ID: 934575969

View in Genome Browser
Species Human (GRCh38)
Location 2:95401868-95401890
Sequence TCTGAGGAAAGGTGTCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 272}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934575969_934575980 21 Left 934575969 2:95401868-95401890 CCACCCAGACACCTTTCCTCAGA 0: 1
1: 0
2: 4
3: 22
4: 272
Right 934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG 0: 1
1: 2
2: 0
3: 2
4: 93
934575969_934575979 15 Left 934575969 2:95401868-95401890 CCACCCAGACACCTTTCCTCAGA 0: 1
1: 0
2: 4
3: 22
4: 272
Right 934575979 2:95401906-95401928 AAACTTCTCAAATAGAAGTCGGG 0: 3
1: 0
2: 0
3: 19
4: 288
934575969_934575978 14 Left 934575969 2:95401868-95401890 CCACCCAGACACCTTTCCTCAGA 0: 1
1: 0
2: 4
3: 22
4: 272
Right 934575978 2:95401905-95401927 AAAACTTCTCAAATAGAAGTCGG 0: 3
1: 0
2: 1
3: 35
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934575969 Original CRISPR TCTGAGGAAAGGTGTCTGGG TGG (reversed) Intergenic
900347156 1:2215290-2215312 TCTCAGGAAGGGTGGCTGAGGGG + Intergenic
900467408 1:2832605-2832627 GCAGAAGAAAGGTGTATGGGGGG + Intergenic
900496986 1:2980238-2980260 TGTGAGGGAAGGTGCCTGGCAGG + Intergenic
900929651 1:5728511-5728533 TCTTAGAACAGGTGTCTGAGTGG - Intergenic
901154164 1:7124260-7124282 ACAGGGGACAGGTGTCTGGGAGG - Intronic
901567360 1:10129562-10129584 GCGGAGGTAACGTGTCTGGGAGG + Intronic
903261781 1:22135576-22135598 GCTGGGGACAGATGTCTGGGTGG + Intronic
903341246 1:22655853-22655875 TCTGAGGAAAGGTTTCCTGGAGG + Intronic
904828932 1:33294527-33294549 TCTTAGGGAAGGAGGCTGGGTGG + Intronic
905884368 1:41483990-41484012 TCTGGGGCAGGGTGTCAGGGTGG - Intronic
906204199 1:43978706-43978728 TCAGAGTAGAGGTTTCTGGGAGG - Intergenic
906615928 1:47232612-47232634 GCTGAAGAAAGGTGTCTGAAAGG - Intergenic
908337870 1:63145721-63145743 GCTGAGTAAAGGAGTTTGGGAGG - Intergenic
908377165 1:63555347-63555369 TTTGAGAAAAGGTGTTTGGATGG + Exonic
908907445 1:69032393-69032415 GCTTGGGAAAGGTGTGTGGGTGG + Intergenic
912580978 1:110720675-110720697 TCTGAGGAAAATTGTCTGGCAGG + Intergenic
917273412 1:173303679-173303701 TCTGGGGAAAGGTTTATGAGAGG - Intergenic
917314822 1:173713772-173713794 TCTGGGGAAAGGGGTAGGGGTGG - Intergenic
918760804 1:188404035-188404057 TCTGAGGAAAAGTGTTAGAGAGG - Intergenic
919439607 1:197615007-197615029 GCTTAGGGAAGGTGCCTGGGAGG - Intronic
922212734 1:223498082-223498104 ACTGAGAAAGGGTGTCTTGGTGG - Intergenic
923285849 1:232494392-232494414 TCTTAGGAAAGATGTCCTGGAGG - Intronic
923765190 1:236886773-236886795 TCTGTGGAAACCTGCCTGGGTGG + Intronic
924018986 1:239760537-239760559 TGTAAGGAAAGGTGTGTAGGTGG - Intronic
924256999 1:242192576-242192598 TTTGAGGAAAAGTGTTTTGGAGG - Intronic
924462408 1:244271021-244271043 TATGAGGAAATGTATCTGTGTGG - Intergenic
1064959198 10:20944702-20944724 GTTGAGCAAAGGTGTCTGTGTGG - Intronic
1065360652 10:24886248-24886270 TCACAGCAAAGCTGTCTGGGAGG - Intronic
1067816252 10:49479689-49479711 TCTGCGGAAGGGGGTGTGGGTGG - Intronic
1069030888 10:63595075-63595097 ACTGGGGGAAGGTGTGTGGGAGG - Intronic
1073195048 10:101683628-101683650 TCTGAAGAAAACTGGCTGGGGGG + Intronic
1073636115 10:105200525-105200547 ACTGAGAAATGGTGTCAGGGTGG + Intronic
1074842576 10:117369990-117370012 TCTGAGTAATAGTGTCTGGGTGG - Intronic
1075057795 10:119233031-119233053 TCTGGGGAAAGGTGTCAGCTTGG + Intronic
1076688059 10:132207042-132207064 TCTGAGGAAATGGGTGTGGCGGG - Intergenic
1076696605 10:132250210-132250232 CCTGAGGACAGGTGTGTGTGAGG + Intronic
1076783207 10:132735806-132735828 TCAGGGGCAGGGTGTCTGGGAGG + Intronic
1077182779 11:1223982-1224004 TCTGTGGAAGGGAGGCTGGGTGG + Intronic
1077483134 11:2825922-2825944 TCTGAGGAAGGGGCTCCGGGTGG - Intronic
1077761451 11:5104179-5104201 TCAGAAAAAAGGTGTCTGGGTGG - Intergenic
1078041966 11:7874103-7874125 CCTGAGAAAGGGTGTGTGGGAGG - Intergenic
1079104279 11:17560500-17560522 TCTGAGCAAAGGTCTAGGGGTGG + Intronic
1081346837 11:41997976-41997998 TCTAAGGGAAGATGTCAGGGTGG + Intergenic
1083227374 11:61293831-61293853 TCTGAGGAAAGCTGTCCCTGGGG + Intronic
1083814981 11:65127726-65127748 GCAGAGGAAAGGGGCCTGGGGGG + Exonic
1083935385 11:65867249-65867271 TCTGAGGGCAGGAGCCTGGGTGG - Intronic
1084772470 11:71352726-71352748 TCTTAGGAGAGGTGGCTGGGAGG - Intergenic
1085034941 11:73293968-73293990 TGTGAGGAGAGGGGTCAGGGAGG + Intronic
1085203158 11:74713871-74713893 CATGAGGACAGGTGACTGGGAGG + Intronic
1085250198 11:75138332-75138354 TCGGATGAAAAGTGTCTGTGGGG + Intronic
1085505244 11:77055098-77055120 TTTGAGGAATGGGGTCTGTGGGG - Intergenic
1085711577 11:78833731-78833753 TCTGAGAAAAGGTGAATCGGGGG + Intronic
1087203632 11:95371240-95371262 CCTGTGGAAATGTATCTGGGGGG + Intergenic
1087611485 11:100439297-100439319 TCTGAGGAAGGCTGGCTGAGGGG + Intergenic
1088744279 11:112792455-112792477 TCAGTGGAAGGGTGTCTGTGGGG + Intergenic
1089682318 11:120125556-120125578 CCTGAGGAAGGGTGGGTGGGTGG + Intronic
1089865668 11:121629082-121629104 TCTGAGGAAAAGGATCTGGGAGG - Intronic
1090276547 11:125424102-125424124 TCTTTGGAGAGGTGTTTGGGGGG + Intronic
1090394650 11:126410856-126410878 TCTGCTGAGAGATGTCTGGGAGG + Intronic
1090420745 11:126573312-126573334 TCTGCGGAAACGTGTGAGGGAGG - Intronic
1091637499 12:2208579-2208601 CCTAAGGAAGGATGTCTGGGTGG + Intronic
1092263579 12:6964916-6964938 ACTGAGAAATGGAGTCTGGGGGG + Intergenic
1093906303 12:24696117-24696139 TCTAGGGAAATGTGTGTGGGGGG + Intergenic
1094158861 12:27368591-27368613 TCTGAAGAAAGGTGTCTAGGAGG + Intronic
1094278489 12:28707520-28707542 TCTGAGAATATGTGTTTGGGTGG + Intergenic
1098031925 12:66264298-66264320 ACAGAGTAAAAGTGTCTGGGAGG - Intergenic
1098095232 12:66947336-66947358 TATGATGACAGGGGTCTGGGAGG - Intergenic
1098153621 12:67574026-67574048 TATGAGGAAAGGAGACTGGCAGG - Intergenic
1098819397 12:75209065-75209087 CCTGGGGAGAGGTGGCTGGGAGG - Intronic
1102895608 12:116595806-116595828 TAGGAGGATAGGTGGCTGGGTGG + Intergenic
1103559639 12:121786642-121786664 AGTCAGGAAAGGTCTCTGGGAGG - Intronic
1104458344 12:128933693-128933715 TCAGGGGAAGGGTGTCTGAGAGG - Intronic
1106660138 13:31790897-31790919 TCTGAGGGTGTGTGTCTGGGTGG + Intronic
1106768156 13:32936603-32936625 TCTAAGGAAAAGTTTCAGGGAGG - Intergenic
1110897258 13:80770300-80770322 GCTCAGGAAAGGCTTCTGGGTGG - Intergenic
1112640567 13:101269375-101269397 TCTGAGGAAAGTAGCCTCGGGGG + Intronic
1113334503 13:109365218-109365240 TCTGAGGAACAGTGACTGAGGGG - Intergenic
1113503955 13:110800178-110800200 TCGGTGGAGAGGAGTCTGGGAGG - Intergenic
1114142314 14:19927464-19927486 TTGGAGGAAAGTAGTCTGGGAGG + Intergenic
1114571274 14:23670734-23670756 TCTATGGGAAGGTGTCTGGGAGG + Intergenic
1114580178 14:23750187-23750209 TCTGAGGAAAGCTGACCAGGTGG + Intergenic
1116239439 14:42322554-42322576 ACTGAGGAAAGCTGTCTGATAGG + Intergenic
1116509502 14:45726436-45726458 TCTCTGGGAAGGTCTCTGGGTGG + Intergenic
1117420811 14:55543162-55543184 GCAGTGGTAAGGTGTCTGGGCGG - Intergenic
1118110164 14:62709404-62709426 TGTGAGGAAAAGTTTCCGGGAGG + Intronic
1118672345 14:68143075-68143097 TCTGTGGACAGGTGACTGGCTGG + Intronic
1119377602 14:74207092-74207114 TCTGAGGAATGGTGGTCGGGGGG + Intergenic
1119545176 14:75466791-75466813 TCTGAGGAATGAAGCCTGGGAGG - Intronic
1121337220 14:93084822-93084844 GCTGAGGAAGGGTGCCTGGCAGG - Intronic
1121738261 14:96233969-96233991 TCTGAGGATCTGTGTCTGTGAGG + Intronic
1122676170 14:103415654-103415676 TGAGGGGAAAGGTCTCTGGGAGG - Intronic
1123998327 15:25734088-25734110 GGTGAGGACAGGAGTCTGGGTGG - Intronic
1125186684 15:36939037-36939059 ATTGAGTAAAGGAGTCTGGGAGG - Intronic
1125510568 15:40290427-40290449 TCTGATCAAAGGTGACAGGGGGG + Intronic
1126099463 15:45110994-45111016 TCTGGGGAGGGGTTTCTGGGTGG + Intronic
1126104064 15:45136043-45136065 TCTGGGGAGGGGTTTCTGGGTGG - Intronic
1126360022 15:47836504-47836526 CCTGAGGACAGGGGTCAGGGAGG + Intergenic
1127099154 15:55546883-55546905 TCTGAGGAAATGGGTGTGGCTGG + Exonic
1128479859 15:68027899-68027921 TCTGAAGAGAGGAGTCTGGCAGG - Intergenic
1129045545 15:72730793-72730815 TCTAAGGAAAGGTATCAAGGTGG - Intronic
1129324995 15:74795104-74795126 TCTGAGCAAAGGTGTCAGGCAGG - Intronic
1129341656 15:74890303-74890325 TCTGAGGCAGGGTGGCGGGGAGG - Intronic
1130628395 15:85539665-85539687 TCTGAGGGAAGGTGTGTGACAGG + Intronic
1131227964 15:90640789-90640811 GCTGAGGACAGATGTCTGAGGGG + Intronic
1131429271 15:92373517-92373539 TCTGGGTATAGGTCTCTGGGTGG + Intergenic
1132322347 15:100935272-100935294 GATCAGGGAAGGTGTCTGGGGGG + Intronic
1132521510 16:392153-392175 TCTGTGGACAGGAGGCTGGGTGG + Intergenic
1132639205 16:970187-970209 GCTGAGGGAAGGTGACTGGCTGG - Intronic
1133606787 16:7395271-7395293 TCTGATGACAGGTGTGTTGGGGG - Intronic
1134319734 16:13151545-13151567 TTTGAGGTAACATGTCTGGGTGG - Intronic
1139389869 16:66600614-66600636 ACTGAGCCAAGGTGTTTGGGGGG - Intergenic
1139548702 16:67661705-67661727 TGTGGGGTAAGGTGTCTGTGGGG + Intronic
1140438611 16:74969156-74969178 TCTGAAGAAAGGTGCCTGCTGGG + Intronic
1141199526 16:81886493-81886515 CCTTAGGATAAGTGTCTGGGAGG - Intronic
1143671370 17:8398143-8398165 TGTGAGGATAGGGGTGTGGGGGG - Intergenic
1143968039 17:10770862-10770884 TCTGAGTAAAGGTGGTTAGGAGG - Intergenic
1144640934 17:16936091-16936113 TCTGAGGGAAGGGCCCTGGGAGG - Intronic
1145393898 17:22478679-22478701 TCTGAGGACTGCTGTCTGTGTGG - Intergenic
1145970560 17:28954040-28954062 TCTGGAAAAAGGTGGCTGGGAGG - Intronic
1146515620 17:33486901-33486923 TCTGAGGGCAGGTGTCAGGGTGG + Intronic
1146727949 17:35170902-35170924 GATGAGGAAAGGAGTCTGGGGGG - Intronic
1146916723 17:36682727-36682749 TCTGAACACAGGTGTGTGGGTGG - Intergenic
1147920717 17:43915327-43915349 TCTGAGGAAAGAGGCCTCGGGGG - Intergenic
1148675509 17:49442521-49442543 ACTGAGGAGTGGAGTCTGGGGGG + Intronic
1149642315 17:58211157-58211179 TCTGTGGAGAAGTGTCAGGGTGG - Intronic
1149806651 17:59624156-59624178 TTTTTAGAAAGGTGTCTGGGGGG - Intronic
1152163204 17:78682566-78682588 CCTGAGAAAGGGTGTGTGGGTGG + Intronic
1152277513 17:79366891-79366913 TCTGAGGACAGTACTCTGGGAGG - Intronic
1152505001 17:80743543-80743565 TCTTGGGAAAGGTGCCTGCGTGG + Intronic
1153119080 18:1699837-1699859 TTGGAGGAAAGGTGTGAGGGAGG + Intergenic
1154083066 18:11276896-11276918 TCTCAGTAAAGGAGCCTGGGAGG + Intergenic
1157357804 18:46951630-46951652 TCTGAGAAAAGATATATGGGAGG + Intronic
1157491449 18:48126675-48126697 TCTGAGGAGAGGTGTGTGCTGGG + Intronic
1157506313 18:48229144-48229166 TCTGGGGCAAGCTGCCTGGGCGG - Intronic
1158000358 18:52611248-52611270 TCAGAGGAAAGATGGCAGGGAGG - Intronic
1158426068 18:57340609-57340631 TGTGAAGGGAGGTGTCTGGGAGG - Intergenic
1160340108 18:78082461-78082483 TCAGAGGAAAGGAGGGTGGGAGG + Intergenic
1162966796 19:14159995-14160017 TCTGAGGAAAGGAGTGGAGGTGG + Intronic
1163101533 19:15100201-15100223 GGTGAGGACAGGTGGCTGGGTGG - Intergenic
1163846687 19:19642175-19642197 TCTGAAGAATGGTGTTTTGGGGG + Intronic
1165404928 19:35623744-35623766 TCTGAGGGAAGGTGGGTGGCAGG + Exonic
1166121769 19:40690915-40690937 TCTGAGGTCAGGTGTCACGGAGG - Intronic
1167576033 19:50317879-50317901 TCTGAGCCCAGGAGTCTGGGAGG - Intronic
925625940 2:5842122-5842144 TAGGAGGAAAGGAGCCTGGGAGG + Intergenic
925771512 2:7287004-7287026 TCTGATCAAAGGTGTCTGAAGGG + Intergenic
926364084 2:12116858-12116880 AATGAGGAAAGGTGATTGGGAGG - Intergenic
926787717 2:16534792-16534814 TTTGTGGAAAGCTGTCTAGGGGG + Intergenic
927205105 2:20604014-20604036 TCTGAGGGCAGGGGTCTTGGAGG - Intronic
930067213 2:47336784-47336806 TTTGTGGAAAGTGGTCTGGGTGG - Intergenic
933266244 2:80183150-80183172 TCCGATAAATGGTGTCTGGGGGG - Intronic
933707440 2:85302577-85302599 TCTGGGGAGAGGTGGGTGGGAGG - Exonic
934575969 2:95401868-95401890 TCTGAGGAAAGGTGTCTGGGTGG - Intergenic
934638141 2:96009725-96009747 TCTAAGGAAAGGTATCTGGGTGG - Intergenic
934795511 2:97095685-97095707 TCTAAGGAAAGGTATCTGGGTGG + Intergenic
935827760 2:106968615-106968637 TCTGAGGAAAGGCATTTAGGTGG - Intergenic
938046248 2:128123888-128123910 TGTGAGAAAAGTTGCCTGGGAGG + Intronic
940281016 2:151989722-151989744 TCTGAGGAGAGGTATCTGGTAGG - Intronic
945061426 2:205912435-205912457 TCTGAGGAAAAGTGCCAGAGTGG + Intergenic
946059536 2:216929897-216929919 ACTTAGGGATGGTGTCTGGGAGG - Intergenic
946490772 2:220146875-220146897 ACTGAAGAAAGGGGTATGGGAGG + Intergenic
947142339 2:227031098-227031120 TTTGAGGAAATATGTCTGGTGGG + Intronic
947874172 2:233457588-233457610 GGTCAGGGAAGGTGTCTGGGAGG + Intronic
948259775 2:236594999-236595021 TGTGGGGAAAGGTGGCTGGCAGG - Intergenic
948500531 2:238389908-238389930 TCTGAGGACAAGTGTGTGTGTGG + Intronic
1168792188 20:585583-585605 GATGAGGCCAGGTGTCTGGGAGG + Intergenic
1170483044 20:16787387-16787409 TCTGAGAAAAGGTGGGAGGGTGG - Intergenic
1171023407 20:21607604-21607626 TTTGAGGAGAGGTGTCTGGGAGG + Intergenic
1171063386 20:21988180-21988202 TCTGAGGATGGCTGTCTTGGTGG + Intergenic
1172370325 20:34384611-34384633 TCTGAGGAAAGTTTGCTGGAAGG + Intronic
1175400629 20:58698120-58698142 CCAGAGGGAAGGCGTCTGGGAGG + Intronic
1177061963 21:16387035-16387057 AATGAGGAAAGGTGTGAGGGAGG - Intergenic
1177883663 21:26722973-26722995 GTAGAGAAAAGGTGTCTGGGAGG - Intergenic
1180090352 21:45531042-45531064 TCTGAGGAAAGGTATCCACGGGG + Intronic
1181392816 22:22595807-22595829 TCTCAGGAAAGAAGTATGGGAGG - Intergenic
1181427246 22:22851623-22851645 TGTGAGGAAAGGTGAGTGGCCGG - Intronic
1181492600 22:23269852-23269874 TCTGCAGAAACCTGTCTGGGTGG - Intronic
1182744680 22:32596504-32596526 TCTGAGGAAGGTGGGCTGGGAGG + Intronic
1183044992 22:35212316-35212338 TCTGAGGAGAAGGGTCTGGAGGG + Intergenic
1184578343 22:45393302-45393324 TTTGAGGCTATGTGTCTGGGTGG + Intronic
1184582666 22:45428086-45428108 AGTGAGGAAAGGTGTTTGGGAGG + Intronic
1184613921 22:45625006-45625028 TCAGAGGATAGGGCTCTGGGTGG - Intergenic
1184671307 22:46013539-46013561 TCCCAGGAAAGGTCGCTGGGGGG + Intergenic
949780701 3:7684342-7684364 TCTGAGGGAGGGTGTCTGAGAGG + Intronic
949964877 3:9347107-9347129 TTTGAGGAAAGATGACAGGGAGG + Intronic
951425073 3:22535265-22535287 TCTGCTGAATGGTTTCTGGGAGG + Intergenic
952684088 3:36130064-36130086 AAGGAGGGAAGGTGTCTGGGGGG - Intergenic
952741778 3:36741211-36741233 ACTGAGGAAGGGTGTCAGGAAGG + Intergenic
953391061 3:42533995-42534017 TATGAGGTCAGGTGGCTGGGAGG + Intronic
954287250 3:49627722-49627744 TCTGAAGTTAGGTGTCTGGGTGG + Intronic
956724830 3:72148450-72148472 TCTGAGGACATCTGTGTGGGTGG - Intergenic
958996777 3:100914691-100914713 TGTGGGGAAAGGGGTATGGGAGG + Intronic
961507320 3:127378612-127378634 TCTGAGGAAAGGAGTCTCAGGGG - Intergenic
961661351 3:128470228-128470250 GCTCAGGAAACGTGTGTGGGTGG - Intergenic
962138189 3:132760162-132760184 TTTGTGGTAAGGTGTATGGGGGG - Intergenic
962274273 3:134000344-134000366 ACTGAGGAGAGGGGTCAGGGAGG + Intronic
964498545 3:157322597-157322619 TGTGAAGAAATGTGTCTGTGAGG + Intronic
964777275 3:160292238-160292260 TCTGACGAAATGTGACTAGGTGG - Intronic
967120418 3:186377942-186377964 ACTGAGGCAAGGCCTCTGGGTGG - Intergenic
968234745 3:197024895-197024917 TGGGAAGAAGGGTGTCTGGGAGG + Intronic
968241267 3:197088479-197088501 CCTGCGAAAAGGTGTGTGGGAGG - Intronic
969168322 4:5337388-5337410 TTTGAGAAAAGGTATATGGGAGG - Intronic
969505057 4:7580865-7580887 TCTGACGAAAGTTTACTGGGAGG + Intronic
969893023 4:10277056-10277078 TCTGAGGAAAGCTTTCTTTGAGG + Intergenic
970450513 4:16162249-16162271 TCTGTGGGAGGGTGTCTGTGGGG - Exonic
972675932 4:41258992-41259014 TCAGAGGCAAGGCCTCTGGGAGG + Intronic
972862754 4:43191169-43191191 TCTCAGGAAAGTCCTCTGGGAGG + Intergenic
975229606 4:71916558-71916580 TCTGAGGGGAGGATTCTGGGAGG + Intergenic
975315465 4:72947031-72947053 TCTTAGGAAAGGTATCAGGTTGG + Intergenic
975858883 4:78654903-78654925 TCTGAGCAATAGTGTCTGAGGGG + Intergenic
976770618 4:88648361-88648383 TCTGAGAAAAGCAGTATGGGAGG + Intronic
977124999 4:93154304-93154326 TCTCTGGAAAGGTGTTAGGGTGG - Intronic
979971351 4:127139732-127139754 TCCAAGGACAGGGGTCTGGGGGG + Intergenic
980951326 4:139381000-139381022 TCTCCAGAAAGGTGTCTGTGAGG - Intronic
981194977 4:141908827-141908849 TCTGAGGTAAGGCCTGTGGGTGG + Intergenic
981657558 4:147129284-147129306 TCTGAAGAAAGGAGTATGGGTGG + Intergenic
982118434 4:152116758-152116780 TGTGGGGAAAGGGGTGTGGGAGG - Intergenic
983268183 4:165530075-165530097 TCTGAGGAGATGGGACTGGGTGG - Intergenic
984709809 4:182875662-182875684 TCTGAGGCAGGGTGTGTGGGAGG + Intergenic
987929228 5:24382207-24382229 TCCGAGGAAAGGTATCTCAGTGG + Intergenic
988630161 5:32920801-32920823 TCTGGGGATAGGTATTTGGGGGG - Intergenic
989095394 5:37777041-37777063 TCTGGAGAAAAGTTTCTGGGCGG + Intergenic
989181065 5:38577557-38577579 ACTCTGGGAAGGTGTCTGGGAGG - Intronic
990402471 5:55452660-55452682 TTTTAGGAAAGGTTTCTTGGAGG - Intronic
991187931 5:63832307-63832329 TCTGATGAAAGGTTTCTGGAGGG + Intergenic
992479099 5:77132800-77132822 TCTAAGGAAAGGTCTATGGGAGG + Intergenic
992626372 5:78639112-78639134 TGTGTGGACAGGTGGCTGGGGGG - Intronic
993133606 5:83929621-83929643 TGGGAGGAAAGGTGTAGGGGAGG + Intergenic
994047147 5:95322996-95323018 TCTGAGAAAGGGTGTATGAGAGG - Intergenic
994140740 5:96338557-96338579 TCAGAGCAAAGTTGTTTGGGGGG - Intergenic
996520188 5:124417651-124417673 TGAGAGGAAAGGTCTCTGGTAGG - Intergenic
998107697 5:139478711-139478733 TCTGAGGAAAGAAGTGAGGGAGG - Intronic
998570286 5:143250890-143250912 TCTGGGGAAAGATGTTTTGGGGG + Intergenic
999294992 5:150453670-150453692 TCTGAGGAAAGGGGTGGGGTGGG + Intergenic
1000253612 5:159517840-159517862 TTTGAGGAAAGGTCTCTGTATGG - Intergenic
1003041233 6:2689155-2689177 TCTGAGAAAGAGTGTCAGGGCGG + Intronic
1003338411 6:5196575-5196597 TCTGAGGAGAGGCATCTGGATGG - Intronic
1003387025 6:5678350-5678372 TGGGAGGAAAGGTGGATGGGAGG + Intronic
1006321319 6:33321275-33321297 TCCAAGGAGAGGTGTGTGGGAGG + Exonic
1006557420 6:34879736-34879758 GCTGAGGAAAGGAATCAGGGAGG + Intronic
1007079339 6:39087630-39087652 TCTGGGGAAAGGTTTTGGGGAGG - Exonic
1007744482 6:44034920-44034942 TTTGAGGTAAGAGGTCTGGGTGG - Intergenic
1008046779 6:46859298-46859320 TCTGTTGATAGGTTTCTGGGTGG + Exonic
1008546376 6:52587268-52587290 TGTGTAGAAAGGTGGCTGGGTGG + Intergenic
1008680515 6:53867017-53867039 TCAGAGGCAAGATGTCTTGGTGG + Intronic
1009381087 6:63030796-63030818 TCTTCAGAAAGGTGTCTGGAAGG - Intergenic
1011752722 6:90469520-90469542 CCAGGGGAAGGGTGTCTGGGCGG - Intergenic
1014271760 6:119344465-119344487 TCTGGGGAAGGGCCTCTGGGTGG + Intronic
1014708224 6:124774508-124774530 TCTGAGGGGAGATGTCTGGTGGG + Intronic
1017415330 6:154214323-154214345 TCTGGGGGAAGGTGAATGGGTGG - Intronic
1017526214 6:155243353-155243375 GCAGAGGAAGGGCGTCTGGGTGG - Intronic
1021862768 7:24923399-24923421 TCTGAGGAAGGGAATCTGGTTGG - Intronic
1023582921 7:41701002-41701024 TTTGAAGAGAGGTGTCTGTGAGG - Intronic
1024677538 7:51650551-51650573 CCTGATGGAAGGTGTTTGGGTGG + Intergenic
1026299440 7:69084307-69084329 TTTGAGGACAGGAGTTTGGGAGG - Intergenic
1029131628 7:98335775-98335797 GCTGAGGGAAGGTGTCCCGGTGG - Intronic
1029242200 7:99171278-99171300 TCTGAGAGAAGGTGCATGGGAGG - Intergenic
1030220333 7:107091942-107091964 TTTGGGGAAAAGTGTCAGGGAGG + Intronic
1031632550 7:124062197-124062219 CCTAAGGAAGGGTGTGTGGGAGG + Intergenic
1032462965 7:132125652-132125674 TCTCAGGACAGGTGACTGGGAGG - Exonic
1032505400 7:132430775-132430797 TCTGAGCAAAGATGGTTGGGTGG + Intronic
1032665705 7:134034171-134034193 TCTGGAGAAAGTTCTCTGGGTGG + Intronic
1034901308 7:154909658-154909680 GCTGTGGAAGGCTGTCTGGGAGG - Intergenic
1035062637 7:156080286-156080308 GCTGTGGACAGGTGACTGGGGGG - Intergenic
1035114996 7:156517004-156517026 TGTGAGGGAGGCTGTCTGGGAGG + Intergenic
1035266938 7:157694211-157694233 TTTGAGGAAAGATGGGTGGGAGG + Intronic
1037775425 8:21832535-21832557 AATGAGGAATGGTGTTTGGGGGG - Intergenic
1038504292 8:28071277-28071299 AGTGAGGAAAGGCCTCTGGGAGG + Intronic
1038671159 8:29584338-29584360 TCAGAGGAAAGGTTTTTGGATGG + Intergenic
1038904769 8:31887693-31887715 TCTGAGGAAAGATGGCTGTAAGG + Intronic
1039936840 8:42052385-42052407 ACTGAGGGCAGGAGTCTGGGTGG + Intergenic
1039953729 8:42191505-42191527 TCTGAGCAGAGGTATCTGGCCGG - Intronic
1040806425 8:51401880-51401902 ACTCAGGAAAGGTGACGGGGTGG + Intronic
1040874874 8:52140942-52140964 TGTGGGAAAAGGTGTCTGGCTGG + Intronic
1044274784 8:90286373-90286395 TGAGAGAAAAGATGTCTGGGTGG - Intergenic
1046817499 8:118600481-118600503 ATTGAGGAAAGGTGTCTTTGAGG + Intronic
1048003779 8:130401647-130401669 TATAAGGAAAGTTGTCTGGGTGG - Intronic
1051282297 9:15454540-15454562 ACTCAGGAAGGATGTCTGGGAGG + Intronic
1051350850 9:16196709-16196731 CCTGAGGAAAGGTCTGTGGTCGG + Intergenic
1051474526 9:17490344-17490366 TTAGATGAAAGGGGTCTGGGTGG + Intronic
1055991687 9:82113040-82113062 TGTGAGGAAAGATGACTGGCAGG + Intergenic
1056460192 9:86801846-86801868 TGTGAGGAAATGTGTCATGGTGG + Intergenic
1057851580 9:98570691-98570713 TCTGAGGACAGGATTCTGGGTGG + Intronic
1059401756 9:114075020-114075042 TTCTAGGAAAGGTGTCTGTGAGG - Exonic
1060250982 9:121986600-121986622 TCTCAGGACAGATTTCTGGGTGG + Intronic
1060477773 9:123999013-123999035 GCTGAGGAAAGGTGTTTTGTGGG + Intergenic
1060783536 9:126431423-126431445 TTGGAGGAAAAGTGCCTGGGGGG + Intronic
1062093444 9:134690515-134690537 AATGAGAAGAGGTGTCTGGGAGG + Intronic
1062613205 9:137384091-137384113 CCTGAGGACAGGAGCCTGGGTGG + Intronic
1185498762 X:582063-582085 TCTGAAGACAGATCTCTGGGTGG + Intergenic
1187488211 X:19724804-19724826 AGTCAGGGAAGGTGTCTGGGAGG - Intronic
1187771614 X:22704883-22704905 TCTAAGAAAAGGCGTGTGGGTGG + Intergenic
1187886529 X:23893922-23893944 TCTCTGGAAAGGGGGCTGGGGGG + Intronic
1188993994 X:36859766-36859788 TCTGAGAAAAGGAGTCGGGAGGG - Intergenic
1193151278 X:78127168-78127190 CCTGAGAAAGGGTGCCTGGGAGG + Exonic
1195280862 X:103331073-103331095 TCTGAGGATAGGAGTCGGGAAGG + Intronic
1195660358 X:107371907-107371929 TCAGAGGCCAGGTGTCGGGGTGG - Intergenic
1196207542 X:112957828-112957850 GCAAAGGAAAGGTGTGTGGGTGG - Intergenic
1196673360 X:118393085-118393107 TCTGGAGTAAGGTGTCTTGGGGG - Exonic
1196983686 X:121243751-121243773 TCTGAGGTATGTGGTCTGGGAGG + Intergenic