ID: 934575968

View in Genome Browser
Species Human (GRCh38)
Location 2:95401867-95401889
Sequence CTGAGGAAAGGTGTCTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 330}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934575968_934575978 15 Left 934575968 2:95401867-95401889 CCCACCCAGACACCTTTCCTCAG 0: 1
1: 0
2: 2
3: 30
4: 330
Right 934575978 2:95401905-95401927 AAAACTTCTCAAATAGAAGTCGG 0: 3
1: 0
2: 1
3: 35
4: 363
934575968_934575979 16 Left 934575968 2:95401867-95401889 CCCACCCAGACACCTTTCCTCAG 0: 1
1: 0
2: 2
3: 30
4: 330
Right 934575979 2:95401906-95401928 AAACTTCTCAAATAGAAGTCGGG 0: 3
1: 0
2: 0
3: 19
4: 288
934575968_934575980 22 Left 934575968 2:95401867-95401889 CCCACCCAGACACCTTTCCTCAG 0: 1
1: 0
2: 2
3: 30
4: 330
Right 934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG 0: 1
1: 2
2: 0
3: 2
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934575968 Original CRISPR CTGAGGAAAGGTGTCTGGGT GGG (reversed) Intergenic
900337115 1:2169747-2169769 CAGAGGGGAGGTGGCTGGGTGGG + Intronic
900548813 1:3243432-3243454 CTGCGGAAGGGTGGCTTGGTGGG - Intronic
901154163 1:7124259-7124281 CAGGGGACAGGTGTCTGGGAGGG - Intronic
901357640 1:8665098-8665120 CTTAGCAAAGGACTCTGGGTAGG - Intronic
901710673 1:11112286-11112308 CTCACTAATGGTGTCTGGGTTGG - Intronic
901863620 1:12090012-12090034 ATGGGGAAAGGTGGATGGGTGGG - Intronic
902552873 1:17229709-17229731 CTAAGCAAAGGGGTCAGGGTGGG - Intronic
903066310 1:20701631-20701653 CTGAGGAGAGGTGGGTGGGGAGG + Intronic
903363533 1:22792267-22792289 CTGGGGAAGGGTGTGAGGGTTGG + Intronic
904828933 1:33294528-33294550 CTTAGGGAAGGAGGCTGGGTGGG + Intronic
905033183 1:34901055-34901077 CTGGGGAAAGGTGGTAGGGTCGG + Intronic
905276113 1:36819331-36819353 CAGAGGCAGGGAGTCTGGGTGGG - Intronic
905856987 1:41320774-41320796 CTGAGCAAATGTCTCTGGGAAGG + Intergenic
906057608 1:42929088-42929110 TTGAGGCAAGGCCTCTGGGTGGG - Intronic
906472622 1:46143935-46143957 CTGGGAAAGGGTGTGTGGGTGGG - Intronic
906638266 1:47424873-47424895 CAGAGGAAAGGGGGCTGGGCTGG + Intergenic
906748175 1:48235945-48235967 CTGAACAGAGGTGGCTGGGTTGG + Intronic
907570744 1:55480990-55481012 CTTAGGAGAGGGCTCTGGGTTGG + Intergenic
908266776 1:62387000-62387022 CTGATGAAATGGATCTGGGTTGG + Intergenic
908907446 1:69032394-69032416 CTTGGGAAAGGTGTGTGGGTGGG + Intergenic
909597438 1:77422267-77422289 CTGAGGGAAGGAGACTGGTTAGG - Intronic
910100853 1:83574600-83574622 GTGAGGGAAGGTGTCTGGTCTGG + Intergenic
910174264 1:84412391-84412413 CTGGTGAAAGGTGGCTGGGATGG - Exonic
911200030 1:95034991-95035013 CTTAGGGAATGTGTCGGGGTAGG - Intronic
912382789 1:109256266-109256288 CTGTGGGCTGGTGTCTGGGTGGG + Intronic
912580979 1:110720676-110720698 CTGAGGAAAATTGTCTGGCAGGG + Intergenic
913521833 1:119651851-119651873 CTGAGAAAAGGGGTGTGGGAAGG + Intergenic
914215717 1:145626262-145626284 CTGGAGAAAGGTGTCAGAGTCGG - Intronic
914467663 1:147946647-147946669 CTGGAGAAAGGTGTCAGAGTCGG - Intronic
914850392 1:151309823-151309845 ATGGGGAAAGGGTTCTGGGTGGG + Intronic
914924452 1:151872287-151872309 CTGTGGAAGGATGACTGGGTAGG + Intergenic
915858302 1:159414245-159414267 CCTAGGAATGGTGTGTGGGTAGG - Intergenic
916018889 1:160775948-160775970 CTGAGCAAAGGGGTCTGGTAAGG + Intergenic
917846954 1:179027080-179027102 CAGAGGGAAGCTGGCTGGGTGGG - Intronic
919030984 1:192242427-192242449 CTCAGGAAAGCTGCCTGGGGAGG + Intergenic
919808049 1:201392451-201392473 ATGAGAGAAGGTGGCTGGGTGGG + Intronic
920213414 1:204345401-204345423 CTGAGCAAAGAAGCCTGGGTTGG - Intronic
921118077 1:212113312-212113334 CTCAGGAGAGGGGTCTGGGGTGG + Intergenic
922212733 1:223498081-223498103 CTGAGAAAGGGTGTCTTGGTGGG - Intergenic
923082314 1:230669946-230669968 GTGTGGAAAGGTGTGTGAGTGGG + Intronic
923688872 1:236174194-236174216 CTTAGGAAAGGAGGCTGTGTTGG - Intronic
924018985 1:239760536-239760558 GTAAGGAAAGGTGTGTAGGTGGG - Intronic
1063125662 10:3134578-3134600 CAGAGGTAAGGGGTCTGGGGAGG + Exonic
1063295410 10:4800240-4800262 CAGGGGAAAGGTGGGTGGGTGGG + Intronic
1063886975 10:10589528-10589550 CTGAGGAAAGGTGTACGAATTGG - Intergenic
1064969470 10:21049657-21049679 GTGAGGAACGGGGTCAGGGTGGG - Intronic
1065092291 10:22246947-22246969 CAGAGGAATGGTTTTTGGGTAGG - Intergenic
1065567274 10:27025806-27025828 CTCAGGAAAGAGGTCTGGGCTGG - Intronic
1065685754 10:28282911-28282933 CTGAGGTACGGTGTGTGGATAGG + Intronic
1066472322 10:35711236-35711258 CTGTGGAGAGGTGGCTGGGAAGG - Intergenic
1067346647 10:45442953-45442975 CTGAGGAAATGTGCCAGGGGAGG - Intronic
1067969152 10:50949823-50949845 CTGAGTTAAGGAGTCTGGGGTGG - Intergenic
1070504496 10:77101173-77101195 CTGATGAGAGGGGTCTTGGTGGG - Intronic
1070546565 10:77457415-77457437 CAGAGGAAAGGACTCTGGGGAGG - Intronic
1070820430 10:79350961-79350983 CTGAGGAAAGATGTCAGCCTTGG + Intronic
1072693935 10:97589527-97589549 CTGGGGACAGCTGTCAGGGTAGG + Intronic
1073185433 10:101612742-101612764 CTGAGGAGGAGTGGCTGGGTGGG - Intronic
1073489935 10:103846452-103846474 CTCAGGAGAGGTGGCTGGGCAGG + Intronic
1073636116 10:105200526-105200548 CTGAGAAATGGTGTCAGGGTGGG + Intronic
1074842575 10:117369989-117370011 CTGAGTAATAGTGTCTGGGTGGG - Intronic
1075793380 10:125101963-125101985 CTGATGAGAGGTGGCTTGGTGGG - Intronic
1077113441 11:872135-872157 CTAAGGGAAACTGTCTGGGTTGG - Intronic
1077480368 11:2811761-2811783 CTGAGCAACGGTGGCTGGGATGG + Intronic
1078496113 11:11818816-11818838 CTGAGGCAAGGTACATGGGTAGG - Intergenic
1079104280 11:17560501-17560523 CTGAGCAAAGGTCTAGGGGTGGG + Intronic
1079175626 11:18137601-18137623 CTGATGACAGGTATCTGGGGCGG - Exonic
1079214864 11:18500002-18500024 CTTAAGAACGGTGTGTGGGTGGG - Intronic
1080893674 11:36431096-36431118 GGGAAGAAAGGGGTCTGGGTGGG + Intronic
1081751953 11:45517654-45517676 ATGAGCAAAGGTGTGTGAGTTGG + Intergenic
1081777966 11:45689288-45689310 CTCAGGAAATGAGTCTGGCTAGG - Intergenic
1083490867 11:63014502-63014524 CTGAGGACAGGTCACTGGGCAGG - Intronic
1083935384 11:65867248-65867270 CTGAGGGCAGGAGCCTGGGTGGG - Intronic
1084998407 11:73006227-73006249 TTTAGGGAAGGTGTCTGGGCAGG - Intronic
1085203159 11:74713872-74713894 ATGAGGACAGGTGACTGGGAGGG + Intronic
1088812447 11:113400750-113400772 CTGAGGAAGGGGCTCTGGCTTGG + Intergenic
1089289383 11:117428577-117428599 CTGAGGTAAGGTGGCTGTGGAGG + Exonic
1089403032 11:118175805-118175827 TTGGGGAATGATGTCTGGGTTGG - Intronic
1089671940 11:120062767-120062789 CTAAGGAGAAGCGTCTGGGTGGG - Intergenic
1089682319 11:120125557-120125579 CTGAGGAAGGGTGGGTGGGTGGG + Intronic
1089993683 11:122884686-122884708 CTGGGGAAAGTTGAGTGGGTGGG - Intronic
1090077840 11:123590670-123590692 CTGAGGAAAGGGGTGTGTGTTGG + Intronic
1091657363 12:2355358-2355380 CTGAGGAAATGTGGGGGGGTGGG - Intronic
1094158862 12:27368592-27368614 CTGAAGAAAGGTGTCTAGGAGGG + Intronic
1094248337 12:28329226-28329248 CTAAAGCAAGGTGTTTGGGTTGG + Intronic
1094267921 12:28579988-28580010 CTGGTGGAAGGTGTGTGGGTCGG + Intergenic
1095205853 12:39440322-39440344 CTGAGTCAAGCTATCTGGGTTGG + Intronic
1095215184 12:39539501-39539523 CTGAGGAAAAGAGTCTCAGTGGG - Intergenic
1095797689 12:46238287-46238309 ATGAGGAAAAGTGTCTGAGTTGG + Intronic
1096186457 12:49584864-49584886 CTGAGGAAACATGGATGGGTGGG - Intronic
1096503390 12:52079087-52079109 CTGAGAAAAGGAGTGGGGGTGGG + Intergenic
1096884434 12:54702149-54702171 TTGAGGAAAGGTGTCTGTGCAGG - Intergenic
1097010952 12:55953185-55953207 CTGAGGGAAGGTGTGGGGCTGGG + Intronic
1097021771 12:56025841-56025863 ATGAAGAAAGATGTCTGGCTTGG - Intronic
1098031924 12:66264297-66264319 CAGAGTAAAAGTGTCTGGGAGGG - Intergenic
1099444091 12:82731276-82731298 CTGAGCAAATGTTTCTGCGTAGG + Intronic
1099649100 12:85401713-85401735 CTTAGGAAAGGTGTTAGAGTTGG + Intergenic
1099941653 12:89196330-89196352 CTGAGATAAGGTGTATGGGTAGG - Intergenic
1101287359 12:103328777-103328799 CTGAGGAAGGGAGTCTGTCTGGG + Intronic
1101403878 12:104411621-104411643 CTGAGCAGAGGGGTCGGGGTGGG - Intergenic
1101566587 12:105911622-105911644 CTGATAAAAGGGGTCTGGGCAGG - Intergenic
1102212690 12:111138672-111138694 CTTGGCAAAGGGGTCTGGGTGGG - Intronic
1102895609 12:116595807-116595829 AGGAGGATAGGTGGCTGGGTGGG + Intergenic
1103400917 12:120641872-120641894 AAGAGAAGAGGTGTCTGGGTAGG + Intronic
1103727128 12:123003528-123003550 CAGAAGAAAGGTGCCTGGTTTGG - Intronic
1105505810 13:21008732-21008754 CTGAGGAAAGGTGTGTAAATTGG + Intronic
1110239232 13:73248334-73248356 CTGAGGAAAGTGATCTGGGATGG + Intergenic
1111168283 13:84491643-84491665 CTTTGGAAAGGAGTCTGGCTAGG + Intergenic
1114257945 14:21018458-21018480 TTGAGGAACGAGGTCTGGGTGGG + Exonic
1114361883 14:21983226-21983248 CTCAGGAAAGCTGTCTAGGGTGG + Intergenic
1115817502 14:37178694-37178716 CTTAGTAAAGGGATCTGGGTGGG - Intergenic
1116509503 14:45726437-45726459 CTCTGGGAAGGTCTCTGGGTGGG + Intergenic
1118709016 14:68504513-68504535 CTGGAGAAATGTGTCTGGGCTGG + Intronic
1119236751 14:73026629-73026651 CTGGGGAGAGGTGTCGAGGTGGG - Intronic
1119671793 14:76525619-76525641 CTGGGGAGGGGTGTCTGAGTAGG + Intergenic
1121337219 14:93084821-93084843 CTGAGGAAGGGTGCCTGGCAGGG - Intronic
1125629710 15:41137247-41137269 CTGAGGAAAGCTTTTGGGGTAGG - Intergenic
1128061126 15:64736653-64736675 CTGAGAGAAGGTGTTGGGGTGGG + Intergenic
1128245909 15:66132634-66132656 CTGAGGAAGGGGGGCTGAGTGGG + Intronic
1128754021 15:70169244-70169266 ACGAGGAAAGGTGTGTGGTTTGG + Intergenic
1129045544 15:72730792-72730814 CTAAGGAAAGGTATCAAGGTGGG - Intronic
1129103900 15:73292006-73292028 CAGAGGAAAGCTGTCTGAGGAGG - Intronic
1129324994 15:74795103-74795125 CTGAGCAAAGGTGTCAGGCAGGG - Intronic
1129517611 15:76166198-76166220 CTCGGCAAAGGTGTCTGGGGAGG + Intronic
1129536333 15:76316267-76316289 ATGAGGATAGGTGTCTGGAGTGG - Intergenic
1129614040 15:77083974-77083996 CTGAGCAAAGCCGACTGGGTAGG - Intronic
1132521511 16:392154-392176 CTGTGGACAGGAGGCTGGGTGGG + Intergenic
1132860845 16:2071060-2071082 CTGAGCAGAGGTGACTGGGATGG + Intronic
1134200207 16:12191640-12191662 CTTAGAAAAGGTGGCGGGGTTGG + Intronic
1137476844 16:48816815-48816837 CTGAGGAAGGGGTTGTGGGTGGG + Intergenic
1138369985 16:56519448-56519470 CTGAGGGAAGGGGTTTGGTTCGG - Intronic
1140900378 16:79361365-79361387 GTGAAGCAAGGTGCCTGGGTTGG + Intergenic
1141199525 16:81886492-81886514 CTTAGGATAAGTGTCTGGGAGGG - Intronic
1141563308 16:84884643-84884665 AGGAGGAAAGGTGTTTGCGTGGG + Intronic
1141766108 16:86060920-86060942 CTGAGGAGAGGAGCCTGGGGAGG + Intergenic
1142964279 17:3571251-3571273 CTGAGGACAGGTGCCTGGGCTGG + Intronic
1142976186 17:3645983-3646005 CTGAGTGACGGGGTCTGGGTCGG + Intronic
1143118232 17:4592462-4592484 CAGAGGAGGGGTGGCTGGGTAGG + Intronic
1143393632 17:6575392-6575414 CAGAGGAACGATGTGTGGGTGGG + Intergenic
1143730016 17:8876114-8876136 CTGAGGAAAGGGGCCGAGGTAGG - Intergenic
1144624485 17:16837851-16837873 CTGAGGACATGTGCCTGGGCTGG - Intergenic
1144881942 17:18434869-18434891 CTGAGGACATGTGCCTGGGCTGG + Intergenic
1145150291 17:20509517-20509539 CTGAGGACATGTGCCTGGGCTGG - Intergenic
1146162218 17:30566158-30566180 CTGAGGACATGTGCCTGGGCTGG - Intergenic
1146675148 17:34768161-34768183 GTGAGGAAGGGGGTCTGGCTTGG - Intergenic
1146727948 17:35170901-35170923 ATGAGGAAAGGAGTCTGGGGGGG - Intronic
1147578619 17:41616572-41616594 CTGAGGACATGTGCCTGGGCTGG - Intergenic
1148080240 17:44963994-44964016 CTGGGGAAAGGACTCTGGGTTGG - Intronic
1149237102 17:54605280-54605302 CTGAGGGAACATGTCTGGTTTGG - Intergenic
1149534207 17:57419903-57419925 CTGAGGACAGTTGTCGGTGTTGG + Intronic
1149642314 17:58211156-58211178 CTGTGGAGAAGTGTCAGGGTGGG - Intronic
1151129723 17:71883791-71883813 CTCAGGAAATGTGTCTTGATCGG + Intergenic
1152505002 17:80743544-80743566 CTTGGGAAAGGTGCCTGCGTGGG + Intronic
1152637598 17:81436436-81436458 CTGGGAAACGGTGTCTGGGAAGG + Intronic
1154034471 18:10786069-10786091 CTTAGGAAAAGTGTGTGAGTTGG - Intronic
1155226956 18:23737381-23737403 GTGAGGGAAGGTGGCTGGGAAGG - Intronic
1155250954 18:23952967-23952989 CTGGGGAAAGGAGGCTGGTTAGG - Intronic
1155424988 18:25697633-25697655 CTGAGGCCAGGTGACTGGGCTGG - Intergenic
1155737968 18:29247741-29247763 CTCAGGAAAGATGTCTTGGCTGG - Intergenic
1159499399 18:69250647-69250669 CTCAGGAAAGATGCCTGGGGTGG + Intergenic
1160090853 18:75825449-75825471 CTGAGGGTGGGGGTCTGGGTTGG - Intergenic
1161574218 19:5046995-5047017 TTCAGAAAAGGTGTCTGGGCTGG + Intronic
1162935775 19:13980768-13980790 CTCAGGAGAGCTGTCTGGGGAGG + Intronic
1163101532 19:15100200-15100222 GTGAGGACAGGTGGCTGGGTGGG - Intergenic
1164454818 19:28398268-28398290 CTGTGAAAATGTGTCTGGCTGGG - Intergenic
1164615374 19:29664344-29664366 CTCAGGAGAGGACTCTGGGTTGG + Intergenic
1165005109 19:32798504-32798526 AGGAGGAAAAGTGTCTGGTTGGG + Intronic
1167565683 19:50255190-50255212 GTGAGGACAGATGTGTGGGTGGG - Intronic
1168597129 19:57686564-57686586 CTGAGGTGAGTTTTCTGGGTGGG - Exonic
925377776 2:3400512-3400534 CTGAGGAAAGGCACCTGGGAAGG - Intronic
926073470 2:9920876-9920898 CTGAGGAGAGGAATCTGTGTAGG + Intronic
927443873 2:23140920-23140942 TTCAGGAAAGGCTTCTGGGTTGG + Intergenic
928439129 2:31277002-31277024 ATGAGGAAAGTTGTGTGGGGTGG + Intergenic
928458138 2:31443311-31443333 CTGATGGGAGGTGTTTGGGTCGG - Intergenic
929553605 2:42909765-42909787 GTGAGGAAAGAAGTCTGGGCCGG + Intergenic
934571506 2:95375726-95375748 CACAGGGAAGCTGTCTGGGTGGG - Intronic
934575968 2:95401867-95401889 CTGAGGAAAGGTGTCTGGGTGGG - Intergenic
934638140 2:96009724-96009746 CTAAGGAAAGGTATCTGGGTGGG - Intergenic
934772132 2:96913814-96913836 CTGAGGAAAGGACTCAGGGACGG - Intronic
934795512 2:97095686-97095708 CTAAGGAAAGGTATCTGGGTGGG + Intergenic
936376882 2:111948452-111948474 CTCAGGAGAGGGGTCTGGGCTGG - Intronic
936401002 2:112164451-112164473 CTGGGGAAGAGTGTCTGGGGAGG + Intronic
937567939 2:123318778-123318800 CTGGTGGAAGGTGTTTGGGTAGG - Intergenic
939136830 2:138306333-138306355 GTGAGGAATGGTGTGTGTGTCGG - Intergenic
939988380 2:148854748-148854770 CTGGGAAAGGCTGTCTGGGTGGG - Intergenic
940328409 2:152449912-152449934 ATGAGGAAAGGTTTCTATGTAGG - Intronic
941801533 2:169665080-169665102 CTGAGGAAAAGTTTCTGAGCAGG + Intronic
942462141 2:176175657-176175679 CTGAAGAAAGGGGTCAGGGCAGG + Intergenic
944825904 2:203482963-203482985 CTGGGGAAAGGCGTCTGGGCAGG + Intronic
945001840 2:205359850-205359872 CTGAGGAAATTTCTCTGGCTTGG + Intronic
945865945 2:215175792-215175814 ATTAGGAAAGGTGTGTGGATAGG - Intergenic
945930347 2:215848816-215848838 CTCAGGAAAGCTGCCTGGGGTGG + Intergenic
946574641 2:221061578-221061600 GTCAGGAAAGGTGTCTGAGCAGG + Intergenic
946581883 2:221137844-221137866 GTGAGGGAAGGTCTCTGTGTGGG + Intergenic
947752713 2:232541167-232541189 CTGAGGAAGTCTGTCTGGGGCGG + Intronic
947945454 2:234097956-234097978 CTCAAGAAAGGTGTCAGGTTGGG - Intergenic
948889803 2:240902010-240902032 GTGAAGAAAGGTGCCTGGGGAGG - Intergenic
1169061102 20:2660891-2660913 CTGAGGTAGGTGGTCTGGGTGGG - Exonic
1169694984 20:8377221-8377243 GTGGGGAAAGGTGTCTTGATAGG + Intronic
1170908493 20:20539298-20539320 CTGGTGAAAGGTGTTTGGGCTGG - Intronic
1171023408 20:21607605-21607627 TTGAGGAGAGGTGTCTGGGAGGG + Intergenic
1172282283 20:33716417-33716439 CTGAGGGAAGGTGGCTGGGGAGG - Intronic
1172738472 20:37147089-37147111 CTAAGGAAAGGAACCTGGGTAGG - Intronic
1173521504 20:43703521-43703543 CTGCAGAGAGGTGTCTGGGCTGG + Intronic
1173753985 20:45498655-45498677 CTCATGATAGGTGCCTGGGTTGG + Intergenic
1173933765 20:46843896-46843918 CTGAGTAAATGTGTTTGGGGAGG + Intergenic
1175129976 20:56781878-56781900 ATGAGGAAAGGGGTCTGTCTGGG + Intergenic
1175335846 20:58195904-58195926 ATGGGGAAAGGTGGGTGGGTGGG - Intergenic
1175400630 20:58698121-58698143 CAGAGGGAAGGCGTCTGGGAGGG + Intronic
1177057157 21:16320156-16320178 CTCAGGAAAGGAGTCTGGATTGG + Intergenic
1177752032 21:25296507-25296529 CTCAGGAAAGCTGCCTGGGATGG - Intergenic
1177883662 21:26722972-26722994 TAGAGAAAAGGTGTCTGGGAGGG - Intergenic
1179064852 21:38015301-38015323 CTGAGGCAAGGTGGCTGTGTCGG - Intronic
1179177780 21:39021496-39021518 CTGAGGAAGGCTGGGTGGGTGGG + Intergenic
1179451593 21:41472156-41472178 CTGAGGCAGGGAGTCGGGGTTGG - Intronic
1179731886 21:43372685-43372707 CTGGGGAACGGGGTCTGGGGAGG + Intergenic
1180138397 21:45875990-45876012 CTGAGGAAAGGTGTGGGGTGAGG + Intronic
1180721818 22:17915035-17915057 GTGATGAAAGGCCTCTGGGTGGG + Intronic
1182112508 22:27733608-27733630 CCAAGGTAGGGTGTCTGGGTAGG - Intergenic
1182409497 22:30171244-30171266 TTCAGGAAAGAGGTCTGGGTTGG - Intronic
1183415850 22:37681423-37681445 CTGAGGCATGGTGCGTGGGTGGG + Intergenic
1184289766 22:43492459-43492481 CTAAGGAATGGCCTCTGGGTGGG - Intronic
1184433190 22:44453703-44453725 CCGAGGACAGGTGTGTGGGCAGG - Intergenic
1184582667 22:45428087-45428109 GTGAGGAAAGGTGTTTGGGAGGG + Intronic
1184729376 22:46364499-46364521 CAGAGGAAAGGTGCCTGGGGAGG - Exonic
1184873649 22:47258469-47258491 CTGAGGAAAAGGGGCTGGGGTGG - Intergenic
1184932428 22:47691288-47691310 CTCAGGACAGGAGGCTGGGTGGG - Intergenic
950023255 3:9803660-9803682 CTGGGGGAGGGTGTCTAGGTTGG - Intronic
950269954 3:11605764-11605786 ATGAGGCAAGGTGACAGGGTGGG + Intronic
950551127 3:13666448-13666470 CTGAGAAATGGTGAGTGGGTGGG + Intergenic
951701588 3:25502476-25502498 GTTAGGAAAGATATCTGGGTGGG - Intronic
952144303 3:30514988-30515010 CTCAGGAAAGGTTGCTTGGTGGG - Intergenic
952983348 3:38756163-38756185 CTGGTGAAAGGGATCTGGGTGGG - Intronic
953221334 3:40974291-40974313 GTGAGGAAAGGCCTCTGGGAAGG - Intergenic
953845321 3:46422084-46422106 CTGGCCAAAGGTGTCTGGCTTGG - Intergenic
954287251 3:49627723-49627745 CTGAAGTTAGGTGTCTGGGTGGG + Intronic
956382064 3:68674983-68675005 CTGGGGAGGGGTCTCTGGGTGGG - Intergenic
956769936 3:72516663-72516685 CTGAAGAAAGGTGACTGGAATGG + Intergenic
960488569 3:118282360-118282382 CTGAGGAAAGCCGTCTGAGGAGG - Intergenic
961043461 3:123693447-123693469 TTTAGGAAAGGTGTCTGAGCTGG + Intronic
961639529 3:128356424-128356446 CTGATTAAAGCTGCCTGGGTGGG + Intronic
962120825 3:132558094-132558116 CTGAGGAAAGCTGGCTGGATTGG - Intergenic
962247235 3:133805910-133805932 CTGCCGCAAGGTGTCTAGGTAGG - Exonic
962310866 3:134326014-134326036 CTGAGGCCAGGTGTATGAGTGGG - Intergenic
962921444 3:139953829-139953851 TTGAGCAAAGGTGTGTGTGTAGG - Intronic
963411273 3:144931169-144931191 CTTAGGAAAGGTGTCTCTTTTGG - Intergenic
963915165 3:150852527-150852549 CTCAGGAAAGCTGCCTGGGGTGG - Intergenic
964620403 3:158715431-158715453 TGGAGAAAAGGTGTCTGGGGAGG + Intronic
964926688 3:161967341-161967363 CTGAGGAAAGAAGCCTGGGCAGG + Intergenic
966932213 3:184683145-184683167 TTCAGGAAAGGTGTCCAGGTAGG - Intronic
967120417 3:186377941-186377963 CTGAGGCAAGGCCTCTGGGTGGG - Intergenic
967409697 3:189154860-189154882 ATCAGGAAAGGTGAGTGGGTTGG + Intronic
967556838 3:190869244-190869266 CTGAGGAAAGCTGACAGAGTAGG + Intronic
968938399 4:3625279-3625301 TGAAGGAAAGATGTCTGGGTTGG + Intergenic
969059368 4:4423003-4423025 CTCAGGGATGGTGTCTGCGTGGG - Intronic
969257620 4:6013205-6013227 CTGAGGAAAGGTCTCAAGGGTGG + Intergenic
969398755 4:6939731-6939753 CTGAGGAGAGGGGTGGGGGTGGG + Intronic
971188229 4:24401798-24401820 CTGATGAGAGGTGAGTGGGTTGG + Intergenic
971345982 4:25812265-25812287 GTGAGGAGAGGTATCTGAGTGGG - Intronic
971379353 4:26082871-26082893 CTTAAGAAAAGTGTCTGGCTTGG - Intergenic
973682845 4:53338921-53338943 CTGGGTATAGGAGTCTGGGTTGG - Intronic
974776721 4:66492827-66492849 CTCAGGAAAGCTGCCTGGGGCGG - Intergenic
974853983 4:67437569-67437591 CTGAGGATGTGTGTATGGGTAGG - Intergenic
976408535 4:84686562-84686584 AAGAGGAAAGCTGTCTGTGTAGG + Intronic
976545836 4:86334676-86334698 TTGAGGAAACGTGTTTGGATAGG - Intronic
977939220 4:102840558-102840580 GCTGGGAAAGGTGTCTGGGTGGG + Intronic
980932221 4:139192891-139192913 CTGAGCAAAGGCATATGGGTGGG - Intergenic
981498423 4:145419577-145419599 GAGAGGAAAGGTGCCTGGCTTGG + Intergenic
983003891 4:162458130-162458152 GTAAGAAAAGGTTTCTGGGTAGG + Intergenic
984392321 4:179151946-179151968 CTGATAAAAGGTATCTGGGCAGG - Intergenic
984709810 4:182875663-182875685 CTGAGGCAGGGTGTGTGGGAGGG + Intergenic
985920994 5:2973788-2973810 CTGATGACAGATCTCTGGGTTGG - Intergenic
989600045 5:43192447-43192469 CAGAGGAAGGGTGGCGGGGTGGG - Intronic
989622104 5:43395150-43395172 CTGAGGAAAGATGTTTAAGTTGG + Intronic
992267255 5:75031644-75031666 CTGAGGAATGGGGCCTAGGTAGG + Intergenic
992913468 5:81422430-81422452 CTGAGGAAAGGTGGGTGATTAGG + Intronic
994130588 5:96223106-96223128 CTGAGAAAGGGTGTGAGGGTAGG + Intergenic
995751388 5:115456666-115456688 CTGTGGACAGGTGTCAGGGCAGG + Intergenic
998406826 5:141878742-141878764 CTGGGGACAGGTGTTTGAGTAGG - Intronic
998690387 5:144581186-144581208 CTGAGGAAAGACGTCTGCTTTGG - Intergenic
1000467579 5:161598918-161598940 ATCAGGAAAGCTGTTTGGGTTGG + Intronic
1000569753 5:162897023-162897045 CTGTGGAAAGGTCTCTTGTTAGG - Intergenic
1000771833 5:165364366-165364388 GGTAGGAAAGGTGTATGGGTGGG + Intergenic
1000849043 5:166317630-166317652 GTGAGGAAAGGAGTCAGGGCTGG + Intergenic
1000935815 5:167302460-167302482 AGGAGGAAAGGGGTCAGGGTGGG + Intronic
1001037696 5:168309490-168309512 CTGTGGAGAGGGGGCTGGGTAGG - Intronic
1002663667 5:180807581-180807603 TTGAGGGCAGGTGTCTGGCTAGG - Intronic
1003683368 6:8277636-8277658 CTGGGGCAGGGTGTCTGGGGAGG + Intergenic
1003724776 6:8748582-8748604 CTGAGGAAAGGCATGTGGGCTGG + Intergenic
1004775892 6:18844467-18844489 CTGTGAAAAGGTGTTTGGGAAGG + Intergenic
1005763175 6:28986344-28986366 CTGAGGAATGGGGTGGGGGTAGG - Intergenic
1006424173 6:33953879-33953901 GAGAGGAAAGGTTTCAGGGTTGG + Intergenic
1006557421 6:34879737-34879759 CTGAGGAAAGGAATCAGGGAGGG + Intronic
1007088384 6:39166708-39166730 TGGAGGAGAGGTGTCTGGGCAGG - Intergenic
1007744481 6:44034919-44034941 TTGAGGTAAGAGGTCTGGGTGGG - Intergenic
1010267470 6:73883153-73883175 CTGAGCAGAGGTGGCAGGGTAGG - Intergenic
1011058499 6:83234349-83234371 CAGAGGATAAGTGTCTGGGTTGG - Intronic
1011752721 6:90469519-90469541 CAGGGGAAGGGTGTCTGGGCGGG - Intergenic
1016356546 6:143224783-143224805 CTGAGGACAGCTGTAGGGGTAGG - Intronic
1017415329 6:154214322-154214344 CTGGGGGAAGGTGAATGGGTGGG - Intronic
1018066845 6:160130675-160130697 CTCTGGAAAGGGGTCTGGGCTGG + Intronic
1018188906 6:161291587-161291609 CTGAGTAGGGGTGCCTGGGTGGG - Intergenic
1019809232 7:3152373-3152395 TTGAGAAAAGGGGTCTGGGCTGG + Intronic
1020088292 7:5323336-5323358 GTGAGGACAGGTGTGGGGGTGGG - Intronic
1021920143 7:25476527-25476549 CTCAGGCAAGATGTCTGGGCAGG + Intergenic
1022503966 7:30899064-30899086 GTGAGGAAAGGGGCTTGGGTTGG + Intergenic
1022922770 7:35033243-35033265 GTCAGGAAAGGTCTCTGGGGAGG - Intronic
1023659642 7:42459021-42459043 CTGAGAAAAGGTAACTGGGCAGG + Intergenic
1023713057 7:43014909-43014931 CTGCTGTAAGGTGTGTGGGTGGG + Intergenic
1023948390 7:44821851-44821873 TTGAGGAAAGGGGGCTGGCTAGG - Intronic
1024505566 7:50158745-50158767 CTGGGGAGAGCTCTCTGGGTGGG - Intronic
1024738714 7:52333196-52333218 CTGAAGAAAAGTTTCGGGGTAGG + Intergenic
1025206020 7:56993779-56993801 GTGAGGACAGGTGTGGGGGTGGG + Intergenic
1025665920 7:63583160-63583182 GTGAGGACAGGTGTGGGGGTGGG - Intergenic
1026441578 7:70449368-70449390 CTCAGGAAAGGATTGTGGGTTGG + Intronic
1029124671 7:98287874-98287896 CTGGGCAAAGGGGTGTGGGTGGG - Intronic
1030079165 7:105762557-105762579 CTGAAGAAAGGTGATTGGGTAGG - Intronic
1032665706 7:134034172-134034194 CTGGAGAAAGTTCTCTGGGTGGG + Intronic
1032765313 7:134986430-134986452 CGGAGGAAAGGAGCCTGCGTAGG - Intergenic
1034218980 7:149430051-149430073 ATGAGGAAAGCTTTCTTGGTGGG - Intergenic
1034781595 7:153887002-153887024 CCGAGGAGGGGTGTCTGGGGAGG + Intergenic
1034901307 7:154909657-154909679 CTGTGGAAGGCTGTCTGGGAGGG - Intergenic
1035062636 7:156080285-156080307 CTGTGGACAGGTGACTGGGGGGG - Intergenic
1035639887 8:1176773-1176795 CTGTGGAAAGAGGTCTCGGTTGG + Intergenic
1038534955 8:28347232-28347254 CCCAGGACAGGTGGCTGGGTAGG + Exonic
1038671160 8:29584339-29584361 CAGAGGAAAGGTTTTTGGATGGG + Intergenic
1039677670 8:39687601-39687623 ATGGGGAAAGGGGCCTGGGTTGG - Intronic
1039936841 8:42052386-42052408 CTGAGGGCAGGAGTCTGGGTGGG + Intergenic
1040431125 8:47343562-47343584 CTGAGGAAAGCTGCCTGGGGTGG + Intronic
1041027768 8:53704178-53704200 CCGGTGGAAGGTGTCTGGGTCGG + Intergenic
1042333920 8:67610682-67610704 CTGAGGAAGGGAGCCTGGATGGG - Intronic
1043383383 8:79726209-79726231 ATGAGCACAGCTGTCTGGGTGGG + Intergenic
1044413229 8:91908062-91908084 CTGAGCAAAGGGCTCTAGGTGGG + Intergenic
1045568291 8:103343563-103343585 AAGAGGAAAGGTGCCAGGGTGGG + Intergenic
1048775518 8:137941781-137941803 CTGAGGAGAGGTTTATGGCTTGG - Intergenic
1049123736 8:140766403-140766425 CTGAGGAGAGGTCTCTGAATAGG - Intronic
1049435645 8:142585003-142585025 CAGAGGAAGGGGCTCTGGGTTGG + Intergenic
1049519090 8:143079171-143079193 CTGAGGGCAGGTGACTGGGCCGG + Intergenic
1050158401 9:2692405-2692427 CTGAGGAGAGGAGGATGGGTTGG + Intergenic
1051628210 9:19118303-19118325 CTGAGGTAAGATGACTGGGACGG - Exonic
1051676095 9:19559960-19559982 GTGAGGTCAGGTGTTTGGGTCGG - Intronic
1053179883 9:35959978-35960000 CAGGGGAAAGGTGTGTGTGTTGG + Intergenic
1054452816 9:65412529-65412551 TGAAGGAAAGATGTCTGGGTTGG - Intergenic
1054712288 9:68523354-68523376 CTGATTCAAGGGGTCTGGGTTGG - Intronic
1056858696 9:90159327-90159349 ATGAGGAAAAGTATCTGTGTAGG + Intergenic
1057503583 9:95615162-95615184 TAGAGGAAAGGTATCTTGGTTGG - Intergenic
1057851581 9:98570692-98570714 CTGAGGACAGGATTCTGGGTGGG + Intronic
1058640312 9:107077533-107077555 CTGAGGAATGAAGTCTGTGTTGG - Intergenic
1059659627 9:116388197-116388219 CTGCAGGCAGGTGTCTGGGTGGG - Intronic
1060477774 9:123999014-123999036 CTGAGGAAAGGTGTTTTGTGGGG + Intergenic
1187026852 X:15444856-15444878 CTGAGGAAAAGAATCTGGCTGGG + Intronic
1187488210 X:19724803-19724825 GTCAGGGAAGGTGTCTGGGAGGG - Intronic
1187552730 X:20322192-20322214 CTCAGGAAAGAAGTCTAGGTTGG + Intergenic
1187972004 X:24668194-24668216 CTGATGACTGGTGTCTGGGAAGG + Intronic
1189368782 X:40411370-40411392 GACAGGAAAGCTGTCTGGGTAGG + Intergenic
1189564047 X:42221226-42221248 CTGAGGAAAGTTAAATGGGTTGG - Intergenic
1190033561 X:46998244-46998266 CTGTGGAACGGTGTCTGGACTGG - Exonic
1192227695 X:69240775-69240797 CTGGGGAAAGGGGTCAGGGGTGG + Intergenic
1192395492 X:70776747-70776769 TCTAGGAAAGGTGTGTGGGTGGG + Intronic
1192494503 X:71606073-71606095 CTGAAGAAAAGTGTCTTGTTTGG - Intronic
1193691376 X:84648700-84648722 CTGAGGAAAGGTGTAGGAGGAGG + Intergenic
1195372939 X:104197987-104198009 TTGAGGTAAGGTGAGTGGGTAGG - Intergenic
1197106535 X:122723196-122723218 CTCAGGAAAGAAGTCTGGGTTGG - Intergenic
1199753993 X:150847691-150847713 CTCAGGAAAAGGGTCTAGGTTGG - Intronic