
1131360156 15:91783692-91783714 GGCAAAGGTTTCAGGGTGGGAGG - Intergenic
1131523799 15:93136786-93136808 GGGAAAGGTGTCAGGGAGGGTGG + Intergenic
1131899025 15:97067697-97067719 AGGAAGGGTGAGTGGGAGGGAGG - Intergenic
1132334157 15:101033416-101033438 AGGAAGGGTGTGAGAGTGGGAGG - Intronic
1132701221 16:1222923-1222945 AGGGAAGGTGGCTGGGTGAGAGG + Intronic
1132904847 16:2277373-2277395 AGGAAAGGGGTCAGGGATGGTGG - Intronic
1133093212 16:3421655-3421677 AGCAATGGTGTGTGGGTGGAGGG - Intronic
1133399369 16:5473624-5473646 AGGATAGATGTAAGGGTGGGTGG + Intergenic
1133399413 16:5473799-5473821 AGGGAAGGTGGGTGGGTGGAAGG + Intergenic
1133399418 16:5473819-5473841 AGGATAGATGTAAGGGTGGGTGG + Intergenic
1133441865 16:5827941-5827963 TGGATAGGTGGGTGGGTGGGTGG - Intergenic
1133456128 16:5943967-5943989 TGGAAAGATGGATGGGTGGGGGG - Intergenic
1133602696 16:7355418-7355440 AGGTATTGTCTCTGGGTGGGAGG - Intronic
1133739534 16:8640803-8640825 AAGATAGGTGGGTGGGTGGGTGG + Intronic
1133810061 16:9154814-9154836 ATGTAAGGCGTCTGGGTGTGCGG - Intergenic
1133839291 16:9394117-9394139 AGGAAAGGTGGAAGGGAGGGAGG - Intergenic
1133888144 16:9851142-9851164 AGGAGAGGTGACAGGGTGGGAGG + Intronic
1133973507 16:10583486-10583508 CGGAAGGGTGCCTGGGTGGTAGG + Intergenic
1134079642 16:11316027-11316049 AGGACAGGGGGCAGGGTGGGTGG - Intronic
1134475120 16:14566833-14566855 AGTACAGGTTGCTGGGTGGGTGG + Intronic
1136176947 16:28523758-28523780 AGGCAGGGAGTCGGGGTGGGAGG - Intergenic
1137475261 16:48802414-48802436 GGGTAAGGTGTCGGGGAGGGAGG - Intergenic
1138198021 16:55068501-55068523 AAGGAAGGTATCTGTGTGGGGGG - Intergenic
1138441275 16:57036481-57036503 TGGGGAGGTGTCAGGGTGGGTGG + Intronic
1138547539 16:57728799-57728821 TGGATAGGTGGGTGGGTGGGTGG + Intronic
1139383103 16:66547150-66547172 GTTAAAGGTGTCTGGGTGGATGG - Intronic
1140164256 16:72533046-72533068 AGGGCAGGGGTCTGAGTGGGAGG - Intergenic
1141110096 16:81265297-81265319 AGGGATGGTGTGTGGGTGGATGG - Intronic
1141161718 16:81633513-81633535 AGGGAAGGTGTTTGGGAGAGAGG + Intronic
1141500935 16:84443619-84443641 AGGAGAGGTGTCTGCTGGGGTGG - Intronic
1141919433 16:87126121-87126143 AGGAGATATGTCTGGATGGGGGG - Intronic
1142014166 16:87735034-87735056 AGGAAATTCGTCTGGGGGGGAGG - Intronic
1142025895 16:87813426-87813448 AGGAAAGATATCAAGGTGGGAGG - Intergenic
1142152974 16:88520838-88520860 AGGGAGGGAGTGTGGGTGGGTGG + Intronic
1142248381 16:88980009-88980031 TGGATGGGTGTGTGGGTGGGTGG + Intergenic
1142248485 16:88980419-88980441 TGGATGGGTGTGTGGGTGGGTGG + Intergenic
1142431877 16:90033202-90033224 AGGAAAAGTCTCTGGGTGTCAGG - Intronic
1142519168 17:493032-493054 GGGAAAGGTGTCTGGGAAGATGG + Intergenic
1142964280 17:3571254-3571276 AGGACAGGTGCCTGGGCTGGAGG + Intronic
1143002113 17:3800952-3800974 AGGAAAGGAGTCTTGCTCGGTGG - Intronic
1143090964 17:4448945-4448967 AGGCAAGGTGTGTGAGTTGGGGG + Intronic
1143254207 17:5543721-5543743 AGGCAAGGGGTCTGTGGGGGAGG + Intronic
1143402811 17:6657083-6657105 AGGAGACGTATCGGGGTGGGGGG - Intergenic
1143815056 17:9506411-9506433 AAGAAAGGTGGGTGGGGGGGGGG - Intronic
1144477173 17:15598382-15598404 AGGAAGGATGGGTGGGTGGGTGG + Intronic
1144477175 17:15598386-15598408 AGGATGGGTGGGTGGGTGGGTGG + Intronic
1144678859 17:17179563-17179585 AGGACTGCTATCTGGGTGGGTGG + Intronic
1144729388 17:17517903-17517925 TGGAAGGTGGTCTGGGTGGGTGG - Intronic
1144821284 17:18076505-18076527 AGGAAAGGGGTCTGGGCAAGGGG - Intergenic
1144921067 17:18764987-18765009 AGGAAGGATGGGTGGGTGGGTGG - Intronic
1147547415 17:41413184-41413206 AGGAAAGATGCCTGGGAAGGTGG - Intergenic
1147582782 17:41636490-41636512 AGCAAAGGGGCCTGGGGGGGGGG - Intergenic
1147605898 17:41773589-41773611 TGGAAAGGGGGCTGGTTGGGGGG - Intronic
1148441013 17:47711611-47711633 AGGAAATGTAGGTGGGTGGGTGG - Exonic
1148505518 17:48124048-48124070 AGGAAATGTGTTTGTGTGTGAGG + Intergenic
1148756238 17:49974447-49974469 AGGAAAAATCGCTGGGTGGGTGG - Exonic
1148793273 17:50185455-50185477 GGGAAAGTTGGTTGGGTGGGAGG + Exonic
1148953989 17:51338179-51338201 AGGAAAAGTGTCAGCCTGGGAGG + Intergenic
1151382381 17:73734769-73734791 AGGAAAGATGCATGGGTGAGGGG - Intergenic
1151943265 17:77305885-77305907 AGGAAGGATGAGTGGGTGGGTGG + Intronic
1151975857 17:77483246-77483268 AAGAAAGGTGTCGGGCTGGCAGG - Intronic
1152508265 17:80767585-80767607 AGTAAAGATATCTGGGTGCGGGG - Intronic
1152640210 17:81446075-81446097 AGGCGGGGTGCCTGGGTGGGGGG + Intronic
1152750070 17:82058575-82058597 GGGAAGAGAGTCTGGGTGGGTGG - Intronic
1152888842 17:82868297-82868319 AGGAAAGGTGGCTTGGAGAGGGG + Intronic
1153178138 18:2402765-2402787 GGGAAGGGTGCGTGGGTGGGAGG + Intergenic
1153338844 18:3953329-3953351 ATAAAAGGTGGCAGGGTGGGAGG - Intronic
1154098139 18:11440025-11440047 AGGGAGGGTGTATGGGTGGAAGG + Intergenic
1154177567 18:12094772-12094794 AGGACTGGTGTGGGGGTGGGTGG + Intronic
1155392400 18:25350722-25350744 GGGTGAGGTGTCGGGGTGGGGGG - Intronic
1155437314 18:25826718-25826740 AGGAAAGAAGTGGGGGTGGGAGG + Intergenic
1157073807 18:44441951-44441973 CGGAAAGGTGGAAGGGTGGGAGG + Intergenic
1157393727 18:47324814-47324836 AGGACAGGGTTGTGGGTGGGTGG - Intergenic
1157481773 18:48059877-48059899 AGGGAAGCTGCCTGGGCGGGTGG - Intronic
1157544283 18:48537177-48537199 AGGCCAGTTGTCTGGGTGGCAGG - Intergenic
1157670294 18:49522810-49522832 AGAAAAGGGGTATGGGTAGGGGG - Intergenic
1157714455 18:49873807-49873829 AAGGGAGGTGGCTGGGTGGGAGG + Intronic
1157772535 18:50361961-50361983 AGAAAAGGAGGCTGGGTGTGGGG - Intergenic
1157817894 18:50743631-50743653 AGAAAATGTCTCTGGGTGGCAGG - Intergenic
1158418110 18:57267821-57267843 AGGAAAGATGGCAGGGAGGGAGG + Intergenic
1158910390 18:62055484-62055506 AAGGAGGGTTTCTGGGTGGGAGG + Intronic
1159278130 18:66247791-66247813 AGGAAATTTGTTGGGGTGGGGGG - Intergenic
1159499400 18:69250650-69250672 AGGAAAGATGCCTGGGGTGGAGG + Intergenic
1160023899 18:75203952-75203974 AGGAAAGGTGCCCGTGGGGGTGG + Intronic
1160152804 18:76407769-76407791 ATGAGGGGTGTCTGGGTGGCTGG - Intronic
1160523527 18:79522394-79522416 ACGGATTGTGTCTGGGTGGGGGG + Intronic
1160767981 19:816928-816950 TGGATAGGTGGATGGGTGGGTGG - Intronic
1161077741 19:2294521-2294543 AGGAAGGGTGTGTGGGCTGGGGG + Intronic
1161077775 19:2294627-2294649 AGGAGGGGCCTCTGGGTGGGGGG + Intronic
1161090378 19:2357207-2357229 TGGATAGGTGTGTGGATGGGTGG - Intergenic
1161243389 19:3235487-3235509 AGGATAGATGGGTGGGTGGGTGG + Intronic
1161565462 19:4999721-4999743 TGGACAGGTGGGTGGGTGGGTGG - Intronic
1161565624 19:5000329-5000351 TGGATAGGTGAATGGGTGGGTGG - Intronic
1161705239 19:5817384-5817406 AGGAAAGGAGTGAGGGAGGGAGG + Intergenic
1161812834 19:6480526-6480548 TGGATAGGTGGGTGGGTGGGTGG - Intronic
1161857987 19:6776688-6776710 TGGATAGGTGAATGGGTGGGTGG - Intronic
1161932462 19:7350017-7350039 AGGAAGGCTGCCTGGGTGGAGGG - Intronic
1161974230 19:7599863-7599885 TGGATAGGTGGATGGGTGGGTGG - Intronic
1161974350 19:7600203-7600225 AGGATAGATGGGTGGGTGGGTGG - Intronic
1162514197 19:11138485-11138507 AGGACAAGTGGGTGGGTGGGTGG - Intronic
1163238415 19:16043342-16043364 AGGAGGGGTGGATGGGTGGGTGG + Intergenic
1163417657 19:17196131-17196153 GGGAAGGATGTGTGGGTGGGTGG + Intronic
1163667759 19:18611058-18611080 CGGAAAGGGGGCTGGGTGTGCGG + Intronic
1163675432 19:18653444-18653466 AGGGCAGGTGGATGGGTGGGTGG - Intronic
1163675509 19:18653676-18653698 TGGAAGGGTGGGTGGGTGGGTGG - Intronic
1163675523 19:18653712-18653734 TGGAAGGGTGGGTGGGTGGGTGG - Intronic
1163675562 19:18653820-18653842 AGGGTGGGTGTGTGGGTGGGTGG - Intronic
1164621418 19:29697914-29697936 TGGCAGGGTGTCTGGGTGGAGGG - Intergenic
1164621459 19:29698074-29698096 TGGCAGGGTGTCTGGGTGGTGGG - Intergenic
1164904974 19:31959871-31959893 GGGAAAGGTGGCTGGGGGGGGGG + Intergenic
1165202484 19:34156501-34156523 AGGAAAGGTGGGAGGCTGGGAGG + Intergenic
1166022611 19:40046088-40046110 GGGAAGGGTGTGTGGGTGAGGGG + Intronic
1166287851 19:41843450-41843472 AGGAAGTGTGTGTGGGAGGGAGG - Intronic
1166307861 19:41945291-41945313 ATGCAAAGTGTGTGGGTGGGTGG - Intergenic
1166679604 19:44758767-44758789 AGGGGAGGGGTCTGGCTGGGAGG - Exonic
1166690997 19:44821109-44821131 AGGGAGGGTGGGTGGGTGGGAGG + Exonic
1166948021 19:46409101-46409123 AGGAAAGGAGGGAGGGTGGGAGG + Intergenic
1167565682 19:50255187-50255209 AGGACAGATGTGTGGGTGGGTGG - Intronic
1167651074 19:50729320-50729342 AGGATGGGTGGGTGGGTGGGTGG - Intergenic
1167805669 19:51782389-51782411 AGGAAACGTGTATGGGTGACTGG + Intronic
1167970094 19:53183827-53183849 AGGAAAGGGGCCTGAGTGGCTGG + Intronic
1168081182 19:54011845-54011867 TGGGAAGGTGCCAGGGTGGGCGG + Intronic
1168237883 19:55075134-55075156 GGGGAGTGTGTCTGGGTGGGAGG - Intronic
1168472113 19:56648247-56648269 TGGAAAGGTGAGAGGGTGGGTGG - Intronic
925294748 2:2769210-2769232 GGGAAAGGGGCCTGGATGGGGGG - Intergenic
925450062 2:3961576-3961598 GGCAAGGGTGTGTGGGTGGGAGG - Intergenic
926007729 2:9385607-9385629 AGGAAAGGTGTGTGTGGCGGGGG + Intronic
926126657 2:10276544-10276566 AGGAAAGAGGTCTGGGCGAGGGG - Intergenic
926232023 2:11011565-11011587 GGGAAAGCTGCCTGGGTGGATGG - Intergenic
927330145 2:21853196-21853218 TGGAAAGGTGTATGTGTGTGAGG - Intergenic
927717246 2:25360751-25360773 AGGAAAGGTGGCGGGGAGAGAGG - Intergenic
928375237 2:30768409-30768431 AAGACAGGTGACTGGGTGGGAGG + Intronic
929259174 2:39845429-39845451 AGGAGAGTTGTCTAGGTGGGTGG + Intergenic
929612148 2:43278951-43278973 AGGAAAGGTCTCTGGATCAGCGG - Intronic
929716588 2:44317024-44317046 AGGGAGGGTGTGTGGGTGGGAGG + Intronic
930090056 2:47525489-47525511 TGGAGAGTTCTCTGGGTGGGAGG + Intronic
930798592 2:55419650-55419672 AGGAATGGTGTCTGCTCGGGGGG - Intronic
930938590 2:56985378-56985400 AGGAAATGAGTCAGGGTGGTGGG - Intergenic
931092563 2:58901462-58901484 AGGAGAGGTAGCTGGGTGAGAGG + Intergenic
931799089 2:65741224-65741246 AGGAAAGATGTAGTGGTGGGTGG + Intergenic
931878789 2:66544016-66544038 AGCAAAGGTGTTTGGGAGGATGG + Intronic
932012364 2:67991423-67991445 AGTAAATGTGTGGGGGTGGGGGG - Intergenic
932281183 2:70493400-70493422 AGCATAGGAGTCTGGGTAGGAGG + Intronic
932949720 2:76278901-76278923 AGGAAAGGTGTGTGCCTGGATGG - Intergenic
934061190 2:88295794-88295816 AGGAGAGGTCTCTAGGTGGAGGG + Intergenic
934115616 2:88789614-88789636 AGGAAGGGTGTGGGGGTGGTAGG - Intergenic
934575967 2:95401864-95401886 AGGAAAGGTGTCTGGGTGGGTGG - Intergenic
934627967 2:95879299-95879321 AGGAAGGGTGTGGGGGTGGTAGG + Intronic
934638139 2:96009721-96009743 AGGAAAGGTATCTGGGTGGGTGG - Intergenic
934795513 2:97095689-97095711 AGGAAAGGTATCTGGGTGGGTGG + Intergenic
934805439 2:97220379-97220401 AGGAAGGGTGTGGGGGTGGTAGG - Intronic
934831922 2:97535169-97535191 AGGAAGGGTGTGGGGGTGGTAGG + Intronic
935140683 2:100350409-100350431 AAGCCAGGTGGCTGGGTGGGAGG - Intergenic
936029511 2:109059814-109059836 AGGGAAGGGGTTTTGGTGGGTGG + Intergenic
937180078 2:119987220-119987242 AGCCAAGGTGGCTGGGTAGGTGG - Intergenic
937279472 2:120707454-120707476 AGGAGAGGTGAGTGGGAGGGAGG + Intergenic
938165049 2:129018796-129018818 AGGAAAGGGGCCTGGATGGTGGG + Intergenic
938604546 2:132878677-132878699 AGGAAGTGTGTGTGTGTGGGCGG - Intronic
938661481 2:133491365-133491387 GGGAAGGCTGTCTGGGAGGGTGG + Intronic
938903653 2:135819278-135819300 AGGAAAGGAGAGTGGGAGGGAGG - Intronic
939136827 2:138306330-138306352 AGGAATGGTGTGTGTGTCGGGGG - Intergenic
939586473 2:144012141-144012163 AGGAAAGGAGTCTGAGGGGATGG - Intronic
941012802 2:160320513-160320535 ATGAGAGGTGTCTGGGTTGTGGG + Intronic
942375750 2:175335225-175335247 GGGAAGCGTGTATGGGTGGGGGG - Intergenic
942396438 2:175554865-175554887 AGAAAAGGTGGAGGGGTGGGTGG + Intergenic
943082792 2:183276590-183276612 GTGAGAGGTGTGTGGGTGGGCGG - Intergenic
943554367 2:189383904-189383926 AGGAAAGGTGAATGGGGGGAGGG - Intergenic
944037592 2:195314434-195314456 AGGAGAGGTGGGTAGGTGGGTGG + Intergenic
944615163 2:201451964-201451986 AGGGAAGGTGTCGGGGCCGGTGG + Intronic
944632545 2:201642512-201642534 AGGTTGGGTCTCTGGGTGGGTGG - Intronic
946070401 2:217029882-217029904 AGGAGAGTGATCTGGGTGGGAGG + Intergenic
946199931 2:218065493-218065515 AGGAAAGGTGAGTGAGTGAGTGG - Intronic
946278370 2:218647757-218647779 AGGGAAGGGGTCTGGGTGAGTGG - Intronic
946327063 2:218990226-218990248 AGGGAAGGTGTCTGGGGCCGTGG + Exonic
947698942 2:232216564-232216586 TGGAAAGGTGGCTAGGTGAGAGG - Intronic
947836029 2:233176366-233176388 TGGATAGGTGGGTGGGTGGGTGG + Intronic
948030071 2:234810160-234810182 AGGAAAGGTTTCGGCGGGGGGGG - Intergenic
948354882 2:237370166-237370188 AGAAAATGAGTCAGGGTGGGTGG - Intronic
948504999 2:238422572-238422594 AGGACAGGGGTATGGGAGGGAGG + Intergenic
948635056 2:239329498-239329520 AGGAGGGGTGTCCCGGTGGGAGG - Intronic
948635155 2:239329963-239329985 AGGAGGGGTGTCCTGGTGGGAGG + Intronic
948975491 2:241461208-241461230 AGGTAAGGTGTGAGGGTTGGAGG - Intronic
948988629 2:241540996-241541018 AGGACAGGTGTCCCTGTGGGAGG + Intergenic
1168773145 20:428756-428778 AGGAAGAGCGTCTGGGTGGAGGG + Intronic
1168980930 20:2003018-2003040 AGGGAAGGGGTCTTTGTGGGTGG - Intergenic
1169106935 20:3004520-3004542 AGGACTGGTGGGTGGGTGGGAGG - Intronic
1169206943 20:3745869-3745891 AGGAAAGCTGGCTTGGAGGGAGG - Intronic
1169538506 20:6574564-6574586 AGAAAAGGTGTGTGTGTGTGAGG - Intergenic
1169694985 20:8377224-8377246 GGGAAAGGTGTCTTGATAGGAGG + Intronic
1170170798 20:13409970-13409992 TGGAAAGGTGTGTGAGTGGGAGG - Intronic
1170365324 20:15591830-15591852 AAGAAAGGGGCCAGGGTGGGAGG - Intronic
1171958438 20:31476605-31476627 GGTGAAGGTTTCTGGGTGGGAGG - Exonic
1173270984 20:41534565-41534587 AGGAAAGATTTTTGGGGGGGCGG + Intronic
1173291041 20:41715519-41715541 AGGAAAGCTGCCTGGGTGGATGG + Intergenic
1173797096 20:45869220-45869242 ATGAAATGTTTCTGGGTGGCCGG + Intronic
1174302407 20:49592220-49592242 AGGACAGATGAATGGGTGGGTGG - Intergenic
1174320960 20:49741332-49741354 AGGAAAGGAGGATGGGAGGGAGG - Intergenic
1174485619 20:50859454-50859476 AGGAGAGGTGTCTGAGGAGGAGG + Intronic
1174619237 20:51861606-51861628 AGGATGGGTGGGTGGGTGGGTGG - Intergenic
1175094397 20:56530056-56530078 TGGATGGGTGTGTGGGTGGGTGG - Intergenic
1175277274 20:57780817-57780839 ATGATAGGTGGATGGGTGGGTGG - Intergenic
1175386061 20:58595956-58595978 AGGGAGGGGGTCTGGGGGGGTGG + Intergenic
1175817860 20:61892998-61893020 AGGGATGGTGGATGGGTGGGTGG + Intronic
1175817901 20:61893160-61893182 AGGGATGGTGGTTGGGTGGGTGG + Intronic
1175817921 20:61893235-61893257 AGGGATGGTGGATGGGTGGGTGG + Intronic
1175901161 20:62360406-62360428 AGGATAGGTGGGTGGGTGGAGGG + Intronic
1175901226 20:62360587-62360609 AGGATAGGTAGGTGGGTGGGTGG + Intronic
1176001316 20:62832641-62832663 TGGAAAAGTGTCAGGGTGGGTGG + Intronic
1176105442 20:63383767-63383789 CGGACAGGTGCCTGGGTGGTTGG - Intergenic
1176159082 20:63639467-63639489 GGGTGAGGTGTCAGGGTGGGGGG - Intergenic
1176163301 20:63659522-63659544 AGGAAAGGACTGCGGGTGGGTGG + Intronic
1176238899 20:64066887-64066909 AGGCAAGTGGTCTGGGTTGGGGG - Intronic
1176661297 21:9637340-9637362 AGGAAAGGAGGGTGGGAGGGAGG - Intergenic
1177061962 21:16387031-16387053 AGGAAAGGTGTGAGGGAGGAAGG - Intergenic
1177615033 21:23505685-23505707 TGGCAAGGTATCTGGGTGGTGGG + Intergenic
1177927320 21:27234828-27234850 AGGCAAGGGGTCTGGCTGTGGGG + Intergenic
1178296495 21:31414672-31414694 AGGACAGGTGTCTGGGCAGTTGG + Intronic
1178794877 21:35734659-35734681 GGGAAGGGTGTGTGGGTGGGAGG + Intronic
1178878925 21:36433453-36433475 TGGAATGGTGGGTGGGTGGGTGG - Intergenic
1179200947 21:39220105-39220127 GGGCAAGGGGTGTGGGTGGGTGG + Intronic
1180182462 21:46124104-46124126 CGGACAGGTGAGTGGGTGGGTGG + Intronic
1181345222 22:22215101-22215123 AGGATAGGAGTTTGGGAGGGTGG - Intergenic
1181698703 22:24608044-24608066 AGGAAGGGGGTCTGGGTTTGAGG + Intronic
1181822685 22:25487848-25487870 AGGATGGGTGTGTGGGTGGATGG + Intergenic
1182018432 22:27060655-27060677 AGGAAGGGAGGCTGAGTGGGAGG + Intergenic
1182047350 22:27285754-27285776 TGGATAGGTGGGTGGGTGGGTGG + Intergenic
1182052763 22:27325607-27325629 ATGAAAGGTGACTGAGTGGATGG + Intergenic
1182086694 22:27565742-27565764 AGGAAGGGTGAGTGGGTGGGTGG + Intergenic
1182276008 22:29189108-29189130 AGAAAAGGTGTGTGAGGGGGAGG + Intergenic
1183082191 22:35463596-35463618 TGGATAGGTGGATGGGTGGGTGG - Intergenic
1183415853 22:37681426-37681448 AGGCATGGTGCGTGGGTGGGGGG + Intergenic
1183427670 22:37748103-37748125 AGGGAAGGGGTCTGGGGAGGAGG + Intronic
1183491138 22:38116244-38116266 GGGAAAGGTGGATGGGCGGGTGG - Intronic
1183628407 22:39018604-39018626 AGGAACGGGGTCTGTGGGGGTGG - Exonic
1184246225 22:43237091-43237113 AGGAAATGTGGTGGGGTGGGGGG + Intronic
1184351456 22:43946703-43946725 ATGACAGGTGTTTGGATGGGTGG + Exonic
1184389436 22:44194853-44194875 TGGATAGGTGTGTGGGTGGATGG - Intronic
1184401319 22:44276260-44276282 AGGAGAGAGGTCTGGGTGGAGGG + Intronic
1184787945 22:46680858-46680880 TGGATAGGTGGGTGGGTGGGTGG - Intergenic
1184902136 22:47453030-47453052 AGGTAATGAGACTGGGTGGGAGG - Intergenic
1184954919 22:47879556-47879578 AGGAAAGGTTTGTGGGTTGCAGG - Intergenic
1185063777 22:48620766-48620788 AGGATGGGTGGTTGGGTGGGTGG - Intronic
1185063803 22:48620849-48620871 AGGATGGGTGGTTGGGTGGGTGG - Intronic
950036314 3:9888442-9888464 AGGAAGGGAGTCTGTGTGGCTGG - Intergenic
950086710 3:10263964-10263986 AGGAAAGGTGGCTGGGAGCTGGG + Intronic
950121986 3:10488137-10488159 TGGATAGGTGGGTGGGTGGGAGG - Intronic
950156488 3:10724970-10724992 AGGAAAGCTGTCAGGGAGGCAGG + Intergenic
950408441 3:12818965-12818987 AGGAAATGTGACCGGGTGGCTGG - Intronic
950471142 3:13187114-13187136 TGGACAGGTGTGTGGGTGGATGG - Intergenic
950474245 3:13205698-13205720 TGGATAGGTGGCTGGATGGGTGG - Intergenic
950677474 3:14563442-14563464 AGGGAGGGTGCCTTGGTGGGCGG + Intergenic
950905495 3:16534131-16534153 ATGAGAGGTGTTTGGGTCGGGGG - Intergenic
951515934 3:23559603-23559625 AGGAAAGGAGTGGGGGAGGGAGG - Intronic
953329184 3:42037917-42037939 AGGTCAGGTGGCTGGGTGAGGGG + Intronic
953422545 3:42765741-42765763 AGGGACGGTGCCTGAGTGGGGGG + Intronic
953582606 3:44170939-44170961 AGGAAAGAGGTGTGTGTGGGTGG - Intergenic
954580529 3:51700682-51700704 AGGGAAGGAAGCTGGGTGGGTGG - Intronic
954743767 3:52775058-52775080 AGGGAAGGTGGCTGGGAAGGGGG - Intergenic
955511177 3:59681837-59681859 TGGAAAGGTGGGTGGGTGGGAGG + Intergenic
955792477 3:62602862-62602884 AAGAATGATGTCTGGGTGGCTGG - Intronic
955998262 3:64700519-64700541 AGGAGAGGAGTCTAGGTTGGAGG + Intergenic
956188921 3:66589798-66589820 GGGAAGGGTGTGTGGGTTGGGGG - Intergenic
956319635 3:67982574-67982596 GGGAAGGGTGTATGGGTGGGGGG - Intergenic
956546600 3:70409969-70409991 TGGAAAGTTGGCAGGGTGGGTGG - Intergenic
956789976 3:72672948-72672970 AGGAGAGGTGACAGGATGGGAGG + Intergenic
957615725 3:82524170-82524192 AGTATATGTGTGTGGGTGGGCGG + Intergenic
958264553 3:91422727-91422749 AGGCAAGGATTCTGGGTAGGAGG - Intergenic
959051385 3:101527941-101527963 AGGACATGTGTGTGTGTGGGGGG - Intergenic
959524872 3:107365556-107365578 AGGAAGGGTGGGAGGGTGGGAGG + Intergenic
959714493 3:109417626-109417648 AGAAAGGGTCTCTGGGTGGCTGG + Intergenic
960482087 3:118204359-118204381 AGGAAAGGAGGGAGGGTGGGAGG - Intergenic
960995876 3:123339716-123339738 ACGAGAGGGGTTTGGGTGGGTGG - Intronic
961492892 3:127267458-127267480 TGGCAAGGTTTCTGGGTGGGTGG + Intergenic
961661350 3:128470224-128470246 AGGAAACGTGTGTGGGTGGCTGG - Intergenic
961669236 3:128517043-128517065 AGTCAAGGTGTTGGGGTGGGGGG - Intergenic
961823867 3:129588700-129588722 AGGAGAGATGGCTGGGTTGGGGG + Intronic
962138187 3:132760158-132760180 TGGTAAGGTGTATGGGGGGGTGG - Intergenic
962271492 3:133980861-133980883 AGGAGAGGTGTCTGGTTTTGTGG - Intronic
962505394 3:136041534-136041556 AGTAAAAGTGGCTGGGTGTGGGG - Intronic
962743316 3:138379171-138379193 GGGAAGGGTGTGTGGGTGGGGGG - Intronic
962921443 3:139953826-139953848 AGCAAAGGTGTGTGTGTAGGAGG - Intronic
963167789 3:142223446-142223468 AGGGATAGTGTGTGGGTGGGTGG + Intronic
963545014 3:146645737-146645759 AGCAAAGTTGGGTGGGTGGGTGG - Intergenic
964367994 3:155970088-155970110 AGGAAAGGTTTCTGGCATGGAGG + Intergenic
964517834 3:157531915-157531937 AGCAAGGCTGTTTGGGTGGGTGG - Intronic
964620404 3:158715434-158715456 AGAAAAGGTGTCTGGGGAGGTGG + Intronic
966355259 3:179072337-179072359 AGGGAAGGTGTGTGTGTGGGTGG - Intergenic
966447882 3:180023944-180023966 TGCAAAGATGTCTGGGTGAGGGG + Intronic
966694077 3:182771574-182771596 TGGAAGGGTGTGTGGGTGGGAGG - Intergenic
966810333 3:183838128-183838150 AGGAGAGGTGGGAGGGTGGGAGG - Intronic
966954423 3:184859642-184859664 AGGAAAGGTGACATGGTGTGAGG - Intronic
967820237 3:193833265-193833287 GGGACATGTGTCTGGGTTGGGGG + Intergenic
968046326 3:195625643-195625665 AGGCAGGGTGTGTGGGTGAGAGG - Intergenic
968308327 3:197664448-197664470 AGGCAGGGTGTGTGGGTGAGAGG + Intergenic
968405281 4:335603-335625 AGAGAAGGTGAGTGGGTGGGTGG - Intergenic
968440585 4:622007-622029 AGGACAGGGGTCTTTGTGGGTGG - Intergenic
968539148 4:1154240-1154262 GTGAAGGGAGTCTGGGTGGGTGG + Intergenic
968735720 4:2295674-2295696 AGGAAAGGTGCCCAGGTGGCAGG - Intronic
968928152 4:3560813-3560835 TGGATAGGTGAGTGGGTGGGTGG - Intergenic
968935862 4:3610061-3610083 TGGATAGGTGGATGGGTGGGTGG - Intergenic
969458759 4:7316190-7316212 AGGAAAGCTAGCTGGATGGGTGG - Intronic
969510392 4:7614367-7614389 TGGAAAGGTGGATGGGTGGATGG - Intronic
969621568 4:8281363-8281385 TGCCAAGGTGGCTGGGTGGGTGG + Intronic
970424953 4:15937350-15937372 AGGAAAGGTGTGAGGTGGGGTGG + Intronic
971041000 4:22752119-22752141 AGGAAAAGTTTCTGTGTGGTGGG - Intergenic
971449469 4:26786722-26786744 TGGATAGGTGGGTGGGTGGGTGG + Intergenic
971529088 4:27661916-27661938 TGGAATGGTGGGTGGGTGGGAGG - Intergenic
972836931 4:42882789-42882811 AGGAAGGGTGGGTGGGTGGAAGG - Intergenic
972960300 4:44446770-44446792 AGGGAAGGTGTTGGGGAGGGAGG - Intronic
973140173 4:46757304-46757326 ATGAAAGGTGGGAGGGTGGGAGG + Intronic
973826406 4:54711227-54711249 AGGAAAGATGGTAGGGTGGGTGG + Intronic
974880400 4:67749670-67749692 AGGAAAGGAGGCAGGGAGGGAGG - Intronic
975119420 4:70712430-70712452 AGTAAAGGTTGCTGGGTAGGAGG + Intronic
975316294 4:72956803-72956825 AGGGAGGGTGTGTGGTTGGGGGG + Intergenic
975464273 4:74691909-74691931 AGGAGAGATGCCTGGGTGGTAGG + Intergenic
975662467 4:76701158-76701180 AGGAATGCTGTCTGGGTGTCAGG + Intronic
975675475 4:76823404-76823426 GGGAAGGGTGTGTGGGTGGGAGG - Intergenic
977817793 4:101435698-101435720 GGGAAAGGTATGTGTGTGGGAGG - Intronic
977939221 4:102840561-102840583 GGGAAAGGTGTCTGGGTGGGAGG + Intronic
978142475 4:105333320-105333342 TGGAAGGGTGTGTGGTTGGGAGG + Intergenic
979489208 4:121306102-121306124 GGGAAGGGTGTGTGGGTAGGAGG + Intergenic
979588964 4:122455736-122455758 AGGAAAGGTTTCTAAGTGAGAGG - Intronic
980000991 4:127488044-127488066 ATCAAAGGGGTCTGGTTGGGAGG + Intergenic
980444113 4:132884675-132884697 AAGAAAGGGGTCTGGGTTGCTGG - Intergenic
982010098 4:151098194-151098216 AGGAAGGTTGTCTTGGGGGGTGG + Intergenic
982514767 4:156331227-156331249 TGAAAGGGTGTGTGGGTGGGAGG + Intergenic
982791656 4:159599157-159599179 ATGAAAGCTGTCTGGGAGGGTGG - Intergenic
982999550 4:162396804-162396826 CGGAATGGCGTATGGGTGGGAGG + Intergenic
983021674 4:162684465-162684487 AGGAGAGGTGTGTGAATGGGAGG + Intergenic
984139988 4:175993111-175993133 AGGAAAGGAGGGAGGGTGGGAGG - Intronic
985107026 4:186509626-186509648 AGGAAGGGAGGGTGGGTGGGTGG + Intronic
985414100 4:189719195-189719217 AGGAAAGGAGGGTGGGAGGGAGG + Intergenic
985560576 5:584079-584101 TGGATGGGTGGCTGGGTGGGTGG + Intergenic
985837459 5:2281318-2281340 TGGATAGGTGGGTGGGTGGGTGG + Intergenic
985952429 5:3233165-3233187 GGGAAAGGTGTGTGGGTGGGAGG - Intergenic
986883507 5:12205373-12205395 AGGAAGGGAGTCGGGGAGGGAGG - Intergenic
987059097 5:14225388-14225410 AGGTCAGGTGTCTGGGTAGTTGG + Intronic
987698360 5:21361595-21361617 AAGAAGGGTGGTTGGGTGGGAGG + Intergenic
988023820 5:25657321-25657343 GGGATAGGAGTCGGGGTGGGTGG - Intergenic
988556684 5:32242666-32242688 AGGGAAGGTGGCTGGGGGGTAGG - Intronic
988844319 5:35113433-35113455 TGGATAGGTGGGTGGGTGGGTGG - Intronic
989181063 5:38577553-38577575 TGGGAAGGTGTCTGGGAGGTGGG - Intronic
989516038 5:42344784-42344806 AGGAAGGGTGTATGGGGAGGTGG + Intergenic
990461052 5:56031458-56031480 GGGAAGAGTGTGTGGGTGGGTGG + Intergenic
990745250 5:58952425-58952447 TGGAAGGGTGTGTGGGTGGTGGG + Intergenic
991497011 5:67236665-67236687 AGGACAGGTTGCAGGGTGGGTGG + Intergenic
991948234 5:71922299-71922321 TGGAATGGGGTGTGGGTGGGAGG + Intergenic
992705405 5:79386458-79386480 GGGAAAGGTGTGATGGTGGGAGG + Intronic
992720596 5:79557235-79557257 AGGAAAGGAGTGAGGGAGGGAGG - Intergenic
993149623 5:84144253-84144275 AGGAAAGGAGGAAGGGTGGGAGG - Intronic
994454444 5:99986075-99986097 AGGAAAGGGGTGGGGGGGGGTGG + Intergenic
994557840 5:101327371-101327393 AGAAAAGGTGAAAGGGTGGGAGG + Intergenic
994866403 5:105277371-105277393 GGGAAGAGTGTGTGGGTGGGAGG + Intergenic
994872324 5:105367516-105367538 GGAAAGGGTGTGTGGGTGGGAGG + Intergenic
995244703 5:109922526-109922548 AGGAAAGGTGTGGGGGCTGGGGG + Intergenic
996112276 5:119580002-119580024 AGGGATGGAGGCTGGGTGGGTGG - Intronic
996407460 5:123119622-123119644 AGGAAAGCTGTCTTTTTGGGTGG + Intronic
996542493 5:124645487-124645509 AGTAAATGTGTGTGTGTGGGTGG + Intronic
996790525 5:127289490-127289512 AGGACAGCAGTCTGGGTGGAAGG - Intergenic
996876304 5:128243774-128243796 AGGATAGATGGGTGGGTGGGTGG + Intergenic
997248372 5:132370301-132370323 AGGAGAGCTGTCTGGATGGCTGG + Exonic
997850148 5:137325111-137325133 AGGAAAGGTTTTTGGGATGGGGG + Intronic
998230964 5:140361167-140361189 GGGAAAGGTGTCTGGGCAGAGGG + Intronic
998399153 5:141839045-141839067 AGGAAACATCTCAGGGTGGGGGG + Intergenic
998755710 5:145376831-145376853 AAGACAGGTGTCTGGGTTTGTGG + Intergenic
998919797 5:147055629-147055651 AGGGAGAGTGTCTGGGTGGGTGG - Intronic
998969661 5:147577378-147577400 AGGCAGGGTGTCTGGGTAAGAGG + Intergenic
999150676 5:149424133-149424155 AGGAAATGTCTCTGGCTGTGGGG - Intergenic
1000082083 5:157858531-157858553 AGGGAAGGTTTGGGGGTGGGGGG - Intronic
1000808417 5:165827490-165827512 AGGAAAGGATTCTGGGAAGGTGG - Intergenic
1001269976 5:170303519-170303541 AGGCAAGATTTCTGGGTGGTGGG + Intergenic
1001329957 5:170754844-170754866 TGGAAAGATGAGTGGGTGGGTGG + Intergenic
1001574048 5:172750264-172750286 AGGGGATGTCTCTGGGTGGGCGG - Intergenic
1001642348 5:173253286-173253308 AGGGAAGGGTTCTGGGTGTGGGG + Intergenic
1001828792 5:174767876-174767898 TGGATAGGTGGATGGGTGGGTGG - Intergenic
1001840374 5:174871209-174871231 TGGATAGGTGAGTGGGTGGGTGG - Intergenic
1001883197 5:175263324-175263346 GGGAAAGGTGAAAGGGTGGGAGG + Intergenic
1002035535 5:176466283-176466305 AGCAAAGCTGTCTGTGTGGTCGG + Intronic
1002170406 5:177371296-177371318 AGGAAGGGGGTCCAGGTGGGAGG + Intronic
1003116091 6:3284752-3284774 GGGACAGTTGTCTGGGTGGGGGG - Intronic
1003645032 6:7907839-7907861 AGGAAAGGAGGCTGAGTGGGCGG - Intronic
1004084186 6:12428468-12428490 AGGAATGGTGGCAGGGTGGAGGG + Intergenic
1004774186 6:18823894-18823916 AGGAAGAGTTTATGGGTGGGAGG + Intergenic
1005082897 6:21974829-21974851 AGGAAATGGGTGTGTGTGGGGGG - Intergenic
1005375621 6:25179531-25179553 AGGAAAGGACACTGGGAGGGTGG - Intergenic
1006053219 6:31359464-31359486 AGGGAAGGGGTGAGGGTGGGAGG - Intergenic
1006072062 6:31505449-31505471 AGGAAAACTGTGAGGGTGGGAGG - Intronic
1006167864 6:32075844-32075866 AGAGAAGGTGGCTGGATGGGTGG + Intronic
1006169714 6:32085931-32085953 GGCAAAGGTGTCAGGCTGGGCGG + Intronic
1006269697 6:32954409-32954431 AGCATGGGTGGCTGGGTGGGTGG + Intronic
1006336729 6:33424981-33425003 AGGAAGGGCGTGTGTGTGGGAGG + Intronic
1006437344 6:34032917-34032939 AGTAAAGGTACCTGGCTGGGAGG - Intronic
1006498880 6:34444570-34444592 ACAAAAAGTGTCTGGGTGTGGGG + Intergenic
1006642270 6:35495614-35495636 ACGAGAGGGGTCTTGGTGGGAGG + Intronic
1006730327 6:36231326-36231348 AGGGAAGGTCTGTGGGTGGGAGG - Exonic
1007744480 6:44034916-44034938 AGGTAAGAGGTCTGGGTGGGAGG - Intergenic
1007749739 6:44064566-44064588 AGGGAAGGGATCTGGCTGGGAGG + Intergenic
1008009296 6:46446287-46446309 AGGCAGGGTGTGTGTGTGGGTGG + Intronic
1008546377 6:52587272-52587294 TAGAAAGGTGGCTGGGTGGATGG + Intergenic
1008990889 6:57600247-57600269 AGGCAAGGATTCTGGGTAGGAGG + Intronic
1009179411 6:60498481-60498503 AGGCAAGGATTCTGGGTAGGAGG + Intergenic
1010044616 6:71426721-71426743 AGAAAAGGTGTGTGGGTGTGAGG + Intergenic
1010233717 6:73557794-73557816 AAAAAAGGGGTCGGGGTGGGAGG - Intergenic
1010658960 6:78546575-78546597 TGGAAAGGTGGGAGGGTGGGAGG + Intergenic
1010923162 6:81709865-81709887 TGGAAAGGTGGAAGGGTGGGAGG - Intronic
1011141042 6:84156957-84156979 ACAAAAGGTGGCAGGGTGGGAGG + Intronic
1011752720 6:90469516-90469538 GGGAAGGGTGTCTGGGCGGGAGG - Intergenic
1012501699 6:99895659-99895681 AGCACATGTGTCTGTGTGGGAGG + Intergenic
1013065512 6:106681131-106681153 AGGAAGGGTGTGCAGGTGGGAGG + Intergenic
1013409165 6:109868930-109868952 AGCACAGGGGTCAGGGTGGGAGG - Intergenic
1013650179 6:112186991-112187013 AGGAAAGGTGGGTGGGTGGTGGG + Intronic
1015913133 6:138187932-138187954 AGGAAATGAGTGTGTGTGGGGGG + Intronic
1017068665 6:150552436-150552458 AAAAAAGGTGTGTGGGGGGGTGG + Intergenic
1017415326 6:154214319-154214341 GGGGAAGGTGAATGGGTGGGGGG - Intronic
1017555119 6:155555810-155555832 CTGCAAGGTGTCTGGGTGGGAGG - Intergenic
1017633897 6:156424742-156424764 AGGAATGGAGACTGGGTGGCTGG - Intergenic
1017637841 6:156460391-156460413 AGCAAAGGTGGCTGTGTGGCAGG - Intergenic
1019055344 6:169219247-169219269 TGGATAGGTGGATGGGTGGGTGG + Intronic
1019510748 7:1416143-1416165 TGGATAGGTGGATGGGTGGGTGG + Intergenic
1019516057 7:1440694-1440716 AGGCAAGGGGTCTGGGTGTGAGG + Intronic
1019601203 7:1884667-1884689 AGGGGAGTTGTCTGAGTGGGCGG + Intronic
1019704680 7:2491844-2491866 AGGACTGATGTGTGGGTGGGTGG - Intergenic
1019704840 7:2492655-2492677 AGGACTGATGTGTGGGTGGGTGG - Intergenic
1019776077 7:2912910-2912932 ATGATGGGTGACTGGGTGGGTGG - Intronic
1019932032 7:4230164-4230186 AGGAAGGGTGGGTGGGTGGGTGG + Intronic
1020007664 7:4791047-4791069 AGGACAGGGGTCTGTGTGGAGGG - Intronic
1020007907 7:4792125-4792147 AGGGGAGGTGTCTGGGCGTGCGG + Intronic
1020009477 7:4800324-4800346 AGGAAAGGTGGGTGGGAGTGAGG + Intronic
1020050306 7:5076964-5076986 AAGAAAGGAGTCTGGGTGTGGGG - Intergenic
1020088289 7:5323333-5323355 AGGACAGGTGTGGGGGTGGGGGG - Intronic
1020110955 7:5447464-5447486 TGGACAGGTGGGTGGGTGGGTGG + Intronic
1021385657 7:20026654-20026676 AGGTAAGGATTCTGGGTGTGAGG + Intergenic
1022421040 7:30223668-30223690 AGCTAAGGTGTATGTGTGGGAGG - Intergenic
1022482791 7:30754703-30754725 AGGAAAGATGGATGGATGGGTGG - Intronic
1022679208 7:32528168-32528190 GGGGTAGGTGTCAGGGTGGGTGG - Intronic
1022869900 7:34465897-34465919 AGGAATGGTGTGTGGGTCAGAGG - Intergenic
1023116414 7:36866891-36866913 GGGAAAGGGGTGTGGGTTGGGGG + Intronic
1023312453 7:38902091-38902113 AGTAAAGCTGTTTGGGTAGGTGG - Intronic
1023819459 7:43972559-43972581 AGGGGAGGTCTCTGAGTGGGAGG + Intergenic
1024074904 7:45813343-45813365 AGGCAAGGGGTCAGCGTGGGAGG - Intergenic
1024074925 7:45813425-45813447 AGGCAAGGGGTCAGCGTGGGAGG - Intergenic
1024075025 7:45813817-45813839 AGGCAAGGGGTCAGCGTGGGAGG - Intergenic
1024075035 7:45813850-45813872 AGGCAAGGGGTCAGTGTGGGAGG - Intergenic
1024233564 7:47380920-47380942 AGGCCAGGTGCCTGGGAGGGAGG - Intronic
1024477925 7:49833554-49833576 AGGAAAGGTGATTGGGAGTGAGG + Intronic
1024523967 7:50332461-50332483 AGGGGAGGCGTTTGGGTGGGTGG + Intronic
1024677539 7:51650555-51650577 ATGGAAGGTGTTTGGGTGGTAGG + Intergenic
1025052397 7:55741911-55741933 AGGCAAGGGGTCAGTGTGGGAGG + Intergenic
1025052468 7:55742185-55742207 AGGCAAGGGGTCAGCGTGGGAGG + Intergenic
1025052789 7:55743459-55743481 AGGCAAGGGGTCAGCGTGGGAGG + Intergenic
1025052800 7:55743492-55743514 AGGCAAGGGGTCAGCGTGGGAGG + Intergenic
1025052821 7:55743558-55743580 AGGCAAGGGGTCAGCGTGGGAGG + Intergenic
1025052832 7:55743591-55743613 AGGCAAGGGGTCAGCGTGGGAGG + Intergenic
1025052843 7:55743624-55743646 AGGCAAGGGGTCAGCGTGGGAGG + Intergenic
1025129467 7:56368014-56368036 AGGCAAGGGGTCAGCGTGGGAGG + Intergenic
1025129560 7:56368366-56368388 AGGCAAGGGGTCAGCGTGGGAGG + Intergenic
1025665919 7:63583157-63583179 AGGACAGGTGTGGGGGTGGGCGG - Intergenic
1025809530 7:64866699-64866721 AGTGAAGGTGGGTGGGTGGGTGG - Intergenic
1026162443 7:67881461-67881483 AGGAAAGGTGTGTGTGTGTAGGG + Intergenic
1026252185 7:68680488-68680510 AGGAAAGGAGGCAGGGAGGGAGG + Intergenic
1026336362 7:69397314-69397336 AGGAAAGGAGACTGGCTTGGAGG + Intergenic
1028922083 7:96320669-96320691 AGGAAAGTACTCTGGGTGTGTGG - Intronic
1029438724 7:100576045-100576067 AGGAGAGGCGTCTGGGAGGCAGG + Intronic
1029460850 7:100693514-100693536 AGGCGAGGTGCCTGGGTGGAGGG + Intergenic
1029697960 7:102226872-102226894 AGGAAATGTGGCTGGGCGAGTGG - Intronic
1030122314 7:106121913-106121935 AGGCAAGGTGTTTAGGTGGTAGG + Intergenic
1030756943 7:113297459-113297481 GGGAAGGGTGTGTTGGTGGGAGG + Intergenic
1031316030 7:120258130-120258152 AGGAAGTATGCCTGGGTGGGGGG - Intergenic
1031769133 7:125820618-125820640 AGGAAAGGAGGGTGGGTGGTTGG + Intergenic
1032706220 7:134423077-134423099 AGGAAGGGTCTCTGGGGGTGGGG - Intergenic
1032851443 7:135798993-135799015 AGGCAGGGTGGATGGGTGGGAGG - Intergenic
1034422038 7:150995564-150995586 AGGAAGGGTGCAGGGGTGGGAGG - Intronic
1034440854 7:151085562-151085584 AGGAAACGTGTGTGTGTTGGTGG + Intergenic
1036074652 8:5482360-5482382 TGGAAAGGTGGGAGGGTGGGAGG + Intergenic
1036629011 8:10497243-10497265 AGGGAAGATCTCTGGGAGGGTGG - Intergenic
1037274117 8:17159151-17159173 AGGAAAGGAGTCTGGGAGTCTGG - Intronic
1037588609 8:20294992-20295014 AGGCAAGGAGCCTGGGTTGGGGG + Intronic
1037806463 8:22060258-22060280 GGGAGAGGGGTCTGGATGGGAGG + Intronic
1037903350 8:22701106-22701128 AGAAAAGGTGTGAGTGTGGGGGG + Intergenic
1038053732 8:23837976-23837998 AAGGGAGGTGGCTGGGTGGGAGG + Intergenic
1038772980 8:30501270-30501292 AGAAAGGGTGTTGGGGTGGGAGG - Intronic
1040668594 8:49659223-49659245 AGGCAATGTGGCTGGGAGGGTGG - Intergenic
1041027771 8:53704181-53704203 GTGGAAGGTGTCTGGGTCGGGGG + Intergenic
1041052688 8:53953047-53953069 CGGAAAGGTGGATGGGAGGGTGG + Intronic
1041286959 8:56272164-56272186 AGGGCAGCTGGCTGGGTGGGGGG + Intergenic
1041869296 8:62615267-62615289 AGGAATGTTGTCTGGGAGGTAGG + Intronic
1043040485 8:75256198-75256220 GGGAAGGGTGTATGGGTGGCAGG + Intergenic
1044338378 8:91017076-91017098 AGGAAAGGAATATGAGTGGGAGG + Intronic
1044557983 8:93585438-93585460 TGGAAGGGTGTGTGGGTGGGAGG + Intergenic
1045238996 8:100381708-100381730 TTGAAAGGAGTCTGGGTTGGAGG + Intronic
1045706528 8:104929862-104929884 ATGCATGGTGTGTGGGTGGGTGG - Intronic
1047122519 8:121921951-121921973 AGGAAAGGTGGCAGGCTGTGTGG - Intergenic
1047755743 8:127917212-127917234 AGGAAATGTGGGTGGGTGGATGG - Intergenic
1048061461 8:130923319-130923341 AGGAAAGGAGGCTGGGAGGCAGG + Intronic
1048934672 8:139344932-139344954 AGGAAAGATATCTGGGGAGGTGG - Intergenic
1049374978 8:142285126-142285148 TGGAATGGTGGATGGGTGGGTGG + Intronic
1049375057 8:142285429-142285451 TGGATAGATGTGTGGGTGGGTGG + Intronic
1049416120 8:142496134-142496156 TGAATAGGTGTGTGGGTGGGTGG + Intronic
1049445306 8:142627763-142627785 AGGAAATGTGTCTGAGTCAGAGG - Intergenic
1049477042 8:142801672-142801694 TGGAAAGGTGGATGGGTGGGTGG + Intergenic
1049477142 8:142802026-142802048 TGGAAGGGTGGATGGGTGGGTGG + Intergenic
1049477192 8:142802185-142802207 TGGAAGGGTGAATGGGTGGGTGG + Intergenic
1049477220 8:142802277-142802299 TGGAAGGGTGGTTGGGTGGGTGG + Intergenic
1049477964 8:142805686-142805708 AGGCAGGGGGTGTGGGTGGGAGG - Intergenic
1049641493 8:143718011-143718033 AACACAGGTGTGTGGGTGGGTGG - Intronic
1049773250 8:144393376-144393398 TGGAAGGGTGGGTGGGTGGGTGG + Intronic
1049773363 8:144393847-144393869 AGCAGGTGTGTCTGGGTGGGGGG - Intronic
1050151334 9:2621969-2621991 CGGGGAGGTGGCTGGGTGGGTGG + Exonic
1050221255 9:3393042-3393064 AGGAAGGGTGGGTGGGCGGGTGG + Intronic
1051039096 9:12784811-12784833 AGAAATGCTGTCTGGGAGGGAGG + Intronic
1051569719 9:18541994-18542016 ATGAAATGTGTCTGGTTGTGTGG + Intronic
1051710794 9:19928375-19928397 AGGAGAGGTTTCTGGGTAGGGGG + Intergenic
1052106195 9:24519994-24520016 AGGATAGGTGTGTGTGTGTGTGG + Intergenic
1053799911 9:41757707-41757729 TTGAAAGGTGGGTGGGTGGGTGG + Intergenic
1053803021 9:41775923-41775945 TGGATAGGTGAGTGGGTGGGTGG - Intergenic
1054142242 9:61539199-61539221 TGGATAGGTGAGTGGGTGGGTGG + Intergenic
1054191310 9:61987233-61987255 TGGATAGGTGAGTGGGTGGGTGG - Intergenic
1054454360 9:65421952-65421974 TGGATAGGTGGATGGGTGGGTGG + Intergenic
1054461990 9:65470346-65470368 TGGATAGGTGAGTGGGTGGGTGG + Intergenic
1054647059 9:67600484-67600506 TGGATAGGTGAGTGGGTGGGTGG + Intergenic
1055562754 9:77537227-77537249 AGGAAGGGGGTGTGGTTGGGAGG - Intronic
1055749325 9:79487283-79487305 AGGAAAGGTGACTATTTGGGGGG + Intergenic
1055793627 9:79950098-79950120 AGGAAAGGGGTGTGTGTGGATGG - Intergenic
1056238309 9:84618032-84618054 AGGAAGGGAGGCTGAGTGGGTGG - Intergenic
1056738119 9:89226906-89226928 AGGAAATTCCTCTGGGTGGGAGG - Intergenic
1056789422 9:89616073-89616095 AGGGAAGGTGTGTGTGTGTGTGG + Intergenic
1056821598 9:89845938-89845960 AGGGAAGGTGTTTGGGTGGAGGG + Intergenic
1056866139 9:90228657-90228679 AGGAAGGGTATCAGAGTGGGAGG + Intergenic
1057061640 9:92009214-92009236 TGGATAGGTGAGTGGGTGGGTGG + Intergenic
1057829063 9:98393271-98393293 TGGATAGGTATGTGGGTGGGTGG - Intronic
1057852598 9:98576949-98576971 TGGATAGGTGAATGGGTGGGTGG + Intronic
1057859726 9:98630711-98630733 AGGAAAGGAGTCAGTGTGAGAGG + Intronic
1057927801 9:99168420-99168442 GGAAAAGGTGTATGTGTGGGAGG + Intergenic
1058095455 9:100855181-100855203 AGCAAAGGAGACTGAGTGGGAGG + Intergenic
1058418906 9:104816636-104816658 AGGATGGGTGGGTGGGTGGGTGG + Intronic
1058881043 9:109286142-109286164 AGGGTAGGTGGGTGGGTGGGTGG + Intronic
1059395375 9:114031228-114031250 GGGAAAGGGGTGGGGGTGGGGGG - Intronic
1059769557 9:117413689-117413711 AGGAGATGGGTGTGGGTGGGGGG - Intronic
1060069424 9:120533420-120533442 AGGAAATGTTTTTGGGTGGAGGG - Intronic
1060155070 9:121313888-121313910 AGGAAGGGTGGCTGTGAGGGAGG - Intronic
1061108439 9:128550449-128550471 AGGCAGGGTGAGTGGGTGGGAGG + Intergenic
1061410491 9:130418622-130418644 AGGAACGATGACTGGGTGGAAGG + Intronic
1061846841 9:133392893-133392915 TGGATAGGTGGGTGGGTGGGTGG + Intronic
1061846956 9:133393329-133393351 TGGATAGGTGGGTGGGTGGGTGG + Intronic
1061906911 9:133703659-133703681 AGGGCAGGTGGCGGGGTGGGGGG - Intronic
1061945808 9:133907847-133907869 AGGAAAGGGGGTGGGGTGGGAGG - Intronic
1061945912 9:133908111-133908133 AGGAAGGGGGGCTTGGTGGGAGG - Intronic
1062093445 9:134690519-134690541 AGAAGAGGTGTCTGGGAGGCTGG + Intronic
1062109525 9:134774299-134774321 TGGAAAGGGGGCTGGGAGGGAGG + Intronic
1062197098 9:135280360-135280382 AGGAAAGGGGTCAGGTTGGACGG + Intergenic
1062247726 9:135578064-135578086 TGGACAGGTGAATGGGTGGGTGG - Intergenic
1062247795 9:135578410-135578432 TGGACAGGTGAATGGGTGGGTGG - Intergenic
1062247864 9:135578756-135578778 TGGACAGGTGAATGGGTGGGTGG - Intergenic
1203638863 Un_KI270750v1:139184-139206 AGGAAAGGAGGGTGGGAGGGAGG - Intergenic
1185624472 X:1472712-1472734 ATGAATGGTGGGTGGGTGGGTGG + Intronic
1185759791 X:2681641-2681663 AGCAAAGGTGCCAGGGTGGCTGG - Intergenic
1185848948 X:3467569-3467591 GGAAAGGGTGTGTGGGTGGGAGG + Intergenic
1185867797 X:3639094-3639116 GGGATAGGTGTGTGGGTGGGTGG + Intronic
1186155233 X:6718592-6718614 AGGAAAGGTGGAAGGGTGGGAGG + Intergenic
1186284242 X:8026939-8026961 AGGATAAGTGGCTGGGTGGATGG - Intergenic
1186284273 X:8027078-8027100 TGGAAAGATGAGTGGGTGGGTGG - Intergenic
1186394044 X:9189881-9189903 AGGATCAGTGTCTGTGTGGGAGG + Intergenic
1186508877 X:10115970-10115992 TGGATGGGTGGCTGGGTGGGTGG - Intronic
1186642486 X:11470944-11470966 AGGAAAGTTGTCTAGGAAGGAGG - Intronic
1186648313 X:11531495-11531517 GGGTAAGGTGAGTGGGTGGGTGG - Intronic
1186712437 X:12213421-12213443 ATGAAAGTTGGGTGGGTGGGTGG + Intronic
1186751838 X:12629323-12629345 ATGAAAGGTATGGGGGTGGGAGG + Intronic
1187869008 X:23749067-23749089 AGGAAAGATATTTGGGTAGGAGG + Intronic
1188549523 X:31347393-31347415 GGGAAAGGTGTGTGGGTAGAGGG - Intronic
1189048313 X:37617109-37617131 AGGAAAAGTGGGTGGGGGGGAGG + Intronic
1189267021 X:39725069-39725091 GAGAAAGGTAACTGGGTGGGTGG - Intergenic
1189974727 X:46449292-46449314 AGGAGAGGTGTGGGGCTGGGTGG - Intronic
1189984643 X:46543501-46543523 AGGAGAGGTGTGGGGCTGGGTGG + Intronic
1190005715 X:46735905-46735927 AGACAAGGTGTCTGGGTGCGGGG - Intronic
1190197139 X:48329288-48329310 AGGAAAGGTGTGTGTGGTGGAGG + Intergenic
1190300152 X:49052820-49052842 ATGAAAGGTGGCTGGGTAAGAGG + Intergenic
1190663878 X:52679666-52679688 AGGAAAGGTGTGTGTGGTGGAGG + Intronic
1190675544 X:52778756-52778778 AGGAAAGGTGTGTGTGGTGGAGG - Intronic
1190953862 X:55172116-55172138 AGGTGGGGAGTCTGGGTGGGTGG + Intronic
1192428544 X:71097370-71097392 AGAAAAGGTGTTGGGGTGGGAGG - Intronic
1194936197 X:99951850-99951872 AGGAAAGGTCTCTCTGAGGGAGG + Intergenic
1195075265 X:101321450-101321472 GGAAAGGGTGTGTGGGTGGGAGG + Intergenic
1195372938 X:104197984-104198006 AGGTAAGGTGAGTGGGTAGGTGG - Intergenic
1195685034 X:107577756-107577778 AGAAGATGTGTGTGGGTGGGGGG - Intronic
1195688319 X:107604297-107604319 GGGAAAGGGGTAGGGGTGGGGGG + Exonic
1196752988 X:119134122-119134144 GGGAAGGGTGTATGGGTGGCAGG - Intronic
1196898180 X:120358605-120358627 AGCAAAGGTTTCTGGGAGGCTGG + Intergenic
1197269579 X:124411098-124411120 TGAAAAGGTGTTTGGGTGGGTGG - Intronic
1197329857 X:125140430-125140452 GGGAAGGGTGTGTGGGTGGATGG + Intergenic
1197891978 X:131277811-131277833 AGGAAAGGGGGCAGGGTGGAGGG - Intronic
1199257358 X:145732083-145732105 AGTAAAGGAGTCTGGATGGATGG + Intergenic
1200256734 X:154586306-154586328 AGGGATGGGGCCTGGGTGGGTGG + Intronic
1200261035 X:154618097-154618119 AGGGATGGGGCCTGGGTGGGTGG - Intronic